Homologs in group_328

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_04715 EHELCC_04715 100.0 Morganella morganii S2 nagE Phosphotransferase system IIA component
NLDBIP_04715 NLDBIP_04715 100.0 Morganella morganii S4 nagE Phosphotransferase system IIA component
LHKJJB_13915 LHKJJB_13915 100.0 Morganella morganii S3 nagE Phosphotransferase system IIA component
HKOGLL_12620 HKOGLL_12620 100.0 Morganella morganii S5 nagE Phosphotransferase system IIA component
F4V73_RS00435 F4V73_RS00435 91.6 Morganella psychrotolerans nagE N-acetylglucosamine-specific PTS transporter subunit IIBC
PMI_RS02280 PMI_RS02280 75.0 Proteus mirabilis HI4320 nagE N-acetylglucosamine-specific PTS transporter subunit IIBC
PMI_RS11320 PMI_RS11320 42.2 Proteus mirabilis HI4320 ptsG PTS glucose transporter subunit IIBC

Distribution of the homologs in the orthogroup group_328

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_328

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P09323 0.0 578 48 9 691 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
P45604 0.0 553 48 10 692 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
Q7CCJ4 1.25e-142 434 36 10 676 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 1.25e-142 434 36 10 676 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 1.25e-142 434 36 10 676 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q2YUZ1 1.35e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NYM1 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 1.8e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q6GKB7 2.39e-142 434 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q4L945 8.26e-142 432 36 12 688 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q7A807 1.03e-141 432 37 14 684 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 1.03e-141 432 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 1.03e-141 432 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 1.03e-141 432 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 1.03e-141 432 37 14 684 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
P20166 1.22e-141 432 36 14 712 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q57071 2.13e-141 431 38 16 696 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q4A0C4 6.31e-141 430 37 14 680 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q53922 4.13e-135 416 36 15 705 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
P39816 3.91e-131 403 35 12 668 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
Q6GDR0 1.08e-128 399 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
A5IVW5 1.63e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
A6U4R9 1.63e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q2YWC1 1.82e-128 398 35 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NUS2 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
Q2FV87 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 2.76e-128 398 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
Q7A3G4 9.53e-128 396 34 16 716 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 9.53e-128 396 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 9.53e-128 396 34 16 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
O34521 3.21e-100 317 41 8 506 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P37439 3.95e-97 310 37 15 517 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69786 6.45e-97 309 36 14 517 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 6.45e-97 309 36 14 517 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 6.45e-97 309 36 14 517 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
Q89AG6 2.97e-96 308 36 12 514 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57437 4.43e-90 291 35 15 522 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9S2H4 1.84e-87 283 43 8 418 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8K9J0 5.23e-82 270 34 13 518 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P19642 9.84e-81 268 32 10 542 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
P35595 5.55e-80 272 30 22 727 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P54715 5.15e-64 224 32 19 539 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
P42015 1.65e-62 214 34 4 332 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
Q9AGA7 2.21e-62 220 30 15 538 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
O06900 4.76e-58 207 28 11 532 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
P47315 7.74e-56 208 31 14 454 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 6.88e-21 101 29 6 244 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
C7NB69 1.63e-55 201 29 13 536 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
P75569 3.78e-53 200 30 13 457 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 9.46e-24 110 32 7 253 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q44840 2.88e-43 157 54 0 131 3 crr PTS system glucose-specific EIIA component Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P69785 2.48e-40 148 48 1 150 3 crr PTS system glucose-specific EIIA component Shigella flexneri
P69783 2.48e-40 148 48 1 150 1 crr PTS system glucose-specific EIIA component Escherichia coli (strain K12)
P69784 2.48e-40 148 48 1 150 3 crr PTS system glucose-specific EIIA component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A283 3.13e-40 148 48 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A284 3.13e-40 148 48 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhi
Q89B05 5.52e-36 136 44 0 141 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P45338 1.11e-35 135 43 1 151 1 crr PTS system glucose-specific EIIA component Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CZD5 2.27e-34 131 42 0 149 3 crr PTS system glucose-specific EIIA component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9WXI7 8.84e-34 130 39 2 148 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9KCQ4 7.22e-33 127 41 0 156 3 crr PTS system glucose-specific EIIA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P31452 7.91e-33 133 28 7 356 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
Q8KA51 3.96e-32 125 40 0 131 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q81JY0 6.1e-32 125 42 0 130 3 crr PTS system glucose-specific EIIA component Bacillus anthracis
Q814U8 6.16e-32 125 42 0 130 3 crr PTS system glucose-specific EIIA component Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8CP79 5.41e-31 122 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPB5 5.41e-31 122 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q93P61 1.1e-30 121 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus
Q5HFZ9 1.1e-30 121 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain COL)
Q6GGY5 1.28e-30 121 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MRSA252)
P50829 3.26e-30 120 38 0 146 4 ptsA Phosphotransferase enzyme IIA component PtsA Bacillus subtilis (strain 168)
Q8NWR1 3.6e-30 120 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MW2)
Q6G9D9 3.6e-30 120 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MSSA476)
P60857 4.42e-30 119 39 0 148 1 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain N315)
P60856 4.42e-30 119 39 0 148 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
P45618 1.46e-29 117 40 1 142 1 crr PTS system glucose-specific EIIA component Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P26207 3.21e-28 124 43 1 162 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
P12655 5.13e-26 117 40 3 174 1 scrA PTS system sucrose-specific EIIBCA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P40739 5.25e-26 116 41 0 141 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
Q9KF90 2.53e-25 114 36 0 141 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q46072 3.21e-25 114 41 0 132 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P08722 1.42e-24 112 35 1 173 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
Q45298 5.59e-23 107 37 0 131 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
P43470 7.05e-21 100 38 0 139 3 scrA PTS system sucrose-specific EIIBCA component Pediococcus pentosaceus
P23936 9.64e-20 97 44 0 104 3 lacS Lactose permease Streptococcus thermophilus
P22733 1.04e-19 97 41 0 103 3 lacY Lactose permease Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7WTB2 8.45e-18 91 35 2 150 2 lacS Lactose permease Lactobacillus helveticus
P43466 1.85e-17 90 42 0 103 3 rafP Raffinose carrier protein Pediococcus pentosaceus
P69790 1.37e-15 78 33 4 150 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 1.37e-15 78 33 4 150 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q9S2H6 2.77e-12 65 42 1 78 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q48624 8.68e-08 59 29 1 109 3 lacS Lactose permease Leuconostoc lactis
P77272 9.3e-08 58 39 3 104 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q8XBJ1 9.79e-08 58 39 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q1R8U3 1.01e-07 58 39 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q8FFA9 1.02e-07 58 39 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P24241 1.92e-07 57 35 4 98 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q32DC5 2.57e-07 57 38 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
Q83QN3 2.71e-07 57 38 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q31Y50 5.25e-07 56 38 3 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
O32292 6.58e-06 47 30 0 69 3 yyzE Putative phosphotransferase enzyme IIA component YyzE Bacillus subtilis (strain 168)
Q7A1Y1 1.93e-05 51 36 7 121 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 1.93e-05 51 36 7 121 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 1.93e-05 51 36 7 121 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 1.93e-05 51 36 7 121 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 1.93e-05 51 36 7 121 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 1.93e-05 51 36 7 121 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 1.93e-05 51 36 7 121 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q6GKB4 2.02e-05 51 36 7 121 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 2.02e-05 51 36 7 121 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7N9D9 6.86e-05 49 31 5 114 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7MBS2 8.67e-05 49 34 3 84 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q8D4Z3 8.82e-05 49 34 3 84 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
Q9KVD9 0.000507 47 35 3 77 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_09915
Feature type CDS
Gene nagE
Product Phosphotransferase system IIA component
Location 78517 - 80547 (strand: -1)
Length 2031 (nucleotides) / 676 (amino acids)

Contig

Accession contig_11
Length 143616 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_328
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00358 phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1
PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02804 N-acetylglucosamine PTS system EIICBA or EIICB component [EC:2.7.1.193] Amino sugar and nucleotide sugar metabolism
Phosphotransferase system (PTS)		 -

Protein Sequence

MGILNYLQRIGRALMVPVATLPAAAILMGVGYWIDPTGWGADNVVAAFLIKSGAAIIDNMSMLFAIGIAYGMSKDKDGAAALTGFVSFMVVTTLCSTATVGMIQGIPPEAVPAAFGKINNQFIGILVGVISAELYNRYSGVELPMALSFFSGRRLVPILASFVMILVAAVLMYVWPVIYDALVSFGKSIKDLGAWGAGIYGFFNRLLIPVGLHHALNSVFWFNVADINDIPNFLAGQQSIDAGTAIPGITGRYQAGFFPIMMFGIPGAALAIYHCAKPENKAKVAGIMIAGAFAAFFTGITEPIEFSFMFVAPVLYVIHAFLTGISLFIAATMQWISGFGFSAGLVDMALSSRNPLATNWYMLILQGLVFFALYYVVFRFVITKFNLLTPGREAAMATNDTVDGYSENVSTDNKKDEKKSISSEARQYIAAIGGSDNLTGIDACITRLRLTVKDSAQVNDAYAKQIGASGVIRLNKESVQVIVGTRAELIANAMRDVLKEGPVAAAQAAAAPEAVKAKAQGNGHVVLTLVAPFDGEVVDLSAVPDEAFAGRVVGDGIAIKPESDTVYAPAAGTVVKIFDTNHAFCLETDNGAEIIVHMGIDTVNLNGNGFTRLIEEGAQVAAGDAVLKLDLAYLNEHAKSMISPVIISNIDDYDRVEIVAKGLVKANESELYHVIK

Flanking regions ( +/- flanking 50bp)

AATGCTGTAAAACAAAAAAGGCCGTTCGTCAGGGCGGCAAGGGGGAGTGAGTGGGTATACTGAACTATCTGCAGCGGATTGGCCGGGCACTGATGGTGCCTGTCGCCACATTGCCGGCTGCGGCAATTCTGATGGGGGTCGGTTACTGGATCGACCCGACGGGCTGGGGTGCGGACAACGTGGTTGCCGCGTTCCTGATCAAATCCGGTGCGGCTATCATTGATAACATGTCAATGCTGTTTGCTATCGGTATCGCTTACGGGATGTCAAAAGACAAAGACGGTGCGGCAGCACTGACCGGTTTTGTCAGCTTTATGGTGGTGACCACCCTGTGTTCCACCGCGACAGTCGGTATGATTCAGGGGATCCCTCCGGAAGCGGTTCCGGCGGCGTTCGGTAAGATCAACAACCAGTTTATCGGTATTCTGGTCGGTGTTATTTCCGCCGAACTGTATAACCGTTACAGCGGTGTTGAGCTGCCGATGGCATTGTCATTCTTCAGCGGCCGCCGTCTGGTGCCTATCCTGGCATCATTCGTGATGATCCTGGTGGCTGCGGTACTGATGTATGTCTGGCCGGTCATTTATGATGCACTGGTTTCCTTCGGTAAGAGCATTAAAGACCTGGGCGCGTGGGGCGCGGGGATTTACGGTTTCTTTAACCGTCTGCTGATCCCGGTCGGTCTGCACCACGCACTGAACTCCGTATTCTGGTTCAACGTGGCGGATATCAACGATATCCCTAACTTCCTGGCCGGTCAGCAATCCATTGATGCCGGTACGGCGATTCCGGGTATCACAGGCCGTTATCAGGCCGGTTTCTTCCCGATCATGATGTTTGGTATCCCGGGTGCCGCGCTGGCGATTTATCACTGCGCCAAACCGGAAAACAAAGCAAAAGTGGCCGGTATTATGATCGCCGGTGCATTTGCCGCGTTCTTCACCGGTATCACCGAGCCGATTGAATTCTCCTTTATGTTCGTGGCACCGGTTCTGTATGTCATCCATGCCTTCCTGACCGGTATCTCCCTGTTTATCGCTGCAACCATGCAGTGGATTTCAGGTTTCGGCTTTAGTGCGGGGCTGGTGGATATGGCGTTGTCTTCACGCAACCCGCTGGCAACCAACTGGTATATGCTGATCCTGCAGGGCCTGGTCTTCTTCGCGCTGTACTATGTGGTGTTCCGTTTTGTTATCACCAAATTCAACCTGTTAACCCCGGGTCGTGAAGCGGCGATGGCAACCAACGATACCGTTGATGGTTACAGTGAGAATGTCAGTACTGATAATAAAAAAGATGAGAAAAAATCCATCAGCAGCGAAGCACGTCAGTATATCGCGGCTATCGGTGGTTCAGATAACCTGACCGGTATTGATGCCTGTATCACCCGCCTGCGTCTGACTGTAAAAGACTCCGCGCAGGTCAATGATGCTTATGCGAAACAAATCGGTGCTTCCGGCGTTATCCGTCTGAATAAAGAGAGTGTGCAGGTGATTGTCGGCACCCGTGCTGAGCTGATCGCCAACGCCATGCGTGACGTGCTGAAAGAAGGCCCGGTTGCGGCAGCTCAGGCTGCGGCGGCTCCGGAAGCAGTGAAAGCCAAAGCACAGGGCAATGGACACGTGGTACTGACGCTGGTGGCACCATTCGACGGCGAAGTGGTTGATTTATCCGCTGTACCGGATGAAGCATTTGCCGGCCGTGTTGTCGGTGACGGTATTGCCATCAAACCGGAAAGCGACACCGTATATGCCCCGGCGGCAGGTACTGTGGTGAAAATTTTCGATACCAACCATGCATTCTGCCTGGAAACCGATAATGGTGCGGAAATTATTGTTCACATGGGTATTGATACTGTGAATCTGAACGGCAACGGCTTTACCCGCCTGATTGAAGAAGGCGCACAGGTTGCTGCCGGTGATGCGGTGCTGAAACTGGATCTGGCGTATCTGAACGAACATGCCAAATCCATGATAAGCCCGGTAATCATCAGTAATATCGATGATTATGATCGCGTGGAGATTGTTGCCAAAGGTCTGGTTAAGGCAAACGAATCTGAGCTGTATCATGTCATTAAATAAGTGATTGCGGTTATGATAATAACGGGAGGCAGCTGCTTCCCGTTTTTTTA