Homologs in group_3050

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_18255 EHELCC_18255 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_18180 NLDBIP_18180 100.0 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_18375 LHKJJB_18375 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_18110 HKOGLL_18110 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS01750 F4V73_RS01750 78.6 Morganella psychrotolerans - LysR substrate-binding domain-containing protein

Distribution of the homologs in the orthogroup group_3050

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3050

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9F6 6.14e-35 131 32 7 296 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 6.14e-35 131 32 7 296 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 6.14e-35 131 32 7 296 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
Q57083 7.11e-34 128 30 5 289 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P46068 1.31e-33 128 31 4 267 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P45099 1.86e-32 124 29 5 295 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55576 1.09e-30 120 31 5 286 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P52658 6.42e-29 115 30 5 287 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P52676 6.66e-29 115 28 4 288 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P24734 2.85e-28 113 31 7 288 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52660 9.81e-28 112 28 5 292 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P52683 5.81e-27 110 30 6 272 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
P14145 1.25e-26 108 31 9 289 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P34818 4.48e-25 105 32 6 255 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P05051 4.31e-24 102 29 6 291 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P11720 3.22e-23 99 32 9 263 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P12529 3.47e-23 99 29 5 265 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
O69772 5.64e-23 99 31 4 254 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
Q9JXW7 2.18e-20 92 29 5 262 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P45461 2.42e-20 92 27 5 270 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
Q9JPU9 8.79e-20 90 29 4 260 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P42507 4.73e-19 88 27 7 277 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P30864 1.96e-18 87 26 5 290 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
A0A0H2ZDG9 3.55e-17 83 28 6 264 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8X4M5 4.28e-14 74 37 1 117 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P25544 8.75e-14 73 34 5 144 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P37641 8.92e-14 73 31 1 139 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P27111 2.08e-13 72 36 1 117 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P52689 1.04e-12 70 33 1 138 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P42722 1.32e-11 67 34 4 143 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P67662 3.8e-11 66 26 3 194 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 3.8e-11 66 26 3 194 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 3.8e-11 66 26 3 194 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
Q5N5I5 1.01e-10 65 32 3 135 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 1.01e-10 65 32 3 135 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45463 1.34e-10 64 28 1 150 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q1R6S1 1.38e-10 64 28 1 150 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 1.38e-10 64 28 1 150 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TD46 1.48e-10 64 28 1 150 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P76250 1.98e-10 63 30 1 150 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P94387 7.64e-10 62 35 4 136 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q8XBK9 8.53e-10 62 27 1 150 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P77333 1.16e-09 61 23 6 278 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P39592 1.3e-09 61 26 1 128 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P0A9G1 8.93e-09 59 25 7 247 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 8.93e-09 59 25 7 247 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 8.93e-09 59 25 7 247 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P0A2Q4 1.02e-08 58 24 10 310 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 1.02e-08 58 24 10 310 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P77700 1.1e-08 58 42 0 70 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
Q47005 1.31e-08 58 32 3 140 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P75836 1.33e-08 58 27 4 185 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P20668 2.07e-08 58 31 4 153 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P55181 2.2e-08 57 29 6 154 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P9WMF5 2.46e-08 57 42 3 102 1 lysG HTH-type transcriptional regulator LysG Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF4 2.46e-08 57 42 3 102 3 lysG HTH-type transcriptional regulator LysG Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67666 2.46e-08 57 42 3 102 3 lysG HTH-type transcriptional regulator LysG Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8KA72 2.85e-08 57 24 3 194 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q55459 4.11e-08 57 31 4 135 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q08597 9.47e-08 55 30 3 140 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P71318 2.16e-07 55 32 5 131 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P52659 2.53e-07 54 33 7 171 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
P52665 2.59e-07 52 35 2 113 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
O32255 2.63e-07 54 30 8 190 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
A0T0V5 3.34e-07 54 28 5 150 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P70773 3.46e-07 54 26 10 267 3 argP HTH-type transcriptional regulator ArgP Aeromonas salmonicida
O35038 5.15e-07 53 25 3 143 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P0A4T7 7.46e-07 53 29 2 145 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 7.46e-07 53 29 2 145 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q04778 8.95e-07 53 27 2 150 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P72131 1.15e-06 52 27 6 270 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P20667 1.66e-06 52 32 5 129 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
P52696 2.18e-06 52 27 6 181 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
A0T0G2 2.81e-06 51 26 5 131 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P77744 3.19e-06 51 36 0 76 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P45600 3.39e-06 51 29 5 133 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P06614 3.42e-06 51 29 5 133 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9X725 3.67e-06 51 29 2 128 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P0ACQ4 4.25e-06 50 29 3 131 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 4.25e-06 50 29 3 131 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 4.25e-06 50 29 3 131 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
Q85G62 4.7e-06 50 31 6 152 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
O34827 6.5e-06 50 27 3 143 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P44821 7.5e-06 50 41 0 51 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52675 9.54e-06 47 33 2 110 3 cysB HTH-type transcriptional regulator CysB (Fragment) Thiocapsa roseopersicina
Q6B936 1.01e-05 50 31 5 144 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P0A2Q2 1.3e-05 49 45 0 46 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 1.3e-05 49 45 0 46 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P05827 1.46e-05 49 45 0 46 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P96194 1.47e-05 47 41 2 80 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q01610 2.06e-05 48 25 3 188 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B4TNR5 2.31e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
P0A2Q0 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5FN59 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B5EZ22 2.4e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B4SYF7 2.42e-05 48 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P0A9F3 2.94e-05 48 28 4 126 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 2.94e-05 48 28 4 126 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 2.94e-05 48 28 4 126 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
B7NF72 3.73e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NU32 3.73e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LUJ5 3.77e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3YVK2 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 3.91e-05 48 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R4H3 3.94e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 3.94e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 3.94e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 3.94e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 3.94e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q329U3 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 3.98e-05 47 34 0 84 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P43011 4.37e-05 47 24 1 141 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2CI69 4.99e-05 47 26 4 150 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
B2TU26 5.89e-05 47 35 0 76 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q06610 6.53e-05 47 29 4 151 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
O34685 7.18e-05 47 26 1 119 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P96725 7.21e-05 47 23 10 277 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
B4E8S9 7.25e-05 47 38 2 73 1 ssuR HTH-type transcriptional regulator SsuR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P48271 8.32e-05 47 32 5 131 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P77309 9.13e-05 47 26 1 121 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
B4F0Q1 0.000109 46 41 1 70 3 argP HTH-type transcriptional regulator ArgP Proteus mirabilis (strain HI4320)
P37459 0.000118 46 24 8 199 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07774 0.00012 46 27 6 172 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P39376 0.000127 46 29 1 109 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
O33812 0.000144 46 27 4 133 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
Q4G384 0.000147 46 29 3 114 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
A5F9F9 0.000152 46 26 1 122 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D1 0.000153 46 26 1 122 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37499 0.000157 46 24 2 135 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
A7MR91 0.000208 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Cronobacter sakazakii (strain ATCC BAA-894)
C6DF35 0.000221 45 41 1 70 3 argP HTH-type transcriptional regulator ArgP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D092 0.000223 45 41 1 70 3 argP HTH-type transcriptional regulator ArgP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P52693 0.00023 45 26 5 140 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0ACR2 0.000276 45 29 1 118 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 0.000276 45 29 1 118 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
B2VF18 0.000295 45 40 1 70 3 argP HTH-type transcriptional regulator ArgP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8APC5 0.000295 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WE66 0.000298 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Enterobacter sp. (strain 638)
A6TDS6 0.000301 45 30 2 118 3 argP HTH-type transcriptional regulator ArgP Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7NHX5 0.000306 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5RE25 0.000312 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXJ1 0.000312 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella enteritidis PT4 (strain P125109)
B5FUH7 0.000312 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella dublin (strain CT_02021853)
A9MRG1 0.000312 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P58509 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58508 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella typhi
B4TV33 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella schwarzengrund (strain CVM19633)
B5BFM9 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi A (strain AKU_12601)
C0PY38 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi C (strain RKS4594)
A9N3P8 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJH0 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T5G4 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella newport (strain SL254)
B4THE6 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella heidelberg (strain SL476)
Q57K51 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella choleraesuis (strain SC-B67)
B5F5I9 0.000315 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Salmonella agona (strain SL483)
Q3YXV6 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella sonnei (strain Ss046)
P0A8S4 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella flexneri
Q0T0Y4 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella flexneri serotype 5b (strain 8401)
Q32BX8 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella dysenteriae serotype 1 (strain Sd197)
Q31WH5 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella boydii serotype 4 (strain Sb227)
B2U0T2 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R7B4 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain UTI89 / UPEC)
B1LDC0 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain SMS-3-5 / SECEC)
B6I748 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain SE11)
B7N7G1 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8S1 0.000318 45 39 1 71 1 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain K12)
B1IT87 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8S2 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TDT7 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A456 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O9:H4 (strain HS)
B1XEK1 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain K12 / DH10B)
C5A0I6 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain K12 / MC4100 / BW2952)
B7LYT3 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O8 (strain IAI1)
B7MZ67 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O81 (strain ED1a)
B5YQA9 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8S3 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O157:H7
B7LFH3 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli (strain 55989 / EAEC)
B7MMA1 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHW2 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZR24 0.000318 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LPC9 0.000323 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5XUC3 0.000329 45 39 1 71 3 argP HTH-type transcriptional regulator ArgP Klebsiella pneumoniae (strain 342)
Q7N185 0.000354 45 40 1 70 3 argP HTH-type transcriptional regulator ArgP Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9HWH8 0.000364 45 35 0 62 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2NRD9 0.000404 45 41 1 70 3 argP HTH-type transcriptional regulator ArgP Sodalis glossinidius (strain morsitans)
A1JPP6 0.000409 45 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JNR6 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q666Q6 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TI95 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pestis (strain Pestoides F)
Q1CEY8 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4J7 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pestis bv. Antiqua (strain Angola)
P58510 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pestis
B2K0R5 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB53 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pestis bv. Antiqua (strain Antiqua)
A7FF10 0.000459 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JQ39 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000463 44 26 3 183 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GIT0 0.000469 44 40 1 70 3 argP HTH-type transcriptional regulator ArgP Serratia proteamaculans (strain 568)
P52595 0.000474 44 30 5 150 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
Q765S2 0.000487 44 43 0 58 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P33634 0.000493 44 27 5 151 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
Q8FK66 0.000493 44 42 0 59 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 0.000493 44 42 0 59 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RF30 0.000498 44 42 0 59 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 0.000498 44 42 0 59 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P0ACR0 0.000507 44 42 0 59 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 0.000507 44 42 0 59 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P52678 0.00053 44 39 0 73 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P52669 0.000773 44 25 5 167 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
O52399 0.000785 43 38 1 70 3 argP HTH-type transcriptional regulator ArgP Edwardsiella ictaluri (strain 93-146)
A1JI47 0.000789 43 25 3 162 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P52666 0.000848 43 33 1 98 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
Q6HPH4 0.00085 43 24 0 121 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
P94678 0.000893 43 33 1 80 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
O33945 0.001 43 26 2 129 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
Q81VJ1 0.001 43 24 0 121 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
Q47141 0.001 43 32 0 86 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_18220
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 10240 - 11142 (strand: -1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession contig_33
Length 35117 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3050
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03566 LysR family transcriptional regulator, glycine cleavage system transcriptional activator Biofilm formation - Escherichia coli -

Protein Sequence

MNRYPPMKALLAFEASVRLGSFIRAAEFLHVTPGAVSQQIKKLEDELGVMLFLREIRKLTVTETGQKYYRLIQPALEQIRAAGETIRYAARHTLTLSMPPGLASKWFSPRMSDFVRTFPGLDLHLNATAALVSLEKDNVDLAVRYTDLSRTQPARVLLSDAPCRLFCHPAYAARLSLHSPADLKNAVLLHTTLYPYWDSWLEHYAGIASGGTPFTAGLHFDQFLLAIDAAVHQQGILIANDFLLEHELAQQTLIPLFPELTLHSGKGFYLLHNRHSADQAMISAVSDWFCHAFAHTAENT

Flanking regions ( +/- flanking 50bp)

GCTGTGCTACAACCGATTTAAATTACCTTATGAAAGAGAAAAACTATTTCATGAACCGTTATCCGCCGATGAAAGCCCTGCTGGCCTTTGAAGCCAGCGTCCGGCTCGGCAGCTTTATCAGAGCGGCAGAATTCCTGCATGTCACACCGGGTGCGGTCAGTCAGCAGATAAAAAAGCTGGAGGATGAGCTGGGCGTGATGTTGTTTCTGCGTGAGATCCGCAAACTGACGGTGACAGAGACAGGACAGAAATACTATCGCTTGATTCAGCCCGCGCTGGAACAGATCCGCGCCGCCGGTGAAACAATCCGCTATGCGGCACGCCATACCCTGACTCTGTCCATGCCGCCCGGGCTGGCCTCCAAATGGTTCTCTCCCAGGATGAGTGATTTTGTCCGCACTTTTCCGGGATTGGATCTGCATCTGAATGCCACAGCAGCGCTGGTTTCGCTGGAAAAAGACAATGTGGATCTGGCTGTCCGCTATACTGATTTATCCCGCACGCAACCGGCACGGGTGCTGTTATCTGACGCCCCCTGCCGTCTGTTTTGTCATCCCGCTTATGCCGCGCGGCTGTCACTTCACAGCCCGGCAGATCTGAAAAACGCGGTACTGCTGCACACCACACTCTATCCTTACTGGGACAGCTGGCTGGAACACTATGCCGGGATAGCGTCCGGCGGCACACCGTTCACCGCCGGACTGCATTTTGATCAGTTCTTACTGGCGATTGATGCGGCGGTGCATCAGCAGGGTATTCTGATTGCCAATGATTTCCTGCTGGAACACGAGCTGGCACAACAGACCCTTATTCCTTTGTTTCCGGAACTGACACTGCATTCCGGCAAAGGATTTTATCTGCTGCATAACCGCCACAGTGCCGATCAGGCGATGATCAGCGCCGTCAGTGACTGGTTTTGTCATGCATTTGCTCACACAGCGGAGAATACATAATAGAACCAGAATCTGTCACTGTGTGCCTTTTTCCTCTGCACCGCAGACGG