Homologs in group_3285

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_10485 EHELCC_10485 100.0 Morganella morganii S2 nikD nickel import ATP-binding protein NikD
NLDBIP_10830 NLDBIP_10830 100.0 Morganella morganii S4 nikD nickel import ATP-binding protein NikD
LHKJJB_10525 LHKJJB_10525 100.0 Morganella morganii S3 nikD nickel import ATP-binding protein NikD
HKOGLL_13585 HKOGLL_13585 100.0 Morganella morganii S5 nikD nickel import ATP-binding protein NikD

Distribution of the homologs in the orthogroup group_3285

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3285

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X5U1 3.13e-98 290 58 1 242 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O157:H7
P33593 7.09e-98 290 58 1 242 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain K12)
Q32AQ2 8.26e-98 289 58 1 242 3 nikD Nickel import ATP-binding protein NikD Shigella dysenteriae serotype 1 (strain Sd197)
Q2RS21 2.83e-97 288 60 2 244 3 nikD Nickel import ATP-binding protein NikD Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0SZJ4 5.59e-97 287 58 1 242 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri serotype 5b (strain 8401)
Q83J78 5.84e-97 287 58 1 242 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri
Q1R5D9 1.16e-96 286 58 1 242 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain UTI89 / UPEC)
Q0TBX9 1.16e-96 286 58 1 242 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FCN0 1.51e-96 286 58 1 242 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8YCN8 2.89e-96 286 58 0 262 3 nikD Nickel import ATP-binding protein NikD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S8 2.89e-96 286 58 0 262 3 nikD Nickel import ATP-binding protein NikD Brucella abortus biovar 1 (strain 9-941)
Q2YL70 2.89e-96 286 58 0 262 3 nikD Nickel import ATP-binding protein NikD Brucella abortus (strain 2308)
Q8FVM9 1.46e-95 284 58 0 262 2 nikD Nickel import ATP-binding protein NikD Brucella suis biovar 1 (strain 1330)
Q3YW49 2.01e-95 283 57 1 242 3 nikD Nickel import ATP-binding protein NikD Shigella sonnei (strain Ss046)
Q31VE7 2.85e-95 283 57 1 242 3 nikD Nickel import ATP-binding protein NikD Shigella boydii serotype 4 (strain Sb227)
Q88HL1 4.7e-72 224 50 1 252 3 nikD Nickel import ATP-binding protein NikD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P50980 1.75e-58 192 39 2 260 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
Q07733 2.15e-58 192 39 2 260 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
A9CKL2 1.34e-50 176 39 4 257 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 1.38e-29 119 31 3 244 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P24136 1.15e-49 170 38 5 260 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
A1A967 2.52e-49 174 39 4 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 2.62e-32 127 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q1RE96 2.97e-49 174 39 4 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 7.97e-33 129 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q32IB5 3.23e-49 174 40 5 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 3.26e-33 130 38 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q8X6W1 1.62e-48 172 39 5 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 1.19e-32 129 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q323W5 1.7e-48 172 39 4 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 7.3e-33 129 38 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q3Z3V4 1.74e-48 172 39 4 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 1.77e-33 131 38 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
P75796 2.44e-48 172 39 4 264 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 1.77e-33 131 38 6 234 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q0TJM0 2.81e-48 172 39 4 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 8.29e-33 129 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A2U9 6.85e-48 165 38 2 235 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 6.85e-48 165 38 2 235 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P77268 1.31e-47 164 36 4 260 2 ddpD Probable D,D-dipeptide transport ATP-binding protein DdpD Escherichia coli (strain K12)
Q8FJL0 1.35e-47 170 38 4 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 2.09e-33 130 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42064 2.82e-47 163 36 4 258 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
Q83LT3 2.85e-47 169 39 5 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 7.92e-32 126 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
P26905 3.35e-47 163 36 4 269 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
Q0T6D3 3.57e-47 169 39 5 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 8.32e-32 126 37 6 234 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q2FVF0 1.6e-46 159 34 4 255 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
A2RI77 2.73e-46 160 36 2 257 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
A0A0H3JXA3 3.19e-46 158 34 4 255 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q57RB2 6.43e-46 165 37 3 263 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 5.98e-34 132 37 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q8ZQM4 1.92e-45 164 37 3 263 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 5.58e-34 132 37 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PGP3 1.99e-45 164 37 3 263 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 3.55e-34 133 37 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z864 8.82e-45 162 37 3 263 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 5.81e-34 132 37 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
P33916 1.65e-43 157 35 3 262 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 6.58e-39 145 38 5 237 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q8FUW8 2.2e-43 153 37 3 259 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 2.2e-43 153 37 3 259 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 2.2e-43 153 37 3 259 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
Q8YDH0 3.47e-43 152 37 3 259 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q53193 7.6e-43 151 35 2 255 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2YK63 4.32e-42 149 33 4 264 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 4.32e-42 149 33 4 264 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
A5VU87 7.91e-42 149 33 4 265 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P04285 1.38e-41 148 34 4 255 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FWP1 3.53e-41 147 33 4 264 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
Q8YBN6 3.88e-41 147 33 4 265 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A0A0H2ZGN6 5.69e-41 146 37 5 262 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
P45052 7.89e-41 146 35 5 247 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAG2 1.01e-40 145 35 4 261 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 1.01e-40 145 35 4 261 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 1.01e-40 145 35 4 261 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
P45095 1.09e-40 145 35 4 258 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6D3A9 1.41e-40 150 37 6 265 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 2.03e-35 136 37 7 235 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P76027 5.97e-40 144 35 4 235 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P63396 4.6e-39 146 35 3 255 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 7.81e-26 109 33 4 231 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 4.6e-39 146 35 3 255 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 7.81e-26 109 33 4 231 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 4.6e-39 146 35 3 255 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 7.81e-26 109 33 4 231 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8P2L5 5.34e-37 135 31 6 260 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q6D1C4 7.7e-37 136 35 9 262 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0CZ33 9.56e-37 135 31 6 260 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 9.56e-37 135 31 6 260 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 9.56e-37 135 31 6 260 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 9.56e-37 135 31 6 260 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
P24137 1.41e-36 134 30 6 263 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
P0A2V5 7.83e-36 132 33 4 233 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 7.83e-36 132 33 4 233 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
Q667L9 4.41e-35 131 34 9 262 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8RDH4 1.01e-34 130 32 3 259 1 dppD Dipeptide transport ATP-binding protein DppD Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P18766 1.64e-34 129 31 6 260 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1CFH7 6.39e-34 128 34 9 262 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 6.39e-34 128 34 9 262 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 6.39e-34 128 34 9 262 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D3Q6 5.74e-33 125 35 6 242 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PCG9 3.54e-32 124 35 6 238 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0BMC9 4.33e-32 124 31 7 258 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 4.33e-32 124 31 7 258 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q32JQ8 4.41e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q53194 4.87e-32 123 33 6 251 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q325U1 6.35e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q0TLD2 6.35e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7VM95 6.6e-32 123 32 7 256 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LN52 6.96e-32 123 31 6 260 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q3Z5F8 7.12e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 7.12e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 7.12e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 7.12e-32 123 35 8 242 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
P30750 9.24e-32 122 34 8 242 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q5NFU5 1.43e-31 122 31 7 258 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q8YBN5 1.44e-31 121 33 5 259 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 1.44e-31 121 33 5 259 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 1.44e-31 121 33 5 259 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 1.44e-31 121 33 5 259 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 1.44e-31 121 33 5 259 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8Z990 1.57e-31 122 34 8 242 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q83MC5 1.76e-31 122 35 8 242 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 1.76e-31 122 35 8 242 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q0AU85 2.28e-31 121 32 7 256 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8ZR89 2.44e-31 121 34 6 238 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57S53 3.04e-31 121 34 6 238 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q8Z8R5 3.82e-31 120 34 6 238 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q3A9G5 4.48e-31 120 32 4 235 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q14H97 6.15e-31 120 31 7 258 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q8RFN2 9.05e-31 120 32 6 243 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P45051 1.4e-30 119 28 6 263 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36636 1.45e-30 119 28 2 259 2 sapD Peptide transport system ATP-binding protein SapD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P72479 1.5e-30 119 31 6 234 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5PID0 2.08e-30 119 34 8 242 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P42065 2.34e-30 119 29 5 234 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
Q5WKL3 2.4e-30 119 31 5 254 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
A2RI78 2.52e-30 118 31 7 261 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
Q7A5Q8 3.12e-30 116 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain N315)
Q99UA2 3.12e-30 116 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q81IN8 3.57e-30 118 33 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8ZRM9 6.05e-30 117 32 8 262 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q81IZ6 6.24e-30 117 32 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73EL7 7.31e-30 117 33 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q57T09 8.26e-30 117 34 8 242 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q6HP89 8.63e-30 117 31 7 253 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q2KVK2 9.43e-30 117 34 11 262 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q6GH27 9.53e-30 115 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MRSA252)
Q32AQ1 1.01e-29 115 33 8 249 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
P08007 1.02e-29 117 31 3 232 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2FVF1 1.04e-29 115 30 4 233 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q81ZF5 1.07e-29 117 31 7 253 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q2YXY9 1.09e-29 115 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8FV85 1.22e-29 117 36 7 233 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.22e-29 117 36 7 233 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.22e-29 117 36 7 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.22e-29 117 36 7 233 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q81VM2 1.42e-29 117 32 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
P47325 1.53e-29 117 26 4 294 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P0AAH7 1.55e-29 116 27 2 259 3 sapD Peptide transport system ATP-binding protein SapD Shigella flexneri
P0AAH4 1.55e-29 116 27 2 259 1 sapD Putrescine export system ATP-binding protein SapD Escherichia coli (strain K12)
P0AAH5 1.55e-29 116 27 2 259 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAH6 1.55e-29 116 27 2 259 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O157:H7
Q63GR8 1.66e-29 116 30 7 253 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q5WDP1 1.73e-29 116 32 8 250 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
A0A0H2ZH52 1.85e-29 116 33 7 244 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
Q6G9I0 2.7e-29 114 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MSSA476)
Q5HG40 2.7e-29 114 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain COL)
Q2FYQ7 2.7e-29 114 29 5 258 1 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH57 2.7e-29 114 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain USA300)
Q65VG9 3.16e-29 116 33 6 234 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q63H29 3.6e-29 115 32 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q1R5D8 4.25e-29 114 33 8 249 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 4.25e-29 114 33 8 249 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 4.25e-29 114 33 8 249 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8NWT5 4.3e-29 113 29 5 258 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MW2)
Q3J1N0 4.67e-29 115 35 6 234 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3YW48 4.82e-29 114 33 8 249 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q38WL5 6.08e-29 115 31 8 266 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
P44785 6.25e-29 115 33 7 242 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMH4 6.72e-29 115 33 7 242 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
P45094 9.65e-29 114 32 5 233 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37313 1e-28 114 35 8 232 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
Q3KK97 1.18e-28 114 34 6 229 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q8G5P8 1.23e-28 115 34 8 237 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q8YA75 1.37e-28 114 29 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7VV72 1.48e-28 114 34 11 259 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 1.48e-28 114 34 11 259 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 1.48e-28 114 34 11 259 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8P4S7 1.73e-28 114 38 10 226 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 1.73e-28 114 38 10 226 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
P77737 1.99e-28 113 30 6 238 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
Q7A7E3 2.17e-28 114 27 5 250 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 2.17e-28 114 27 5 250 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7N8M2 2.29e-28 113 34 9 242 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P33594 2.38e-28 112 33 8 244 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q5WJP0 2.39e-28 113 31 5 259 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q92EZ6 2.39e-28 113 30 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0A0H3JT74 2.41e-28 111 30 4 233 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q31VE6 2.81e-28 112 33 8 249 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q73F11 2.84e-28 113 32 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3BNZ3 2.91e-28 113 37 10 225 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q724C0 3.36e-28 113 29 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q6AE21 4.36e-28 112 32 5 234 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q6N9W0 5.36e-28 113 34 6 234 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9CK97 5.85e-28 112 33 8 244 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q6N798 7.33e-28 113 34 10 260 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
O26096 7.68e-28 112 30 8 253 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q1CR30 8.87e-28 112 31 7 250 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
P54954 8.9e-28 110 34 8 232 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q5E715 8.92e-28 112 30 5 238 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6GIH9 9.52e-28 112 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q134N9 1.1e-27 112 35 7 234 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q2YJJ8 1.13e-27 111 34 6 238 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 1.13e-27 111 34 6 238 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
Q8NXH5 1.26e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 1.26e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 1.26e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 1.26e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 1.26e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q2YWP2 1.32e-27 111 30 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8X4L6 1.41e-27 110 33 8 247 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q5KVK2 1.56e-27 111 32 6 243 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q88RL5 1.69e-27 111 35 8 229 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6D5H7 1.76e-27 111 33 6 233 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8PGE8 2.23e-27 110 37 10 225 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q24QI5 2.25e-27 110 30 4 251 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
P45288 2.3e-27 111 27 2 260 3 sapD Peptide transport system ATP-binding protein SapD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1IGN4 2.4e-27 111 32 8 253 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q9ZJ34 2.58e-27 110 31 7 250 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q02ME3 3.1e-27 111 35 8 237 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7A6M2 3.35e-27 110 30 6 257 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 3.35e-27 110 30 6 257 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q032A0 3.79e-27 110 29 7 271 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q89LP2 3.9e-27 110 33 7 236 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
D8KFN1 3.95e-27 110 29 7 271 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 3.95e-27 110 29 7 271 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q8ELQ6 4.2e-27 110 33 7 234 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4KKK8 4.83e-27 110 35 8 231 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q17VE0 4.94e-27 109 31 7 250 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q8YDH1 4.99e-27 110 34 6 238 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P77622 5.82e-27 109 32 4 237 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q9S4Z0 5.83e-27 109 35 6 221 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
Q2NRN5 5.91e-27 110 31 6 260 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q6GJL2 7.63e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q1WVG9 8.12e-27 109 30 6 238 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q8NY21 9.28e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 9.28e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q9CIN4 9.71e-27 109 28 4 268 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q5HIL5 9.87e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 9.87e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 9.87e-27 109 26 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q3KJS6 1.11e-26 109 31 8 260 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q5H503 1.46e-26 108 33 9 255 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5JEB0 1.77e-26 108 30 5 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q4KK46 2.46e-26 108 33 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8NWT6 2.7e-26 105 27 5 249 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 2.7e-26 105 27 5 249 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q5HG41 2.73e-26 105 27 5 250 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 2.73e-26 105 27 5 250 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 2.73e-26 105 27 5 250 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q2P7S3 2.75e-26 108 33 9 255 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P16678 2.78e-26 106 32 7 258 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q1B677 3.38e-26 107 33 6 233 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q0KDG3 3.44e-26 107 34 6 233 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6GH28 3.66e-26 105 27 5 250 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q5YRD1 3.97e-26 107 33 8 241 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q1IGZ0 4.42e-26 107 34 8 230 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q9I1C8 4.64e-26 107 34 8 237 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A5Q9 4.77e-26 105 27 5 249 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 4.77e-26 105 27 5 249 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q1LQF6 5.69e-26 107 33 8 254 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0SZJ3 6.34e-26 105 32 8 249 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q83J77 7.26e-26 105 32 8 249 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q4ZZR8 8.89e-26 106 33 9 253 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q9KTJ5 9.12e-26 106 29 7 261 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q21BU8 9.42e-26 107 33 6 234 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q8ELA5 9.74e-26 106 33 5 235 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O32169 9.85e-26 106 32 6 232 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q2YVT7 1.03e-25 106 25 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q04B25 1.31e-25 106 28 9 263 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAN9 1.32e-25 106 28 9 263 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q12B04 1.51e-25 106 35 6 223 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
P75552 1.57e-25 107 25 4 275 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q0I5E9 1.84e-25 105 31 8 242 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q67SV5 1.85e-25 105 32 9 250 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q04DA7 2.2e-25 105 29 9 262 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7MN25 2.29e-25 105 28 6 260 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q48PU6 2.43e-25 105 32 9 253 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8DFC3 2.75e-25 105 28 6 260 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q03Z27 2.84e-25 105 28 7 268 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8Y0X3 3.16e-25 105 35 9 240 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q07LR5 3.17e-25 105 35 7 225 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q87RS1 3.41e-25 105 28 6 260 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9HT70 4.32e-25 104 34 7 228 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 4.32e-25 104 34 7 228 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q87AL9 4.73e-25 104 34 8 232 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8NSN2 6.17e-25 104 30 6 237 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q83F44 6.36e-25 104 30 5 249 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q49W48 6.62e-25 104 30 7 257 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q65M34 6.64e-25 104 29 5 227 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q4L4R9 6.69e-25 104 29 5 255 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q87UN4 8.93e-25 103 32 9 253 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2RS22 1.08e-24 102 33 6 233 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C0SP98 1.09e-24 103 29 7 259 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
Q9PF03 1.09e-24 103 34 8 231 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q7VI92 1.12e-24 103 29 9 255 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2YXZ0 1.2e-24 101 27 5 249 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q88RB3 1.46e-24 103 30 6 251 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6NJ07 1.57e-24 103 30 4 232 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8FRX8 1.7e-24 103 30 6 245 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5M5Z2 2.04e-24 103 28 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1F6 2.55e-24 103 28 8 258 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q46Y69 2.6e-24 102 33 9 256 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5L5Z1 2.71e-24 102 31 7 238 3 metN Methionine import ATP-binding protein MetN Chlamydia abortus (strain DSM 27085 / S26/3)
Q1J8E4 2.81e-24 102 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
O57896 3.11e-24 102 27 3 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8CQS7 3.16e-24 102 27 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 3.16e-24 102 27 7 234 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1M8E0 3.19e-24 102 35 9 237 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q043Y8 3.6e-24 102 30 8 239 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q13LD8 3.77e-24 103 32 6 233 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q832Y6 5.48e-24 102 27 6 252 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q5FKL2 5.94e-24 102 29 6 238 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q6MCV4 6.12e-24 102 29 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q03P57 6.21e-24 102 29 6 256 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q88UV2 6.3e-24 101 31 6 237 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9K789 6.37e-24 101 29 6 233 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q74IV9 6.5e-24 101 29 8 239 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q92LX3 7.24e-24 102 33 7 242 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q9A502 7.38e-24 101 34 8 242 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2NHW1 8.3e-24 99 27 7 259 3 pstB Phosphate import ATP-binding protein PstB Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q98DA2 9.4e-24 101 34 8 248 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q87UV4 9.89e-24 101 30 7 260 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q39IE7 1.07e-23 101 33 9 255 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q13VD7 1.16e-23 100 31 6 252 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q2SY12 1.44e-23 100 32 8 255 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6LV32 1.51e-23 98 28 7 247 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q8U4K3 1.53e-23 100 26 4 238 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q6A6X6 1.54e-23 100 29 7 256 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1BY14 1.64e-23 100 34 8 233 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 1.64e-23 100 34 8 233 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q0BH79 2.18e-23 100 35 9 233 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8EPK1 2.27e-23 100 29 5 232 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0AAI0 2.32e-23 99 26 9 271 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 2.32e-23 99 26 9 271 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 2.32e-23 99 26 9 271 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1BR30 2.36e-23 100 34 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 2.36e-23 100 34 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q815Y7 2.57e-23 100 31 7 236 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q4JTG9 2.65e-23 100 30 6 226 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q5HQQ9 3.09e-23 99 29 6 237 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0B6I6 3.35e-23 100 33 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0SFW6 3.47e-23 99 30 5 232 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
A1VZQ5 3.69e-23 97 27 6 231 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q8CTB2 4.14e-23 99 29 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CRI7 4.15e-23 98 28 6 237 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q72Y96 4.18e-23 99 31 7 236 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5X484 4.45e-23 99 29 9 258 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q8ZX91 4.81e-23 97 30 9 241 3 pstB Phosphate import ATP-binding protein PstB Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q0P9X7 5.04e-23 97 27 6 231 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q39AT4 5.41e-23 100 34 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q254K9 5.89e-23 99 30 5 236 3 metN Methionine import ATP-binding protein MetN Chlamydia felis (strain Fe/C-56)
Q7CHF8 5.93e-23 99 31 7 254 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 5.93e-23 99 31 7 254 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 5.93e-23 99 31 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 5.93e-23 99 31 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q48PN3 6.49e-23 99 30 7 260 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9MUN1 6.88e-23 99 27 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q5HM28 7.94e-23 97 28 6 237 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NR42 7.96e-23 96 33 4 204 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q93DA2 8.56e-23 99 27 7 259 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q81XL3 8.87e-23 98 31 7 236 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q631Y4 9.05e-23 98 31 7 236 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q0SFY5 9.24e-23 98 30 5 243 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q5WVL8 9.52e-23 98 29 7 251 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q2K284 1.03e-22 98 34 9 238 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q53I83 1.1e-22 98 30 6 258 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q63S19 1.11e-22 98 32 8 255 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 1.11e-22 98 32 8 255 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 1.11e-22 98 32 8 255 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q88KY4 1.18e-22 95 32 6 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q97KD5 1.23e-22 97 30 8 248 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P36638 1.25e-22 97 27 9 272 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5ZUG5 1.3e-22 98 28 7 251 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6HBS0 1.3e-22 98 31 9 242 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5XDS8 1.31e-22 98 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8GEH7 1.31e-22 97 31 6 224 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
P0CZ31 1.4e-22 98 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1JNE0 1.4e-22 98 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 1.4e-22 98 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0CZ30 1.4e-22 98 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q2IGQ6 1.43e-22 96 30 11 259 3 pstB Phosphate import ATP-binding protein PstB Anaeromyxobacter dehalogenans (strain 2CP-C)
Q45460 1.45e-22 98 25 7 251 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q6D734 1.45e-22 98 25 4 244 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3AAA4 1.77e-22 96 30 11 253 3 pstB Phosphate import ATP-binding protein PstB Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q48V78 1.92e-22 97 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 1.92e-22 97 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q2RWA3 1.95e-22 97 34 9 237 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5SLN1 1.99e-22 96 28 9 264 3 pstB Phosphate import ATP-binding protein PstB Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1QVQ7 2.01e-22 97 31 9 262 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6F9P2 2.27e-22 97 28 7 254 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q823C4 2.34e-22 97 30 5 236 3 metN Methionine import ATP-binding protein MetN Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5YZY9 2.36e-22 97 31 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q83GE8 2.47e-22 95 32 12 269 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain Twist)
P0CZ35 2.52e-22 97 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.52e-22 97 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 2.52e-22 97 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5XCA4 2.57e-22 97 29 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q3IQI3 2.63e-22 96 30 4 249 3 pstB2 Phosphate import ATP-binding protein PstB 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q97T09 3.3e-22 97 27 6 257 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9V2E4 3.57e-22 95 28 7 230 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q8P2K6 3.66e-22 97 27 8 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
P74548 3.78e-22 97 28 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1JII9 3.81e-22 97 26 6 262 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1J6Q6 4.12e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 4.12e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 4.12e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 4.12e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q4ZZK0 4.5e-22 97 29 7 260 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q8DMX9 4.54e-22 95 30 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 4.54e-22 95 30 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 4.54e-22 95 30 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q72GX5 5.19e-22 95 27 9 261 3 pstB Phosphate import ATP-binding protein PstB Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q83HT1 5.43e-22 94 32 12 269 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain TW08/27)
Q88WA5 5.59e-22 96 26 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q65F80 5.71e-22 96 29 6 232 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P37774 5.72e-22 94 29 9 260 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q4ZV73 6.25e-22 94 31 6 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q1QE80 6.31e-22 97 28 4 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q7CN92 6.32e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 6.32e-22 97 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q827Y0 6.47e-22 96 30 6 258 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8UH62 7e-22 96 31 4 235 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
A3DJK5 7.51e-22 95 27 5 235 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q30V33 7.71e-22 96 29 7 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1DDP4 7.8e-22 95 32 7 225 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q8DRF9 8.25e-22 96 27 6 257 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0LUE6 8.28e-22 96 30 4 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0BTP1 8.86e-22 95 30 10 242 3 pstB Phosphate import ATP-binding protein PstB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q31GF5 9.47e-22 93 31 7 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
O59479 1.03e-21 94 27 6 238 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P46341 1.29e-21 94 28 11 263 3 pstB2 Phosphate import ATP-binding protein PstB 2 Bacillus subtilis (strain 168)
Q8E9I8 1.42e-21 93 31 12 263 3 pstB2 Phosphate import ATP-binding protein PstB 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q831K6 1.6e-21 95 27 6 254 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q57SD6 1.8e-21 95 30 4 222 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q9L1C3 1.8e-21 95 30 6 251 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O67154 1.93e-21 93 28 11 262 3 pstB Phosphate import ATP-binding protein PstB Aquifex aeolicus (strain VF5)
Q8NQU4 2.05e-21 93 28 10 257 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P44662 2.21e-21 94 30 10 255 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q895C4 2.23e-21 94 27 5 227 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q8ENU2 2.28e-21 94 28 7 257 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q04F14 2.38e-21 94 27 5 236 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q5M397 2.71e-21 95 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN4 3.02e-21 95 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q03JH1 3.11e-21 95 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9V2C0 3.53e-21 94 28 5 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q8DUF7 3.61e-21 94 29 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6FAN3 4.09e-21 94 31 7 234 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O34992 4.16e-21 94 25 6 251 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q62B84 4.85e-21 94 32 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
P96063 4.89e-21 94 30 4 222 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9V1Q4 5.07e-21 92 26 6 238 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q8E3S0 5.1e-21 94 31 7 237 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q8U7G2 5.4e-21 94 32 7 242 3 metN Methionine import ATP-binding protein MetN Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3IS07 5.49e-21 92 31 10 239 3 pstB1 Phosphate import ATP-binding protein PstB 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3JHC9 5.52e-21 94 32 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
O51587 5.57e-21 94 25 7 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q63NI4 5.63e-21 94 32 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
O34362 5.69e-21 95 31 9 252 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 2.72e-10 63 25 5 228 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q9RYZ3 5.85e-21 92 32 10 243 3 pstB Phosphate import ATP-binding protein PstB Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q3IM36 6.21e-21 92 28 12 263 3 pstB3 Phosphate import ATP-binding protein PstB 3 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9KLQ5 6.51e-21 93 25 4 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X196 6.66e-21 94 28 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6G2E2 6.92e-21 93 32 6 229 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q660M8 7.23e-21 93 25 7 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q9RR46 7.34e-21 94 29 8 247 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q5PFQ7 7.43e-21 93 30 4 222 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0SML1 7.61e-21 93 25 7 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q47T99 7.61e-21 94 28 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q9KGD6 7.65e-21 92 30 7 230 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Z8W8 7.81e-21 93 30 4 222 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8DY54 8.16e-21 93 31 7 237 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 8.16e-21 93 31 7 237 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3A6U0 8.18e-21 91 27 10 277 3 pstB Phosphate import ATP-binding protein PstB Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q9KIF7 9.01e-21 94 26 4 241 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q5HV18 1.15e-20 92 28 4 240 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.15e-20 92 28 4 240 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q72D46 1.19e-20 91 29 10 239 3 pstB Phosphate import ATP-binding protein PstB Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DZJ0 1.21e-20 93 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.21e-20 93 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.21e-20 93 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P31134 1.22e-20 93 27 7 251 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q48KI4 1.24e-20 90 31 6 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9UZU7 1.32e-20 91 28 8 262 3 pstB Phosphate import ATP-binding protein PstB Pyrococcus abyssi (strain GE5 / Orsay)
Q73YZ5 1.36e-20 90 29 7 254 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 1.36e-20 90 29 7 254 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q0SVB6 1.38e-20 90 28 13 269 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain SM101 / Type A)
Q8XMP8 1.38e-20 90 28 13 269 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain 13 / Type A)
Q0TTG6 1.38e-20 90 28 13 269 3 pstB Phosphate import ATP-binding protein PstB Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P55662 1.45e-20 91 27 6 247 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q21XK2 1.7e-20 92 32 5 232 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q03A07 1.74e-20 92 30 7 239 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P27675 1.82e-20 90 26 10 250 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P9WQL3 1.84e-20 92 31 3 219 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 1.84e-20 92 31 3 219 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O57872 2.28e-20 90 30 8 228 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5ZWE4 2.46e-20 92 28 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9JZW0 2.55e-20 92 29 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6LKD4 2.87e-20 92 27 5 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q12L15 3.1e-20 90 30 14 272 3 pstB Phosphate import ATP-binding protein PstB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9JUX4 3.11e-20 91 29 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7M816 3.39e-20 90 29 6 231 3 metN Methionine import ATP-binding protein MetN Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q737I0 3.63e-20 92 27 9 258 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 1.09e-13 73 25 6 235 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7N8B9 4.06e-20 91 25 4 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8DWR3 4.53e-20 90 29 11 268 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 4.53e-20 90 29 11 268 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 4.53e-20 90 29 11 268 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5L3R0 4.53e-20 90 31 8 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08925
Feature type CDS
Gene nikD
Product nickel import ATP-binding protein NikD
Location 2507 - 3301 (strand: -1)
Length 795 (nucleotides) / 264 (amino acids)

Contig

Accession contig_10
Length 146103 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3285
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0444 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Protein Sequence

MSLNHSVLEVSHLSAGYLHNNHAHFLISNLSFSLRRGEVLALVGASGSGKSMTCSALLDVLPPGVQKTQGTILLDGQPVTGQALRGREVASIMQNPRSAFNPVRTMHQHITETLKATRQPLHDIDKRIRDVLAEVELGDSEHILKLYPFEMSGGMLQRMMIAIAILSDAPFLFADEPTTDLDLVVQMKILDLLDHIVSDRQTGLLLITHDMGVVARLADQVAVLSDGNIIETGPVEDIFARPRSPVTRNLISAHLSLYGLELSA

Flanking regions ( +/- flanking 50bp)

CTCGGGGATGCTCTGCGTGATCGTCTGGATCCGACACTGAGGGCCGGGACATGTCATTAAATCATTCTGTATTGGAGGTCAGCCATCTGTCGGCGGGGTATCTGCATAATAATCATGCCCATTTCCTGATTTCTAATCTGTCATTTTCACTGCGGCGCGGCGAAGTGCTGGCGCTGGTCGGCGCGAGCGGCTCCGGCAAATCCATGACCTGCTCTGCGCTGCTGGATGTACTGCCGCCGGGTGTGCAGAAAACACAGGGCACTATTTTGCTGGACGGACAGCCGGTCACCGGACAGGCCCTGCGCGGCAGGGAAGTGGCGTCGATTATGCAGAACCCGCGCAGTGCATTTAACCCGGTGCGGACCATGCATCAGCATATTACCGAAACACTGAAGGCCACCCGGCAGCCGCTGCATGATATTGATAAACGCATCCGTGATGTGCTGGCGGAAGTGGAACTGGGGGACAGTGAGCATATCCTGAAGCTCTATCCGTTTGAGATGAGCGGCGGCATGTTACAGCGGATGATGATCGCGATTGCGATCCTCAGCGACGCGCCGTTTCTGTTTGCTGATGAGCCGACTACCGATCTGGATCTGGTGGTGCAGATGAAAATTCTCGATTTGCTGGATCATATAGTATCTGACCGGCAGACCGGGCTTTTGCTGATCACCCATGATATGGGCGTGGTGGCGCGCCTTGCCGATCAGGTGGCGGTGCTGTCAGACGGGAACATTATTGAAACCGGTCCGGTGGAGGATATTTTTGCCCGGCCGCGCTCGCCGGTGACCCGTAATCTTATTTCTGCACACCTTTCACTGTATGGTCTGGAGCTTTCCGCATGACATTGATCTCTGTTGAACACCTGAGCAAAAGCTACCAAAGCCATTCACTG