Homologs in group_2875

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_19425 EHELCC_19425 100.0 Morganella morganii S2 nikL Additional component NikL of nickel ECF transporter
NLDBIP_15005 NLDBIP_15005 100.0 Morganella morganii S4 nikL Additional component NikL of nickel ECF transporter
LHKJJB_14340 LHKJJB_14340 100.0 Morganella morganii S3 nikL Additional component NikL of nickel ECF transporter
HKOGLL_12960 HKOGLL_12960 100.0 Morganella morganii S5 nikL Additional component NikL of nickel ECF transporter
F4V73_RS16910 F4V73_RS16910 91.6 Morganella psychrotolerans - Additional component NikL of nickel ECF transporter

Distribution of the homologs in the orthogroup group_2875

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2875

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P44275 8.12e-35 122 43 3 146 3 HI_1622 Uncharacterized protein HI_1622 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_10840
Feature type CDS
Gene nikL
Product Additional component NikL of nickel ECF transporter
Location 135567 - 136079 (strand: -1)
Length 513 (nucleotides) / 170 (amino acids)
In genomic island -

Contig

Accession contig_12
Length 141735 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2875
Orthogroup size 6
N. genomes 6

Actions

Genomic region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5266 General function prediction only (R) R Uncharacterized protein, contains GH25 family domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K16915 nickel transport protein ABC transporters -

Protein Sequence

MKSVYLFAILLINGVLLATTAQAHSMHVVAQLEGNVISGQSYYSDMSPAKDTYVGTYLKGHEDDEISGKTDEKGYFKIEVPATGDYILYVEGDEGHKVETEVPVISASANTGSSDSSSGYIQIRQDIDQLKNKIYLQNILGGVGYIVGIFGVIAFFRARELTKQAAKNAA

Flanking regions ( +/- flanking 50bp)

TCCAGCAGCTGGAATATGTTTTATCTTTTGACGCTGAGTAATTAAACGTTATGAAATCTGTTTATTTATTTGCCATTTTACTGATTAACGGGGTGCTGTTGGCAACAACAGCACAAGCTCACTCCATGCATGTGGTTGCACAGCTGGAAGGGAATGTGATCAGCGGCCAGTCTTATTATTCTGATATGTCTCCGGCAAAAGATACTTATGTCGGTACGTATCTGAAAGGCCACGAAGATGATGAAATATCCGGAAAGACCGATGAAAAAGGGTATTTTAAAATCGAAGTCCCGGCGACCGGTGATTATATTCTCTATGTTGAAGGTGATGAAGGGCACAAAGTGGAAACGGAAGTTCCGGTTATTTCCGCCTCAGCTAACACCGGCAGCAGTGATTCCTCTTCCGGTTATATTCAGATCCGCCAGGATATTGACCAGCTGAAGAATAAAATCTATCTGCAGAATATTCTCGGTGGTGTGGGCTATATCGTGGGTATTTTCGGTGTGATTGCATTCTTCCGTGCCCGTGAATTAACAAAGCAGGCCGCTAAAAACGCCGCATAACAGGAGGAAGACCATGCATTTATCTGAAGGCGTATTACATCTTCCTGTTC