Homologs in group_328

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09915 FBDBKF_09915 75.0 Morganella morganii S1 nagE Phosphotransferase system IIA component
EHELCC_04715 EHELCC_04715 75.0 Morganella morganii S2 nagE Phosphotransferase system IIA component
NLDBIP_04715 NLDBIP_04715 75.0 Morganella morganii S4 nagE Phosphotransferase system IIA component
LHKJJB_13915 LHKJJB_13915 75.0 Morganella morganii S3 nagE Phosphotransferase system IIA component
HKOGLL_12620 HKOGLL_12620 75.0 Morganella morganii S5 nagE Phosphotransferase system IIA component
F4V73_RS00435 F4V73_RS00435 75.0 Morganella psychrotolerans nagE N-acetylglucosamine-specific PTS transporter subunit IIBC
PMI_RS11320 PMI_RS11320 42.9 Proteus mirabilis HI4320 ptsG PTS glucose transporter subunit IIBC

Distribution of the homologs in the orthogroup group_328

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_328

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P09323 0.0 577 48 9 692 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
P45604 0.0 570 49 8 689 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
P20166 1.25e-147 448 38 15 720 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q7CCJ4 8.27e-146 442 38 13 685 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 8.27e-146 442 38 13 685 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 8.27e-146 442 38 13 685 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q4A0C4 1.21e-142 434 37 15 707 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YUZ1 1.27e-142 435 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NYM1 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 1.36e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q6GKB7 2.18e-142 434 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q4L945 1.01e-141 432 36 14 698 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q7A807 1.16e-140 429 37 13 687 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 1.16e-140 429 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 1.16e-140 429 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 1.16e-140 429 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 1.16e-140 429 37 13 687 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q57071 5.97e-138 422 37 15 700 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
P39816 1.12e-130 402 38 16 670 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
Q53922 1.76e-130 404 36 18 697 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
A5IVW5 9.43e-126 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
A6U4R9 9.43e-126 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q6GDR0 1.12e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q8NUS2 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
Q2FV87 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 1.23e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
Q2YWC1 1.33e-125 391 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3G4 5.68e-125 389 34 17 716 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 5.68e-125 389 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 5.68e-125 389 34 17 716 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q89AG6 1.37e-95 306 37 11 511 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P69786 1.24e-93 301 36 13 511 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 1.24e-93 301 36 13 511 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 1.24e-93 301 36 13 511 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
O34521 8.88e-92 295 40 8 494 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P37439 1.56e-90 293 35 12 509 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P57437 9.12e-87 283 36 14 510 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9S2H4 7.57e-84 273 42 8 409 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8K9J0 6.23e-83 273 36 13 509 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P19642 2.37e-82 273 34 15 536 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
P35595 4.91e-80 272 31 23 745 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P42015 1.97e-63 216 38 4 318 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P54715 3.65e-59 211 30 15 545 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
Q9AGA7 4.38e-58 208 29 16 556 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
O06900 5.96e-58 207 29 13 531 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
P47315 8.56e-58 214 33 16 458 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 3.98e-20 99 29 8 249 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
C7NB69 6.02e-57 205 29 11 536 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
P75569 2.43e-55 207 31 13 458 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 1.58e-25 116 33 9 255 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A283 3.77e-46 164 52 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A284 3.77e-46 164 52 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhi
P69785 7.8e-45 160 51 1 150 3 crr PTS system glucose-specific EIIA component Shigella flexneri
P69783 7.8e-45 160 51 1 150 1 crr PTS system glucose-specific EIIA component Escherichia coli (strain K12)
P69784 7.8e-45 160 51 1 150 3 crr PTS system glucose-specific EIIA component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q89B05 3.55e-43 156 47 2 161 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q44840 1.35e-40 150 53 0 130 3 crr PTS system glucose-specific EIIA component Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9WXI7 2.12e-40 148 47 1 144 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P45338 1.47e-38 143 43 1 158 1 crr PTS system glucose-specific EIIA component Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8KA51 1.11e-36 138 44 1 145 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8CP79 7.61e-35 133 45 0 130 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPB5 7.61e-35 133 45 0 130 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GGY5 6.72e-34 130 48 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MRSA252)
Q93P61 7.06e-34 130 48 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus
Q5HFZ9 7.06e-34 130 48 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain COL)
Q8NWR1 2.48e-33 129 47 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MW2)
Q6G9D9 2.48e-33 129 47 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MSSA476)
P60857 2.82e-33 129 47 0 121 1 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain N315)
P60856 2.82e-33 129 47 0 121 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
P31452 7.03e-33 134 29 8 352 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
Q45298 1.55e-30 131 39 0 146 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
Q8CZD5 3.35e-30 120 39 0 147 3 crr PTS system glucose-specific EIIA component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q81JY0 4.58e-30 119 39 0 146 3 crr PTS system glucose-specific EIIA component Bacillus anthracis
Q814U8 4.81e-30 119 39 0 146 3 crr PTS system glucose-specific EIIA component Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q46072 1e-29 129 39 0 146 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P50829 5.65e-29 116 41 1 127 4 ptsA Phosphotransferase enzyme IIA component PtsA Bacillus subtilis (strain 168)
Q9KCQ4 5.9e-29 116 37 1 156 3 crr PTS system glucose-specific EIIA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P45618 4.05e-27 110 43 0 123 1 crr PTS system glucose-specific EIIA component Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P26207 5.28e-26 117 38 0 153 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
Q9KF90 1.34e-25 115 31 0 170 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P08722 2.65e-25 114 37 1 171 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
P40739 3.09e-25 114 37 2 157 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
P12655 1.8e-23 109 39 1 157 1 scrA PTS system sucrose-specific EIIBCA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P23936 2.98e-21 102 37 2 154 3 lacS Lactose permease Streptococcus thermophilus
P43466 2.31e-19 96 36 2 134 3 rafP Raffinose carrier protein Pediococcus pentosaceus
P43470 1.11e-16 87 32 2 171 3 scrA PTS system sucrose-specific EIIBCA component Pediococcus pentosaceus
Q7WTB2 4.87e-16 85 36 4 155 2 lacS Lactose permease Lactobacillus helveticus
P22733 5.92e-16 85 39 0 101 3 lacY Lactose permease Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P69790 1.93e-12 68 36 5 127 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 1.93e-12 68 36 5 127 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q9S2H6 1.43e-11 63 40 1 75 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q48624 2.58e-08 60 28 3 140 3 lacS Lactose permease Leuconostoc lactis
P77272 1.25e-06 55 33 3 111 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q8XBJ1 1.34e-06 55 33 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q1R8U3 1.77e-06 54 33 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q8FFA9 1.8e-06 54 33 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83QN3 2.58e-06 54 33 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q32DC5 3.26e-06 53 32 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
P24241 3.94e-06 53 37 3 79 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q7A1Y1 7.09e-06 52 43 3 69 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 7.09e-06 52 43 3 69 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 7.09e-06 52 43 3 69 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 7.09e-06 52 43 3 69 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 7.09e-06 52 43 3 69 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 7.09e-06 52 43 3 69 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 7.09e-06 52 43 3 69 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q6GKB4 7.22e-06 52 43 3 69 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 7.22e-06 52 43 3 69 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q31Y50 7.62e-06 52 32 3 111 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
O32292 1.91e-05 46 33 0 69 3 yyzE Putative phosphotransferase enzyme IIA component YyzE Bacillus subtilis (strain 168)
Q7MBS2 0.000203 48 31 4 108 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q9CKN5 0.000205 48 26 4 142 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q8D4Z3 0.000274 47 31 4 108 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02280
Feature type CDS
Gene nagE
Product N-acetylglucosamine-specific PTS transporter subunit IIBC
Location 524804 - 526849 (strand: 1)
Length 2046 (nucleotides) / 681 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_328
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00358 phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1
PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02804 N-acetylglucosamine PTS system EIICBA or EIICB component [EC:2.7.1.193] Amino sugar and nucleotide sugar metabolism
Phosphotransferase system (PTS)		 -

Protein Sequence

MNILSYLQKIGRALMVPVATLPAAAILMGIGYWIDPVGWGNDNALAALLIKSGAAIIDNMSVLFAIGVAYGMSKDKDGAAALTGFVGFLVVTTLCSPAAVSMIKGLPLAEVPVAFGKINNQFVGILVGVLSAELYNRFSSVELPRALSFFSGRRLVPILTSFLMIIVAFILMYIWPVIYGGLVSFGESIKDMGALGAGIYAFFNRLLIPVGLHHALNSVFWFDVAGINDIPNFLAGQQAIDAGLATVGVTGRYQAGFFPVMMFGLPGAALAIYHCARKEHKAKVAGIMMAGAFAAFFTGITEPLEFSFMFVAPVLYVIHAFLMAISVYIAASMEWISGFGFSAGLVDMFLSSRNPLAVKWYMLIVQGIAFFFIYYGIFRFTITKFNLKTPGREDEVAGDETADGYDEDIKAVPTNSKEAVQQEARQYIAAVGGSDNLTGIDACITRLRLNVKDASVVNDAYAKHLGASGVIRLNKQSVQVIVGTRAEIVASAMRDVLAQGPVAAYAGRHTDNAVSTEKTSEKQTNNDAKVILEMVAPFDGEVVALKDVPDEAFSSGVVGDGLAIKPTSNIVMAPAAGTVVKIFDTNHAFCIETDNGVEIIVHMGIDTVALGGKGFKRLVEEGTEVKLGQPILELDLEYLNTNAKSMISPVIISNIDDFDKVSDIASGQVTANNTIIYKVLK

Flanking regions ( +/- flanking 50bp)

TAAATGAGTATAAATAAGATCCCAAATAGGGGTTATCCAAGGGGGAGTGTGTGAATATTTTAAGTTATCTGCAAAAGATAGGACGGGCATTGATGGTGCCCGTTGCGACATTGCCTGCTGCTGCAATTCTGATGGGAATAGGCTACTGGATTGATCCGGTAGGCTGGGGAAACGATAATGCGCTAGCTGCTTTACTGATCAAATCAGGTGCTGCCATTATCGATAATATGTCAGTATTGTTTGCGATAGGTGTTGCTTATGGTATGTCAAAAGACAAAGACGGGGCGGCGGCCTTAACTGGCTTTGTCGGCTTTTTAGTGGTGACTACACTTTGTTCACCTGCTGCGGTATCGATGATCAAAGGTCTACCACTTGCAGAAGTGCCTGTGGCTTTTGGTAAAATAAACAACCAGTTTGTCGGTATTCTGGTTGGGGTACTTTCAGCTGAGCTGTATAACCGCTTTAGCAGTGTCGAATTACCTCGTGCATTATCATTTTTTAGTGGTCGTCGCTTAGTGCCGATCCTCACGTCATTCTTGATGATTATCGTCGCCTTTATTCTAATGTATATCTGGCCGGTAATTTACGGCGGCTTAGTGAGCTTTGGTGAAAGCATTAAAGATATGGGGGCTTTGGGCGCCGGTATTTATGCTTTCTTTAACCGCCTATTAATTCCTGTTGGTTTACACCATGCGCTGAACTCTGTGTTCTGGTTTGATGTGGCGGGTATTAATGATATTCCTAACTTCCTTGCTGGTCAGCAAGCGATTGATGCGGGCTTGGCAACGGTCGGTGTGACAGGACGTTATCAAGCAGGTTTCTTCCCAGTTATGATGTTTGGTTTACCAGGGGCAGCACTGGCTATTTATCATTGTGCGCGCAAAGAGCATAAAGCAAAAGTTGCCGGTATCATGATGGCTGGGGCATTTGCGGCATTCTTTACGGGGATCACTGAACCGCTTGAATTCTCCTTTATGTTTGTTGCTCCAGTGCTTTATGTTATTCACGCATTCTTAATGGCGATTTCTGTTTATATTGCCGCAAGTATGGAGTGGATTTCAGGCTTTGGCTTTAGTGCGGGCCTTGTGGATATGTTCTTATCTTCACGCAACCCTCTGGCGGTTAAATGGTATATGTTGATTGTGCAAGGTATCGCATTCTTCTTCATTTACTATGGTATTTTCCGTTTCACTATTACTAAATTTAACCTGAAAACACCGGGTCGTGAAGATGAAGTGGCGGGGGATGAAACCGCAGACGGCTATGATGAAGATATCAAAGCCGTCCCCACTAATAGCAAAGAAGCAGTGCAACAAGAAGCACGTCAATATATCGCTGCAGTTGGTGGCTCAGATAACTTAACTGGTATTGATGCTTGTATTACTCGTTTACGTTTAAATGTAAAAGATGCCAGTGTAGTCAACGATGCTTACGCAAAACACCTAGGTGCTTCAGGGGTTATTCGCTTAAATAAACAGAGTGTTCAAGTGATTGTGGGCACACGGGCTGAAATTGTTGCAAGTGCCATGCGTGATGTATTAGCACAAGGCCCAGTTGCCGCTTATGCTGGTAGACATACAGATAACGCGGTATCGACAGAAAAAACATCAGAAAAACAGACTAATAATGATGCCAAAGTCATTCTTGAAATGGTCGCGCCATTTGATGGTGAAGTGGTTGCATTAAAAGATGTGCCTGATGAAGCTTTCTCAAGCGGTGTCGTGGGAGATGGTCTTGCTATTAAACCCACATCAAATATTGTGATGGCACCTGCTGCCGGTACGGTAGTAAAAATCTTTGATACTAACCACGCATTTTGCATTGAAACGGATAACGGTGTTGAGATTATCGTCCATATGGGGATTGATACGGTCGCATTAGGAGGAAAAGGCTTTAAACGTCTGGTTGAAGAAGGTACAGAGGTTAAACTCGGCCAGCCTATCTTAGAGCTAGATCTTGAGTATTTAAACACTAATGCTAAATCAATGATAAGTCCGGTTATCATCAGTAATATCGATGACTTTGATAAAGTGAGTGATATTGCATCCGGCCAAGTGACGGCAAATAACACCATAATCTATAAAGTATTAAAATAAATATCATATAGATATTTAATCCTCTATAAAGAGATGGTTAAATAAGACGA