Homologs in group_2875

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10840 FBDBKF_10840 91.6 Morganella morganii S1 nikL Additional component NikL of nickel ECF transporter
EHELCC_19425 EHELCC_19425 91.6 Morganella morganii S2 nikL Additional component NikL of nickel ECF transporter
NLDBIP_15005 NLDBIP_15005 91.6 Morganella morganii S4 nikL Additional component NikL of nickel ECF transporter
LHKJJB_14340 LHKJJB_14340 91.6 Morganella morganii S3 nikL Additional component NikL of nickel ECF transporter
HKOGLL_12960 HKOGLL_12960 91.6 Morganella morganii S5 nikL Additional component NikL of nickel ECF transporter

Distribution of the homologs in the orthogroup group_2875

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2875

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P44275 1.15e-37 129 44 4 164 3 HI_1622 Uncharacterized protein HI_1622 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16910
Feature type CDS
Gene -
Product Additional component NikL of nickel ECF transporter
Location 5535 - 6038 (strand: 1)
Length 504 (nucleotides) / 167 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000007
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2875
Orthogroup size 6
N. genomes 6

Actions

Genomic region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5266 General function prediction only (R) R Uncharacterized protein, contains GH25 family domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K16915 nickel transport protein ABC transporters -

Protein Sequence

MKSIYLFVALLINGVLLATTAQAHSMHVVAQLEGNVISGQSYYSDMSPAKDTYVGIYLKGHQDDEISGKTDDKGYFKIDVPATGEYVLYVEGDEGHKVETDVPVISATSSSSDSSSGYIQIRQDIDQLKNKIYLQNILGGVGYIVGIFGVIAFFRARELTKQAAKAA

Flanking regions ( +/- flanking 50bp)

TCCAGCAGTTAGAATATGTCTTATCATTTGATGCAGAGTAATTAAACGTTATGAAGTCTATTTACTTATTTGTTGCCTTATTAATTAACGGGGTGCTGTTGGCAACAACAGCACAAGCTCACTCCATGCACGTTGTCGCGCAATTAGAAGGTAATGTGATCAGCGGGCAATCCTATTATTCAGATATGTCACCGGCAAAAGATACTTATGTCGGTATATATCTGAAAGGTCACCAGGATGATGAAATATCCGGTAAAACGGATGATAAAGGCTATTTCAAAATCGACGTACCCGCTACCGGCGAATATGTTTTATATGTTGAAGGCGATGAAGGACATAAAGTTGAAACTGATGTTCCGGTTATTTCAGCAACCAGCAGCAGTAGTGATTCATCTTCCGGCTATATTCAGATCCGCCAGGATATTGATCAGTTAAAGAATAAAATTTATCTGCAAAATATTTTAGGCGGTGTTGGTTATATTGTGGGTATTTTTGGTGTGATTGCCTTCTTCCGCGCCCGTGAACTCACCAAACAGGCTGCTAAAGCCGCATAACAGGAGGACTAACATGCATTTATCAGAAGGCGTATTACATCTTCCTGTTC