Homologs in group_2155

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_16255 EHELCC_16255 100.0 Morganella morganii S2 pyrE Orotate phosphoribosyltransferase
NLDBIP_17085 NLDBIP_17085 100.0 Morganella morganii S4 pyrE Orotate phosphoribosyltransferase
LHKJJB_17005 LHKJJB_17005 100.0 Morganella morganii S3 pyrE Orotate phosphoribosyltransferase
HKOGLL_16835 HKOGLL_16835 100.0 Morganella morganii S5 pyrE Orotate phosphoribosyltransferase
F4V73_RS17380 F4V73_RS17380 93.0 Morganella psychrotolerans pyrE orotate phosphoribosyltransferase
PMI_RS15585 PMI_RS15585 79.4 Proteus mirabilis HI4320 pyrE orotate phosphoribosyltransferase

Distribution of the homologs in the orthogroup group_2155

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2155

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MY25 1.89e-138 389 85 0 213 3 pyrE Orotate phosphoribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MQA9 2.55e-133 375 82 0 213 3 pyrE Orotate phosphoribosyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q83J15 2.49e-131 370 79 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella flexneri
B7MFK3 5.38e-131 370 80 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LVK4 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NEU6 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A7E3 9.1e-131 369 79 0 213 1 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain K12)
B1IYV8 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A7E4 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBG7 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6A4 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O9:H4 (strain HS)
B1X976 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZXN4 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M4C7 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O8 (strain IAI1)
B7N1U3 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O81 (strain ED1a)
B7L766 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7UM49 9.1e-131 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LK79 1.51e-130 369 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NQ04 2.14e-130 368 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q0SYG9 3.83e-130 368 79 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella flexneri serotype 5b (strain 8401)
P08870 4.66e-130 367 79 0 213 1 pyrE Orotate phosphoribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TZY3 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella schwarzengrund (strain CVM19633)
C0Q1X4 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella paratyphi C (strain RKS4594)
A9MVN7 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SXE3 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella newport (strain SL254)
B4T9Y5 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella heidelberg (strain SL476)
B5RG81 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5G6 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FM65 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella dublin (strain CT_02021853)
Q57IA0 4.66e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella choleraesuis (strain SC-B67)
Q31UY4 4.98e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TTV6 4.98e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YWE0 4.98e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XD99 4.98e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O157:H7
Q8Z2H5 5.03e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella typhi
A6TFN4 9e-130 367 79 0 213 3 pyrE Orotate phosphoribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5B9D0 1.2e-129 366 80 0 213 3 pyrE Orotate phosphoribosyltransferase Edwardsiella ictaluri (strain 93-146)
Q329L4 1.46e-129 366 79 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B5EXE6 2.14e-129 366 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella agona (strain SL483)
B6I3L9 2.58e-129 365 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli (strain SE11)
A7ZTJ3 2.58e-129 365 79 0 213 3 pyrE Orotate phosphoribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YW04 2.61e-129 365 78 0 213 3 pyrE Orotate phosphoribosyltransferase Shigella sonnei (strain Ss046)
A4W507 3.01e-129 365 80 0 213 3 pyrE Orotate phosphoribosyltransferase Enterobacter sp. (strain 638)
B5XTG0 4.04e-129 365 79 0 213 3 pyrE Orotate phosphoribosyltransferase Klebsiella pneumoniae (strain 342)
B5BI16 1.66e-128 363 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PC26 1.66e-128 363 79 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C6DIC6 2.72e-128 363 78 0 213 3 pyrE Orotate phosphoribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4F0W4 5.69e-128 362 79 0 213 3 pyrE Orotate phosphoribosyltransferase Proteus mirabilis (strain HI4320)
A1JHW8 7.89e-128 362 79 0 213 3 pyrE Orotate phosphoribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q87T92 1.76e-127 361 78 0 213 3 pyrE Orotate phosphoribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8GLE9 2.09e-127 361 78 0 213 3 pyrE Orotate phosphoribosyltransferase Serratia proteamaculans (strain 568)
Q7MPT2 2.36e-127 360 79 0 213 3 pyrE Orotate phosphoribosyltransferase Vibrio vulnificus (strain YJ016)
Q8DDX5 2.78e-127 360 79 0 213 3 pyrE Orotate phosphoribosyltransferase Vibrio vulnificus (strain CMCP6)
Q9KVD5 3.83e-127 360 78 0 213 1 pyrE Orotate phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A9MKN3 5.03e-127 360 78 0 213 3 pyrE Orotate phosphoribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VF77 5.14e-126 357 77 0 213 3 pyrE Orotate phosphoribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8E9L5 6.23e-126 357 78 0 214 3 pyrE Orotate phosphoribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B7VHJ8 8.61e-126 357 77 0 213 3 pyrE Orotate phosphoribosyltransferase Vibrio atlanticus (strain LGP32)
B1JQX7 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66GE0 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSE1 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CCZ8 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R670 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJP7 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pestis
B2JYM9 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C263 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCT0 8.75e-126 357 77 0 215 3 pyrE Orotate phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5FFE3 6.91e-125 354 77 0 213 3 pyrE Orotate phosphoribosyltransferase Aliivibrio fischeri (strain MJ11)
Q6LVN7 1.51e-124 353 76 0 213 3 pyrE Orotate phosphoribosyltransferase Photobacterium profundum (strain SS9)
A4SHC9 2.46e-121 345 74 1 217 3 pyrE Orotate phosphoribosyltransferase Aeromonas salmonicida (strain A449)
Q3IJI1 1.39e-118 338 75 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
B4S200 1.92e-114 328 71 0 213 3 pyrE Orotate phosphoribosyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q48Q10 1.17e-113 326 69 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B0BT67 1.38e-113 326 71 0 213 3 pyrE Orotate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H0G3 1.38e-113 326 71 0 213 3 pyrE Orotate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZ36 1.38e-113 326 71 0 213 3 pyrE Orotate phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4ZZY3 1.96e-113 325 68 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q88BD7 1.16e-112 323 68 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B8F557 1.29e-112 323 70 0 214 3 pyrE Orotate phosphoribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q9CJW4 1.1e-109 316 68 0 214 3 pyrE Orotate phosphoribosyltransferase Pasteurella multocida (strain Pm70)
A6VSX4 2.02e-109 315 67 1 215 3 pyrE Orotate phosphoribosyltransferase Marinomonas sp. (strain MWYL1)
A4VGS1 4.16e-109 315 67 1 215 3 pyrE Orotate phosphoribosyltransferase Stutzerimonas stutzeri (strain A1501)
Q48AN2 4.29e-108 312 65 1 221 3 pyrE Orotate phosphoribosyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A5UG90 3.25e-107 310 66 0 213 3 pyrE Orotate phosphoribosyltransferase Haemophilus influenzae (strain PittGG)
Q4QNR7 3.25e-107 310 66 0 213 3 pyrE Orotate phosphoribosyltransferase Haemophilus influenzae (strain 86-028NP)
P43855 3.62e-107 310 66 0 213 1 pyrE Orotate phosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UAL7 3.62e-107 310 66 0 213 3 pyrE Orotate phosphoribosyltransferase Haemophilus influenzae (strain PittEE)
Q65W02 1.15e-106 308 66 0 213 3 pyrE Orotate phosphoribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C1DI51 1.85e-105 305 69 0 213 3 pyrE Orotate phosphoribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C3K476 5.77e-104 301 67 1 214 3 pyrE Orotate phosphoribosyltransferase Pseudomonas fluorescens (strain SBW25)
P50587 8.36e-104 301 69 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02E31 8.36e-104 301 69 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3K4M3 1.84e-103 300 67 1 214 3 pyrE Orotate phosphoribosyltransferase Pseudomonas fluorescens (strain Pf0-1)
B7V5M2 3.08e-103 300 68 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas aeruginosa (strain LESB58)
Q7VKV3 7.72e-103 298 65 0 213 3 pyrE Orotate phosphoribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VED8 1.49e-102 298 68 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas aeruginosa (strain PA7)
Q4K3R9 7.22e-102 296 66 1 214 3 pyrE Orotate phosphoribosyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1J4L6 1.41e-101 295 66 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas putida (strain W619)
Q1I2T8 1.41e-101 295 66 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas entomophila (strain L48)
Q88C92 6.8e-101 293 66 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KQ92 6.8e-101 293 66 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas putida (strain GB-1)
A5WB07 6.8e-101 293 66 0 213 3 pyrE Orotate phosphoribosyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A6VLF2 4.89e-100 291 63 0 213 3 pyrE Orotate phosphoribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8GTF1 8.26e-100 291 65 0 213 3 pyrE Orotate phosphoribosyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1TY28 1.63e-94 277 60 1 213 3 pyrE Orotate phosphoribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3J6V6 7.61e-94 276 60 1 215 3 pyrE Orotate phosphoribosyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q2S8N8 4.79e-92 271 57 0 214 3 pyrE Orotate phosphoribosyltransferase Hahella chejuensis (strain KCTC 2396)
Q1QSL0 3.68e-91 270 59 2 228 3 pyrE Orotate phosphoribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q21EF2 5.61e-91 268 62 2 215 3 pyrE Orotate phosphoribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B3PG74 2.18e-90 267 61 0 215 3 pyrE Orotate phosphoribosyltransferase Cellvibrio japonicus (strain Ueda107)
C1D6F5 4.89e-88 261 56 1 213 3 pyrE Orotate phosphoribosyltransferase Laribacter hongkongensis (strain HLHK9)
C4K3W9 4.33e-87 259 61 0 213 3 pyrE Orotate phosphoribosyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q3SM42 1.27e-86 258 55 1 213 3 pyrE Orotate phosphoribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q7WEU9 7.06e-86 256 56 2 215 3 pyrE Orotate phosphoribosyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NQ92 1.28e-85 255 56 1 214 3 pyrE Orotate phosphoribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7W3H5 1.62e-85 255 56 2 215 3 pyrE Orotate phosphoribosyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VSN4 2.54e-85 254 56 2 215 3 pyrE Orotate phosphoribosyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2YCI8 5.38e-83 249 56 1 211 3 pyrE Orotate phosphoribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A9M1F6 1.92e-82 247 52 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
A1KS25 2.56e-82 246 52 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P65915 2.56e-82 246 52 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P65914 2.56e-82 246 52 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
C5BLH1 9.18e-82 245 57 2 214 3 pyrE Orotate phosphoribosyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
B4RNV9 1.35e-80 242 51 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q8VR31 4.3e-80 241 55 1 212 3 pyrE Orotate phosphoribosyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5FAK5 4.75e-80 241 51 1 214 3 pyrE Orotate phosphoribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1AXP4 9.45e-80 240 53 2 215 3 pyrE Orotate phosphoribosyltransferase Ruthia magnifica subsp. Calyptogena magnifica
A5CVN5 2.72e-79 239 55 0 193 3 pyrE Orotate phosphoribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B8D880 3.96e-79 238 50 1 211 3 pyrE Orotate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57622 3.96e-79 238 50 1 211 3 pyrE Orotate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8C3 3.96e-79 238 50 1 211 3 pyrE Orotate phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1LS40 4.77e-79 239 55 3 215 3 pyrE Orotate phosphoribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A6SUD4 2.13e-78 237 53 4 221 3 pyrE Orotate phosphoribosyltransferase Janthinobacterium sp. (strain Marseille)
A1WZE3 3.6e-78 236 53 1 213 3 pyrE Orotate phosphoribosyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
B2I1J9 4.38e-78 236 54 4 213 3 pyrE Orotate phosphoribosyltransferase Acinetobacter baumannii (strain ACICU)
B7ICE9 5.69e-78 236 54 4 213 3 pyrE Orotate phosphoribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GV69 5.69e-78 236 54 4 213 3 pyrE Orotate phosphoribosyltransferase Acinetobacter baumannii (strain AB307-0294)
A3M9Y5 6.63e-78 236 54 4 213 3 pyrE Orotate phosphoribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q2KU70 7.32e-78 236 56 3 220 3 pyrE Orotate phosphoribosyltransferase Bordetella avium (strain 197N)
Q0KF45 2.54e-77 234 54 3 215 3 pyrE Orotate phosphoribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q820K1 3.06e-77 234 51 1 215 3 pyrE Orotate phosphoribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A9I0G7 7.09e-77 233 55 2 220 3 pyrE Orotate phosphoribosyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A4G1L0 1.31e-76 232 52 3 221 3 pyrE Orotate phosphoribosyltransferase Herminiimonas arsenicoxydans
A4T0F4 2.87e-76 231 51 3 216 3 pyrE Orotate phosphoribosyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q6F6Z6 8.31e-74 225 54 3 209 3 pyrE Orotate phosphoribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8Y342 3e-72 221 52 3 217 3 pyrE Orotate phosphoribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2UD27 2.49e-71 219 51 3 217 3 pyrE Orotate phosphoribosyltransferase Ralstonia pickettii (strain 12J)
P41923 4.98e-70 216 50 5 220 3 URA5 Orotate phosphoribosyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
B2FJX2 1.04e-69 215 49 3 217 3 pyrE Orotate phosphoribosyltransferase Stenotrophomonas maltophilia (strain K279a)
Q5ZW83 1.34e-69 214 56 3 212 3 pyrE Orotate phosphoribosyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBA2 1.34e-69 214 56 3 212 3 pyrE Orotate phosphoribosyltransferase Legionella pneumophila (strain Corby)
Q5X5W4 1.34e-69 214 56 3 212 3 pyrE Orotate phosphoribosyltransferase Legionella pneumophila (strain Paris)
A2SBW1 4.45e-69 214 49 3 219 3 pyrE Orotate phosphoribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XSI4 8.56e-69 213 51 3 216 3 pyrE Orotate phosphoribosyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q5WX86 1.17e-68 212 55 3 212 3 pyrE Orotate phosphoribosyltransferase Legionella pneumophila (strain Lens)
A9KKR4 1.91e-68 212 47 5 224 3 pyrE Orotate phosphoribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
J9VQB3 9e-68 210 51 3 211 3 URA5 Orotate phosphoribosyltransferase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P0CS95 9.1e-68 210 51 3 211 3 URA5 Orotate phosphoribosyltransferase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ41 9.1e-68 210 51 3 211 3 URA5 Orotate phosphoribosyltransferase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A1VIL5 3.39e-67 209 48 4 229 3 pyrE Orotate phosphoribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
B4STF6 5.01e-67 208 48 3 217 3 pyrE Orotate phosphoribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
O13474 8.59e-67 207 49 4 220 3 URA5 Orotate phosphoribosyltransferase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2P898 1.38e-66 207 48 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P59575 1.1e-65 204 41 1 205 3 pyrE Orotate phosphoribosyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q87F16 2.46e-65 204 47 3 217 3 pyrE Orotate phosphoribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P13298 1.38e-64 202 49 4 216 1 URA5 Orotate phosphoribosyltransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B0U1J0 1.4e-64 202 47 3 217 3 pyrE Orotate phosphoribosyltransferase Xylella fastidiosa (strain M12)
B2I6N0 1.4e-64 202 47 3 217 3 pyrE Orotate phosphoribosyltransferase Xylella fastidiosa (strain M23)
Q9PGZ3 4.46e-64 201 47 3 217 3 pyrE Orotate phosphoribosyltransferase Xylella fastidiosa (strain 9a5c)
Q8P469 7.28e-64 200 49 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RXL2 7.28e-64 200 49 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UPQ3 7.28e-64 200 49 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q8PFS5 1.9e-63 199 48 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BNB6 3.2e-63 198 48 3 217 3 pyrE Orotate phosphoribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A6LS60 1.68e-61 194 47 3 195 3 pyrE Orotate phosphoribosyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
O94331 2.11e-59 188 46 3 212 3 ura5 Orotate phosphoribosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B2UW87 9.44e-59 187 45 3 195 3 pyrE Orotate phosphoribosyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
A5EY64 1.73e-58 186 45 4 217 3 pyrE Orotate phosphoribosyltransferase Dichelobacter nodosus (strain VCS1703A)
Q97N11 1.92e-58 186 40 5 227 3 pyrE Orotate phosphoribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P30402 1.99e-58 186 43 5 223 1 URA10 Orotate phosphoribosyltransferase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B3DS55 2.79e-58 186 44 5 222 3 pyrE Orotate phosphoribosyltransferase Bifidobacterium longum (strain DJO10A)
B7GRU8 3.11e-58 186 45 6 222 3 pyrE Orotate phosphoribosyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8G661 4.6e-58 186 45 6 222 3 pyrE Orotate phosphoribosyltransferase Bifidobacterium longum (strain NCC 2705)
B2TNF7 7.54e-58 185 44 3 195 3 pyrE Orotate phosphoribosyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
A1A1G3 5.09e-57 183 45 6 222 3 pyrE Orotate phosphoribosyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
O42767 3.53e-56 181 42 6 227 3 URA5 Orotate phosphoribosyltransferase Metarhizium anisopliae
B8DUJ6 6.2e-56 180 42 6 228 3 pyrE Orotate phosphoribosyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
C4ZF78 1.48e-53 174 42 7 224 3 pyrE Orotate phosphoribosyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
P35788 1.02e-51 169 46 6 207 3 PYR1 Orotate phosphoribosyltransferase Colletotrichum graminicola
P21846 4.23e-51 168 43 5 204 3 ura5 Orotate phosphoribosyltransferase Hypocrea jecorina
Q7RVF7 2.63e-49 163 45 6 207 3 ura-5 Orotate phosphoribosyltransferase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P08309 2.02e-47 158 38 4 225 3 URA5 Orotate phosphoribosyltransferase Podospora anserina
P18904 4.44e-46 155 45 6 204 3 URA5 Orotate phosphoribosyltransferase Sordaria macrospora
O93849 6.53e-46 155 39 6 232 3 URA5 Orotate phosphoribosyltransferase Coccidioides posadasii (strain C735)
Q1DNB0 6.53e-46 155 39 6 232 3 URA5 Orotate phosphoribosyltransferase Coccidioides immitis (strain RS)
P58861 1.57e-22 93 27 5 185 3 pyrE Orotate phosphoribosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P0CL79 2.52e-20 87 27 5 185 3 pyrE Orotate phosphoribosyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q5JHF4 7.28e-20 86 30 3 160 3 pyrE Orotate phosphoribosyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P0CL78 7.33e-20 86 26 5 185 3 pyrE Orotate phosphoribosyltransferase Pyrococcus abyssi
O58855 2.92e-18 82 25 5 183 3 pyrE Orotate phosphoribosyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P11172 4.23e-18 85 26 4 186 1 UMPS Uridine 5'-monophosphate synthase Homo sapiens
Q8ZTG3 4.84e-18 81 31 5 176 3 pyrE Orotate phosphoribosyltransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A4WLH7 7.06e-18 81 31 5 186 3 pyrE Orotate phosphoribosyltransferase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
P13439 9.71e-18 84 27 5 188 1 Umps Uridine 5'-monophosphate synthase Mus musculus
Q5R514 1.45e-17 83 26 4 186 2 UMPS Uridine 5'-monophosphate synthase Pongo abelii
A1RRV2 1.77e-17 80 30 8 209 3 pyrE Orotate phosphoribosyltransferase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
A3MX27 4.83e-17 79 30 7 198 3 pyrE Orotate phosphoribosyltransferase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q8Q0J4 1.75e-16 77 34 6 148 3 pyrE Orotate phosphoribosyltransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O61790 4.28e-16 77 30 6 168 1 R12E2.11 Orotate phosphoribosyltransferase Caenorhabditis elegans
A3CU84 1.7e-15 74 28 5 179 3 pyrE Orotate phosphoribosyltransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
C5A1Y3 3.07e-15 73 27 3 161 3 pyrE Orotate phosphoribosyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q9HNG2 5.86e-15 73 29 5 172 3 pyrE Orotate phosphoribosyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
G5EDZ2 1.4e-14 75 28 5 192 1 umps-1 Uridine 5'-monophosphate synthase Caenorhabditis elegans
Q42942 1.53e-14 75 28 6 178 2 PYR5-6 Uridine 5'-monophosphate synthase (Fragment) Nicotiana tabacum
Q2NFI3 4.65e-14 70 26 5 195 3 pyrE Orotate phosphoribosyltransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
P31754 6.42e-14 73 23 5 186 2 UMPS Uridine 5'-monophosphate synthase Bos taurus
P58859 7.22e-14 70 28 7 174 3 pyrE Orotate phosphoribosyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O27888 8.53e-14 70 30 7 183 3 pyrE Orotate phosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9UX09 6.11e-13 68 26 6 205 3 pyrE Orotate phosphoribosyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
D4GZW2 8.83e-13 67 30 6 184 3 pyrE2 Orotate phosphoribosyltransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q58509 1.2e-12 67 30 5 149 3 pyrE Orotate phosphoribosyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q970X1 1.43e-12 67 23 6 211 3 pyrE Orotate phosphoribosyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A2BJ25 6.69e-12 65 27 7 214 3 pyrE Orotate phosphoribosyltransferase Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q42586 9.6e-12 67 25 5 187 2 PYRE-F Uridine 5'-monophosphate synthase Arabidopsis thaliana
Q2FPQ2 1.27e-11 63 32 4 149 3 pyrE Orotate phosphoribosyltransferase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q0W6Q2 2.33e-11 63 28 7 186 3 pyrE Orotate phosphoribosyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q3IT15 3.74e-11 62 29 6 186 3 pyrE Orotate phosphoribosyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
O08359 5.9e-11 62 25 4 187 3 pyrE Orotate phosphoribosyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
O28533 9.8e-11 61 30 4 153 3 pyrE Orotate phosphoribosyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A2SQ87 1.02e-10 61 29 5 161 3 pyrE Orotate phosphoribosyltransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q9LDN2 1.04e-10 63 27 8 200 2 UMPS1 Uridine 5'-monophosphate synthase Oryza sativa subsp. japonica
Q7UYX5 1.1e-10 62 31 7 178 3 pyrE Orotate phosphoribosyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8RZA1 1.15e-10 63 26 5 184 2 UMPS2 Uridine 5'-monophosphate synthase Oryza sativa subsp. japonica
Q18FD1 2.36e-10 60 28 7 173 3 pyrE Orotate phosphoribosyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A5D197 2.39e-10 60 29 9 207 3 pyrE Orotate phosphoribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q13CJ6 4.14e-10 60 34 6 146 3 pyrE Orotate phosphoribosyltransferase Rhodopseudomonas palustris (strain BisB5)
A5EST0 4.62e-10 60 32 6 155 3 pyrE Orotate phosphoribosyltransferase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q9RX68 5.34e-10 60 26 7 198 3 pyrE Orotate phosphoribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2J1V2 7.35e-10 59 34 6 146 3 pyrE Orotate phosphoribosyltransferase Rhodopseudomonas palustris (strain HaA2)
P09556 1.13e-09 60 28 6 181 1 pyr56 Uridine 5'-monophosphate synthase Dictyostelium discoideum
Q6LX60 1.41e-09 58 27 5 168 3 pyrE Orotate phosphoribosyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A1SPW6 1.58e-09 58 29 5 169 3 pyrE Orotate phosphoribosyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A2C0A9 1.7e-09 58 29 5 161 3 pyrE Orotate phosphoribosyltransferase Prochlorococcus marinus (strain NATL1A)
A4YL97 1.87e-09 58 33 6 153 3 pyrE Orotate phosphoribosyltransferase Bradyrhizobium sp. (strain ORS 278)
A9GUD3 2.1e-09 58 29 8 195 3 pyrE Orotate phosphoribosyltransferase Sorangium cellulosum (strain So ce56)
Q9HM15 3.21e-09 57 27 5 144 3 pyrE Orotate phosphoribosyltransferase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q8DQL5 3.4e-09 58 26 4 174 3 pyrE Orotate phosphoribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04LJ2 3.4e-09 58 26 4 174 3 pyrE Orotate phosphoribosyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9Y9D8 3.47e-09 57 32 9 197 1 pyrE Orotate phosphoribosyltransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q3AN25 4.45e-09 57 31 5 151 3 pyrE Orotate phosphoribosyltransferase Synechococcus sp. (strain CC9605)
Q89BL4 6.62e-09 57 31 7 155 3 pyrE Orotate phosphoribosyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B3QC92 9.29e-09 56 33 7 147 3 pyrE Orotate phosphoribosyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q3B095 9.53e-09 56 27 7 195 3 pyrE Orotate phosphoribosyltransferase Synechococcus sp. (strain CC9902)
Q6N0N8 1.02e-08 56 33 7 147 3 pyrE Orotate phosphoribosyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q55574 1.04e-08 56 27 4 159 3 pyrE Orotate phosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0CB78 1.22e-08 56 25 4 174 1 pyrE Orotate phosphoribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97CT9 1.62e-08 55 26 5 149 3 pyrE Orotate phosphoribosyltransferase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q6L2K9 2.87e-08 54 25 6 172 3 pyrE Orotate phosphoribosyltransferase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
P58860 2.91e-08 55 27 4 188 3 pyrE Orotate phosphoribosyltransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A0RY85 3.15e-08 55 28 4 156 3 pyrE Orotate phosphoribosyltransferase Cenarchaeum symbiosum (strain A)
Q92AH7 6.5e-08 54 29 5 145 3 pyrE Orotate phosphoribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A4QHG9 6.73e-08 53 30 6 152 3 pyrE Orotate phosphoribosyltransferase Corynebacterium glutamicum (strain R)
Q71YI5 6.97e-08 54 30 6 146 3 pyrE Orotate phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
Q8NM11 7.14e-08 53 30 6 152 1 pyrE Orotate phosphoribosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8Y668 7.17e-08 54 30 6 146 3 pyrE Orotate phosphoribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8YM41 7.44e-08 54 27 6 172 3 pyrE Orotate phosphoribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B5E302 9.36e-08 53 25 4 174 3 pyrE Orotate phosphoribosyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
A3DM49 1.18e-07 53 22 4 186 3 pyrE Orotate phosphoribosyltransferase Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q20WV6 1.32e-07 53 32 5 146 3 pyrE Orotate phosphoribosyltransferase Rhodopseudomonas palustris (strain BisB18)
Q25566 1.42e-07 54 24 4 162 3 UMP Uridine 5'-monophosphate synthase Naegleria gruberi
Q3K146 1.44e-07 53 24 4 168 3 pyrE Orotate phosphoribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A5ULL0 2.62e-07 52 31 5 130 3 Msm_0883 PyrE-like protein Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q64Z17 2.69e-07 52 28 4 156 3 pyrE Orotate phosphoribosyltransferase Bacteroides fragilis (strain YCH46)
Q5LI12 2.69e-07 52 28 4 156 3 pyrE Orotate phosphoribosyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A7IAZ7 2.84e-07 52 30 4 118 3 Mboo_2394 PyrE-like protein Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q8NKQ2 3.61e-07 52 27 5 153 3 pyrE1 PyrE-like protein Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P65918 4.3e-07 52 24 4 168 3 pyrE Orotate phosphoribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65917 4.3e-07 52 24 4 168 3 pyrE Orotate phosphoribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q04R73 4.9e-07 51 30 6 169 3 pyrE Orotate phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q053K4 6.08e-07 51 30 6 169 3 pyrE Orotate phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q03KS5 1.02e-06 50 26 3 131 3 pyrE Orotate phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M4H9 1.06e-06 50 26 3 131 3 pyrE Orotate phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZW8 1.06e-06 50 26 3 131 3 pyrE Orotate phosphoribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q3AC07 2.25e-06 49 25 6 186 3 pyrE Orotate phosphoribosyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q01637 2.56e-06 50 23 6 210 2 r-l Uridine 5'-monophosphate synthase Drosophila melanogaster
Q8DTV2 2.85e-06 49 25 3 131 1 pyrE Orotate phosphoribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A6KYP1 2.87e-06 49 25 5 158 3 pyrE Orotate phosphoribosyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q8A1D5 3.17e-06 49 27 4 156 3 pyrE Orotate phosphoribosyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B7H6L8 5.5e-06 48 27 6 167 3 pyrE Orotate phosphoribosyltransferase Bacillus cereus (strain B4264)
P58858 5.79e-06 48 27 5 161 3 pyrE Orotate phosphoribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C3MF81 6.24e-06 48 32 6 123 3 pyrE Orotate phosphoribosyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A8FD21 8.06e-06 48 29 6 152 3 pyrE Orotate phosphoribosyltransferase Bacillus pumilus (strain SAFR-032)
B7IUP2 9.25e-06 48 28 5 150 3 pyrE Orotate phosphoribosyltransferase Bacillus cereus (strain G9842)
Q1MM09 1.01e-05 48 30 5 123 3 pyrE Orotate phosphoribosyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q81WF6 1.1e-05 48 26 4 147 1 pyrE Orotate phosphoribosyltransferase Bacillus anthracis
C3L744 1.1e-05 48 26 4 147 3 pyrE Orotate phosphoribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P652 1.1e-05 48 26 4 147 3 pyrE Orotate phosphoribosyltransferase Bacillus anthracis (strain A0248)
Q732I7 1.11e-05 48 28 5 150 3 pyrE Orotate phosphoribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JJW9 1.11e-05 48 28 5 150 3 pyrE Orotate phosphoribosyltransferase Bacillus cereus (strain AH820)
Q6HET2 1.14e-05 48 28 5 150 3 pyrE Orotate phosphoribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
P46534 1.25e-05 47 30 6 135 2 pyrE Orotate phosphoribosyltransferase Bacillus caldolyticus
Q9A076 1.26e-05 47 26 4 133 1 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M1
Q819S7 1.35e-05 47 27 5 151 3 pyrE Orotate phosphoribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A9VTC2 1.41e-05 47 26 4 147 3 pyrE Orotate phosphoribosyltransferase Bacillus mycoides (strain KBAB4)
A9BDP7 1.5e-05 47 24 6 190 3 pyrE Orotate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9211)
Q1JM64 1.53e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JC80 1.53e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DD69 1.57e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1J728 1.57e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
P65920 1.57e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCK7 1.57e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DD68 1.57e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1JHA9 1.59e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
A2RF04 2.07e-05 47 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8DHW5 2.08e-05 47 32 4 115 3 pyrE Orotate phosphoribosyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9CGM8 2.22e-05 47 26 4 173 3 pyrE Orotate phosphoribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
A7GRK7 2.73e-05 47 27 5 150 3 pyrE Orotate phosphoribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8ER35 2.77e-05 47 27 4 130 3 pyrE Orotate phosphoribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q74J27 2.83e-05 47 25 4 152 3 pyrE Orotate phosphoribosyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q0C3U2 3.28e-05 46 25 8 197 3 pyrE Orotate phosphoribosyltransferase Hyphomonas neptunium (strain ATCC 15444)
A2BUQ6 3.31e-05 46 25 7 181 3 pyrE Orotate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9515)
B0SL24 3.37e-05 46 26 5 169 3 pyrE Orotate phosphoribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCV6 3.37e-05 46 26 5 169 3 pyrE Orotate phosphoribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
O67742 3.43e-05 46 25 9 201 3 pyrE Orotate phosphoribosyltransferase Aquifex aeolicus (strain VF5)
A2CCL7 3.74e-05 46 26 4 166 3 pyrE Orotate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9303)
Q7V4S7 3.78e-05 46 26 4 166 3 pyrE Orotate phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9313)
P25972 4.31e-05 46 31 3 88 1 pyrE Orotate phosphoribosyltransferase Bacillus subtilis (strain 168)
A0QLX9 4.71e-05 45 27 8 179 3 pyrE Orotate phosphoribosyltransferase Mycobacterium avium (strain 104)
Q48U09 4.73e-05 46 26 4 133 3 pyrE Orotate phosphoribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A4SGU2 5.29e-05 45 29 8 188 3 pyrE Orotate phosphoribosyltransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A2RLC0 5.45e-05 46 28 3 131 3 pyrE Orotate phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q8PVD0 5.55e-05 45 26 4 138 3 MM_2035 PyrE-like protein Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q92SC6 6.9e-05 45 31 6 123 3 pyrE Orotate phosphoribosyltransferase Rhizobium meliloti (strain 1021)
Q83FI4 7.11e-05 45 24 8 193 3 pyrE Orotate phosphoribosyltransferase Tropheryma whipplei (strain Twist)
Q83H88 7.11e-05 45 24 8 193 3 pyrE Orotate phosphoribosyltransferase Tropheryma whipplei (strain TW08/27)
Q02ZC9 7.19e-05 45 28 3 131 3 pyrE Orotate phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
B9J8H7 7.31e-05 45 30 6 123 3 pyrE Orotate phosphoribosyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q824L3 8.93e-05 45 23 8 193 3 pyrE Orotate phosphoribosyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B3EPT5 9.17e-05 45 31 6 151 3 pyrE Orotate phosphoribosyltransferase Chlorobium phaeobacteroides (strain BS1)
O26962 0.000114 45 32 4 125 3 MTH_876 PyrE-like protein Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A3CN88 0.000124 45 26 4 142 3 pyrE Orotate phosphoribosyltransferase Streptococcus sanguinis (strain SK36)
A1BJI2 0.00014 44 27 8 181 3 pyrE Orotate phosphoribosyltransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q465U8 0.000146 44 26 4 138 3 Mbar_A3471 PyrE-like protein 2 Methanosarcina barkeri (strain Fusaro / DSM 804)
A3CS56 0.00015 44 30 2 103 3 Memar_0272 PyrE-like protein Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q46F14 0.000166 44 28 4 138 3 Mbar_A0547 PyrE-like protein 1 Methanosarcina barkeri (strain Fusaro / DSM 804)
A3PH80 0.000177 44 30 5 130 3 pyrE Orotate phosphoribosyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J555 0.000191 44 30 5 130 3 pyrE Orotate phosphoribosyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2NEP2 0.000198 44 27 3 113 3 Msp_1334 PyrE-like protein Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A9A8L2 0.000199 44 25 4 131 3 MmarC6_0870 PyrE-like protein Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A4G0B2 0.000199 44 25 4 131 3 MmarC5_1599 PyrE-like protein Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
P58862 0.0002 44 26 4 138 3 MA_0919 PyrE-like protein 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
F2MMN7 0.000214 44 30 3 113 3 pyrE Orotate phosphoribosyltransferase Enterococcus faecalis (strain ATCC 47077 / OG1RF)
P0DH75 0.000214 44 30 3 113 3 pyrE Orotate phosphoribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
B9KMA3 0.000218 44 30 5 130 3 pyrE Orotate phosphoribosyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A6VI67 0.00026 43 25 4 131 3 MmarC7_1077 PyrE-like protein Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A8AXM7 0.000283 43 24 6 186 3 pyrE Orotate phosphoribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q49WY6 0.000334 43 27 5 139 3 pyrE Orotate phosphoribosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6A910 0.000348 43 25 7 207 3 pyrE Orotate phosphoribosyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
B9LUS0 0.000363 43 28 6 136 3 Hlac_0798 PyrE-like protein Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q9HS16 0.000366 43 30 3 126 3 pyrE1 PyrE-like protein Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R3D9 0.000366 43 30 3 126 3 OE_1672F PyrE-like protein Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q6M139 0.000395 43 27 3 95 3 MMP0079 PyrE-like protein Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A2SRI7 0.000432 43 27 9 174 3 Mlab_0772 PyrE-like protein Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q985B1 0.000592 42 26 4 139 3 pyrE2 Orotate phosphoribosyltransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98AN7 0.000695 42 26 6 154 3 pyrE1 Orotate phosphoribosyltransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q03NE4 0.000762 42 30 1 62 3 pyrE Orotate phosphoribosyltransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q5SHI8 0.000774 42 26 4 156 3 pyrE Orotate phosphoribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P61499 0.000835 42 26 4 156 3 pyrE Orotate phosphoribosyltransferase Thermus thermophilus
P61498 0.000835 42 26 4 156 1 pyrE Orotate phosphoribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B1ZJQ5 0.001 42 25 6 176 3 pyrE Orotate phosphoribosyltransferase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_16220
Feature type CDS
Gene pyrE
Product Orotate phosphoribosyltransferase
Location 33662 - 34309 (strand: 1)
Length 648 (nucleotides) / 215 (amino acids)

Contig

Accession contig_23
Length 63965 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2155
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00156 Phosphoribosyl transferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0461 Nucleotide transport and metabolism (F) F Orotate phosphoribosyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MKAYQREFIELAMKKQVLKFGEFTLKSGRKSPYFFNAGLFNTGRDLALLGRFYAAALCDSGVQYDVLFGPAYKGIPIATTTAVALAEHHDLDMPYCFNRKEAKDHGEGGTLVGSPLSGRIVVVDDVITAGTAIRESMEIIRQNNASLAGVMLSLDRQEKGKGELSAVQEVERDYGCQVFSIITLNDLISYLAEDPQMDSHLQAVRAYREQYGIEI

Flanking regions ( +/- flanking 50bp)

ATGCCTGTGATTCAGGCACGTTATCCGTCAATCAGAATCAGGAGATCCCGATGAAAGCTTATCAGCGCGAATTTATTGAACTTGCGATGAAAAAACAGGTACTGAAATTTGGTGAATTTACGCTGAAATCCGGCCGGAAAAGCCCGTATTTCTTCAATGCCGGGTTATTCAATACAGGGCGGGATTTGGCACTGCTCGGACGCTTTTATGCGGCAGCATTATGCGACAGCGGCGTACAGTATGATGTCCTGTTCGGGCCTGCCTACAAGGGTATTCCGATTGCAACGACGACAGCCGTCGCACTGGCCGAGCATCATGATCTTGATATGCCGTACTGTTTTAACCGTAAGGAAGCCAAAGATCACGGGGAAGGCGGAACATTGGTCGGCAGCCCGCTGAGCGGACGGATTGTGGTGGTGGATGATGTGATCACCGCCGGAACGGCGATCCGTGAGTCGATGGAAATCATCAGACAAAACAATGCTTCGCTTGCCGGTGTGATGCTGAGTCTTGATCGTCAGGAAAAAGGCAAAGGCGAGTTATCCGCCGTCCAGGAAGTGGAGCGCGATTACGGTTGTCAGGTATTTTCCATTATCACACTGAATGATTTAATCAGCTATCTGGCGGAAGATCCGCAGATGGACAGCCATTTACAGGCTGTACGGGCTTACCGTGAGCAGTACGGGATTGAGATCTGAGCCGGACAGCAGGCAAAAAAAGCCCTCGCCCAATAAAACGGGCGGGGTGA