Homologs in group_1740

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_14465 EHELCC_14465 100.0 Morganella morganii S2 yhfA OsmC family protein
NLDBIP_15560 NLDBIP_15560 100.0 Morganella morganii S4 yhfA OsmC family protein
LHKJJB_15050 LHKJJB_15050 100.0 Morganella morganii S3 yhfA OsmC family protein
HKOGLL_14170 HKOGLL_14170 100.0 Morganella morganii S5 yhfA OsmC family protein
F4V73_RS14810 F4V73_RS14810 94.8 Morganella psychrotolerans - OsmC family protein
PMI_RS13925 PMI_RS13925 75.6 Proteus mirabilis HI4320 - OsmC family protein

Distribution of the homologs in the orthogroup group_1740

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1740

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ADX4 1.86e-78 230 80 0 131 4 yhfA Protein YhfA Shigella flexneri
P0ADX1 1.86e-78 230 80 0 131 1 yhfA Protein YhfA Escherichia coli (strain K12)
P0ADX2 1.86e-78 230 80 0 131 4 yhfA Protein YhfA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ADX3 1.86e-78 230 80 0 131 4 yhfA Protein YhfA Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_11840
Feature type CDS
Gene yhfA
Product OsmC family protein
Location 18841 - 19248 (strand: -1)
Length 408 (nucleotides) / 135 (amino acids)
In genomic island -

Contig

Accession contig_14
Length 134564 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1740
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02566 OsmC-like protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1765 General function prediction only (R) R Uncharacterized OsmC-related protein

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07397 putative redox protein - -

Protein Sequence

MEARVKWVENMTFLGESASGHQITMDGNAGEKAPNPMEMVLMATGGCSAIDVVSILQKGRNQVIDCDVKLTAERRETAPRLFTHINLHFIVTGRDLTENVVGRAVQLSAEKYCSVSLMLGESVNITHSFEVKNIE

Flanking regions ( +/- flanking 50bp)

GAATGAAAGGGTAGTCTGTCGTGAATTATATTGATGATGAGGGTATAAAAATGGAAGCGCGTGTAAAGTGGGTTGAGAACATGACTTTCTTAGGGGAATCCGCGTCAGGACACCAGATTACAATGGACGGTAATGCCGGTGAAAAAGCTCCGAACCCGATGGAGATGGTACTGATGGCAACCGGCGGCTGCAGCGCCATTGATGTTGTCTCTATTTTGCAAAAAGGCCGTAATCAAGTCATTGATTGTGATGTAAAACTCACCGCTGAACGTCGTGAAACCGCGCCACGTTTATTCACTCATATTAATCTGCATTTTATTGTGACCGGCCGTGACCTGACTGAAAACGTTGTCGGGCGTGCCGTGCAATTATCCGCTGAGAAATATTGCTCTGTTTCATTAATGTTAGGCGAAAGTGTTAACATTACGCATAGTTTTGAAGTAAAGAATATTGAATGATTTTTTGAAATATTATTTTTATTTTTGAAAATAAACCGGGTAATACATTA