Homologs in group_189

Help

8 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_13170 EHELCC_13170 100.0 Morganella morganii S2 xerC tyrosine recombinase XerC
NLDBIP_13510 NLDBIP_13510 100.0 Morganella morganii S4 xerC tyrosine recombinase XerC
LHKJJB_13045 LHKJJB_13045 100.0 Morganella morganii S3 xerC tyrosine recombinase XerC
HKOGLL_11985 HKOGLL_11985 100.0 Morganella morganii S5 xerC tyrosine recombinase XerC
F4V73_RS09555 F4V73_RS09555 87.9 Morganella psychrotolerans xerC tyrosine recombinase XerC
PMI_RS05890 PMI_RS05890 27.1 Proteus mirabilis HI4320 - tyrosine-type recombinase/integrase
PMI_RS09895 PMI_RS09895 23.0 Proteus mirabilis HI4320 - tyrosine-type recombinase/integrase
PMI_RS16605 PMI_RS16605 72.0 Proteus mirabilis HI4320 xerC tyrosine recombinase XerC

Distribution of the homologs in the orthogroup group_189

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_189

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O31207 4.91e-163 458 73 0 298 1 xerC Tyrosine recombinase XerC Proteus mirabilis
Q8D1K0 8.18e-151 427 68 2 304 3 xerC Tyrosine recombinase XerC Yersinia pestis
Q7ZAL9 5.19e-147 417 69 1 297 3 xerC Tyrosine recombinase XerC Shigella flexneri
Q329Y7 5.19e-147 417 69 1 297 3 xerC Tyrosine recombinase XerC Shigella dysenteriae serotype 1 (strain Sd197)
P55888 5.45e-147 417 68 2 304 3 xerC Tyrosine recombinase XerC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3A8 6.78e-147 417 68 2 304 3 xerC Tyrosine recombinase XerC Salmonella typhi
B5YY58 2.46e-146 416 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4T6 2.46e-146 416 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7
B7M613 2.8e-146 416 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O8 (strain IAI1)
A7ZU16 2.8e-146 416 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SZ02 3.6e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Shigella flexneri serotype 5b (strain 8401)
Q3YVF5 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Shigella sonnei (strain Ss046)
Q31UH7 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 4 (strain Sb227)
B2TUW7 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LU45 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLY2 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SMS-3-5 / SECEC)
B6I4F2 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SE11)
B7NFB3 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8P6 4.06e-146 415 68 1 297 1 xerC Tyrosine recombinase XerC Escherichia coli (strain K12)
B1IW93 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P7 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A6R9 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O9:H4 (strain HS)
B1XAH7 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / DH10B)
C4ZZ74 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N2A1 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O81 (strain ED1a)
B7NTD1 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L968 4.06e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain 55989 / EAEC)
Q1R4C3 4.29e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli (strain UTI89 / UPEC)
A1AHX9 4.29e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O1:K1 / APEC
B7MH75 4.29e-146 415 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UNC8 8.55e-146 414 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
O31087 1.09e-145 414 68 1 291 3 xerC Tyrosine recombinase XerC Serratia marcescens
Q0TAR4 1.12e-145 414 68 1 297 3 xerC Tyrosine recombinase XerC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P44818 8.93e-125 361 57 1 296 1 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UE41 6.97e-124 359 57 1 296 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain PittEE)
Q4QMP0 1.15e-123 358 57 1 296 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain 86-028NP)
A6VQS4 1.53e-123 358 58 1 289 3 xerC Tyrosine recombinase XerC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UWL5 1.47e-122 355 55 1 294 3 xerC Tyrosine recombinase XerC Histophilus somni (strain 2336)
Q65V80 1.76e-120 350 56 1 291 3 xerC Tyrosine recombinase XerC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CKC2 3.28e-117 342 54 1 291 3 xerC Tyrosine recombinase XerC Pasteurella multocida (strain Pm70)
Q7MQB9 3.49e-116 340 56 2 290 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain YJ016)
Q7ZAI9 3.49e-116 340 56 2 290 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain CMCP6)
A1SQX0 1.33e-112 330 54 2 292 3 xerC Tyrosine recombinase XerC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B7VMD2 2.73e-112 330 56 2 289 3 xerC Tyrosine recombinase XerC Vibrio atlanticus (strain LGP32)
Q87KJ6 2.56e-111 327 55 2 290 3 xerC Tyrosine recombinase XerC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B3GZ58 6.18e-111 326 51 1 301 3 xerC Tyrosine recombinase XerC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
C3LPX0 1.05e-110 326 53 2 297 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVL4 1.05e-110 326 53 2 297 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4I4 1.05e-110 326 53 2 297 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7N0V8 1.7e-110 325 55 2 290 3 xerC Tyrosine recombinase XerC Vibrio campbellii (strain ATCC BAA-1116)
Q7VKG8 2.02e-105 312 48 1 298 3 xerC Tyrosine recombinase XerC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1SAP3 8.97e-99 295 51 2 289 3 xerC Tyrosine recombinase XerC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1RPD0 2.65e-96 289 51 5 303 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain W3-18-1)
A4YBF5 2.65e-96 289 51 5 303 3 xerC Tyrosine recombinase XerC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HN93 1.93e-95 286 50 3 295 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-4)
A0KS67 1.93e-95 286 50 3 295 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain ANA-3)
Q0HQJ4 2.53e-95 286 50 3 295 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-7)
Q7ZAJ5 3.08e-93 281 49 4 307 3 xerC Tyrosine recombinase XerC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0VM16 1.55e-91 277 47 4 306 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8P550 3.71e-91 276 49 2 303 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNK3 3.71e-91 276 49 2 303 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain B100)
Q4UYY0 3.71e-91 276 49 2 303 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain 8004)
Q88B11 7.22e-88 267 50 3 288 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8PPP9 8.76e-88 267 48 3 305 3 xerC Tyrosine recombinase XerC Xanthomonas axonopodis pv. citri (strain 306)
A6VE54 1.9e-87 266 50 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain PA7)
Q51566 4.02e-87 266 50 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q500B4 5.64e-87 265 49 3 288 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. syringae (strain B728a)
Q48C04 9.41e-87 265 49 3 288 3 xerC Tyrosine recombinase XerC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q02E82 1.9e-86 264 49 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5H1 1.9e-86 264 49 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain LESB58)
A4VGW3 6.52e-86 262 50 3 288 3 xerC Tyrosine recombinase XerC Stutzerimonas stutzeri (strain A1501)
Q1QSU9 1.2e-85 262 49 5 294 3 xerC Tyrosine recombinase XerC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8VS06 6.68e-85 260 48 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens
Q4K3W0 1.2e-84 259 48 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1I301 3.45e-83 255 47 3 292 3 xerC Tyrosine recombinase XerC Pseudomonas entomophila (strain L48)
Q88CF1 4.53e-83 255 48 3 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3K4R6 4.68e-83 255 48 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain Pf0-1)
A5WAU7 1.04e-82 254 48 3 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1J1V8 1.56e-82 254 47 3 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain W619)
C1DJ58 5.7e-82 252 48 3 292 3 xerC Tyrosine recombinase XerC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0KQ43 1e-81 252 48 3 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain GB-1)
Q9PD96 6.12e-81 249 46 2 289 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain 9a5c)
Q87DI2 3.09e-80 248 46 2 289 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA18 3.09e-80 248 46 2 289 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain M23)
Q7NVH1 1.74e-77 241 48 6 293 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
C3K438 5.15e-74 232 48 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain SBW25)
B2U7W2 4.81e-71 225 43 8 307 3 xerC Tyrosine recombinase XerC Ralstonia pickettii (strain 12J)
B4RNW5 1.09e-69 221 43 5 284 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain NCCP11945)
Q5FAI3 1.09e-69 221 43 5 284 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JW14 1.02e-68 219 41 6 302 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B5YFZ8 1.21e-68 218 39 5 293 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A9M1G2 1.36e-68 218 41 5 298 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C (strain 053442)
A1KS31 3e-68 218 41 5 298 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JXV6 7.43e-68 216 46 2 233 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8Y3C8 1.32e-67 217 44 9 309 3 xerC1 Tyrosine recombinase XerC 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7ZAM3 8.1e-65 208 38 4 293 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Y5V0 1.02e-64 208 40 4 292 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71Y59 1.22e-63 205 40 4 292 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
Q92A53 2.09e-63 205 39 4 292 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B3E1H7 1.06e-60 199 38 6 309 3 xerC Tyrosine recombinase XerC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q2LT92 8.26e-59 193 34 5 312 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)
Q1D804 1.02e-58 193 39 6 295 3 xerC Tyrosine recombinase XerC Myxococcus xanthus (strain DK1622)
P59818 1.02e-58 193 39 6 295 3 xerC Tyrosine recombinase XerC Myxococcus xanthus
A1AKP9 1.36e-58 192 39 5 293 3 xerC Tyrosine recombinase XerC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q7ZAJ2 2.69e-58 192 35 4 293 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HP53 2.69e-58 192 35 4 293 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O31206 6.23e-58 191 38 5 304 1 xerD Tyrosine recombinase XerD Proteus mirabilis
Q7ZAM8 1.11e-57 191 35 6 304 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RY9 1.11e-57 191 35 6 304 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7ZAP1 1.77e-57 190 38 4 300 3 xerD Tyrosine recombinase XerD Bifidobacterium longum (strain NCC 2705)
Q4L6J7 5.9e-57 188 34 3 292 3 xerD Tyrosine recombinase XerD Staphylococcus haemolyticus (strain JCSC1435)
P46352 6.01e-57 188 36 4 290 3 xerD Tyrosine recombinase XerD Bacillus subtilis (strain 168)
A0LEB8 9.8e-57 189 38 7 324 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q7ZAM5 1.93e-56 187 34 3 304 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B2A335 2.73e-56 187 36 2 292 3 xerC Tyrosine recombinase XerC Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q9KCP0 3.62e-56 186 36 4 292 3 xerD Tyrosine recombinase XerD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q93C64 4.59e-55 183 37 4 289 3 xerD Tyrosine recombinase XerD Lacticaseibacillus casei
Q49XU5 6.15e-55 183 34 4 294 3 xerD Tyrosine recombinase XerD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7ZAK0 1.05e-54 183 37 4 294 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P0A2P6 1.13e-54 182 39 5 296 1 xerD Tyrosine recombinase XerD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P7 1.13e-54 182 39 5 296 3 xerD Tyrosine recombinase XerD Salmonella typhi
A9B1E0 2.1e-54 182 37 5 279 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A5D2W6 2.78e-54 182 37 4 306 3 xerC Tyrosine recombinase XerC Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8X574 2.79e-54 181 37 4 295 3 xerD Tyrosine recombinase XerD Escherichia coli O157:H7
P39776 3.41e-54 181 34 6 294 1 xerC Tyrosine recombinase XerC Bacillus subtilis (strain 168)
Q7ZAM0 4.48e-54 181 37 4 295 3 xerD Tyrosine recombinase XerD Shigella flexneri
P0A8P8 4.73e-54 181 37 4 295 1 xerD Tyrosine recombinase XerD Escherichia coli (strain K12)
P0A8P9 4.73e-54 181 37 4 295 3 xerD Tyrosine recombinase XerD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8KET0 7.78e-54 181 34 7 306 3 xerD Tyrosine recombinase XerD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8NNZ9 9.67e-54 180 36 4 289 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P0A0P1 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MW2)
P0A0P2 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus
Q6G967 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MSSA476)
Q6GGK1 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MRSA252)
P0A0P0 1.78e-53 179 34 3 290 1 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain N315)
P0A0N9 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFS5 1.78e-53 179 34 3 290 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain COL)
Q9KA25 2.47e-53 179 36 6 298 3 xerC Tyrosine recombinase XerC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9Z9F7 3.15e-53 179 34 6 315 3 xerC Tyrosine recombinase XerC Chlamydia pneumoniae
Q7ZAN4 4.29e-53 179 37 6 298 3 xerD Tyrosine recombinase XerD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A0QVB4 4.42e-53 178 37 6 301 3 xerC Tyrosine recombinase XerC Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B3QM22 1.63e-52 178 34 6 317 3 xerC Tyrosine recombinase XerC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q9HXQ6 1.94e-52 177 37 3 290 3 xerD Tyrosine recombinase XerD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q039E1 2e-52 177 36 4 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 2e-52 177 36 4 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
Q8ZHK1 2.37e-52 176 37 5 294 3 xerD Tyrosine recombinase XerD Yersinia pestis
A8FD78 2.5e-52 176 35 6 294 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
Q04A03 2.83e-52 176 37 6 294 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 2.83e-52 176 37 6 294 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q48733 2.99e-52 176 37 6 294 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
Q9PK47 7.55e-52 176 33 5 304 3 xerC Tyrosine recombinase XerC Chlamydia muridarum (strain MoPn / Nigg)
Q65JN5 1.95e-51 174 33 2 294 3 xerC Tyrosine recombinase XerC Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q49890 2.17e-51 174 35 6 310 3 xerD Tyrosine recombinase XerD Mycobacterium leprae (strain TN)
B8DG54 1.52e-50 172 34 4 293 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
Q3SVJ8 1.85e-50 172 37 7 312 3 xerC Tyrosine recombinase XerC Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7ZAJ8 3.23e-50 171 35 4 303 3 xerD Tyrosine recombinase XerD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B9DPG4 4.17e-50 171 35 4 295 3 xerC Tyrosine recombinase XerC Staphylococcus carnosus (strain TM300)
Q8Y7K0 4.35e-50 171 33 3 293 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7MNQ0 4.82e-50 171 34 4 292 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain YJ016)
Q7ZAJ0 4.82e-50 171 34 4 292 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain CMCP6)
Q8NQL5 5.39e-50 171 36 6 303 3 xerD Tyrosine recombinase XerD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q720E4 5.75e-50 170 33 3 293 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain F2365)
C1L2I5 5.75e-50 170 33 3 293 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8UC70 8.83e-50 170 36 4 305 3 xerC Tyrosine recombinase XerC Agrobacterium fabrum (strain C58 / ATCC 33970)
A0AI80 1.01e-49 170 34 4 293 3 xerC Tyrosine recombinase XerC Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5L6G3 1.23e-49 170 32 6 306 3 xerC Tyrosine recombinase XerC Chlamydia abortus (strain DSM 27085 / S26/3)
Q9KPE9 2.01e-49 169 36 6 293 3 xerD Tyrosine recombinase XerD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A7NFG3 2.16e-49 169 35 5 292 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
O84351 3.08e-49 169 39 3 221 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBY1 3.08e-49 169 39 3 221 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KM11 3.08e-49 169 39 3 221 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7R6 3.08e-49 169 39 3 221 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q7ZAJ4 3.74e-49 168 34 7 301 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPU0 3.74e-49 168 34 7 301 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WF35 3.91e-49 168 41 4 235 1 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF34 3.91e-49 168 41 4 235 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6P9 3.91e-49 168 41 4 235 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AG09 3.91e-49 168 41 4 235 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMN8 3.91e-49 168 41 4 235 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67629 3.91e-49 168 41 4 235 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B7GGC7 4.44e-49 168 30 4 301 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1RHT1 6.84e-49 167 35 8 303 3 xerD Tyrosine recombinase XerD Rickettsia bellii (strain RML369-C)
Q8NWZ8 7.92e-49 167 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MW2)
Q6G9W1 7.92e-49 167 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MSSA476)
P9WF33 9.91e-49 167 35 5 305 1 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF32 9.91e-49 167 35 5 305 3 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67637 9.91e-49 167 35 5 305 3 xerD Tyrosine recombinase XerD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8KBZ5 1.2e-48 168 33 6 316 3 xerC Tyrosine recombinase XerC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q6GHI3 1.32e-48 167 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MRSA252)
Q9CPF0 1.87e-48 166 33 6 306 3 xerD Tyrosine recombinase XerD Pasteurella multocida (strain Pm70)
P67631 2.33e-48 166 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain N315)
P67630 2.33e-48 166 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X1M7 2.33e-48 166 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5ISD6 2.49e-48 166 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH9)
A6U170 2.49e-48 166 35 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH1)
Q92C75 3.01e-48 166 33 4 293 3 xerC Tyrosine recombinase XerC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2YXL6 3.46e-48 166 34 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZDG8 3.97e-48 166 34 6 290 3 xerD Tyrosine recombinase XerD Rickettsia prowazekii (strain Madrid E)
A5URM3 4.7e-48 166 34 6 295 3 xerC Tyrosine recombinase XerC Roseiflexus sp. (strain RS-1)
Q7VPN8 5.95e-48 165 32 4 291 3 xerD Tyrosine recombinase XerD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A8Z3T2 7.32e-48 165 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300 / TCH1516)
A6QGF2 7.32e-48 165 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Newman)
Q5HGI0 7.32e-48 165 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain COL)
Q2FZ30 7.32e-48 165 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHI6 7.32e-48 165 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300)
Q88MV0 7.89e-48 165 37 4 294 3 xerD Tyrosine recombinase XerD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4UM01 8.47e-48 165 35 7 290 3 xerD Tyrosine recombinase XerD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A3PXY1 9.76e-48 164 36 7 307 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain JLS)
Q1BAI5 1.89e-47 164 36 7 307 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain MCS)
A1UEH7 1.89e-47 164 36 7 307 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain KMS)
B4SDZ2 3.32e-47 164 33 6 315 3 xerC Tyrosine recombinase XerC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q49X37 4.01e-47 163 34 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q92IC9 5.6e-47 163 35 6 290 3 xerD Tyrosine recombinase XerD Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q97HE5 9.33e-47 162 29 5 291 3 CA_C2066 Putative tyrosine recombinase CA_C2066 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A4TEB1 9.81e-47 162 40 3 234 3 xerC Tyrosine recombinase XerC Mycolicibacterium gilvum (strain PYR-GCK)
Q823T9 1.17e-46 162 30 5 311 3 xerC Tyrosine recombinase XerC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9KJF6 4.28e-46 160 34 2 290 3 xerC Tyrosine recombinase XerC Staphylococcus aureus
B8I9N8 7.79e-46 160 37 6 312 3 xerC Tyrosine recombinase XerC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q4L5V4 8e-46 159 33 3 296 3 xerC Tyrosine recombinase XerC Staphylococcus haemolyticus (strain JCSC1435)
Q03FK2 1.32e-45 159 34 4 293 3 xerC Tyrosine recombinase XerC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q89X68 2.11e-45 159 35 5 298 3 xerC Tyrosine recombinase XerC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7ZAN7 4.94e-45 158 35 6 304 3 xerC Tyrosine recombinase XerC Brucella suis biovar 1 (strain 1330)
Q8YJD9 6.25e-45 157 35 6 304 3 xerC Tyrosine recombinase XerC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P44630 6.33e-45 157 31 5 297 3 xerD Tyrosine recombinase XerD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CBU0 1.41e-44 156 39 4 237 3 xerC Tyrosine recombinase XerC Mycobacterium leprae (strain TN)
Q9K068 1.43e-44 156 36 7 292 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9PDF4 1.95e-44 157 36 6 303 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain 9a5c)
Q92LK1 2.52e-44 156 36 5 302 3 xerC Tyrosine recombinase XerC Rhizobium meliloti (strain 1021)
Q9A437 4.04e-44 155 34 5 300 3 xerD Tyrosine recombinase XerD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7ZAM7 1.08e-43 154 31 5 301 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SA5 1.08e-43 154 31 5 301 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B6IPE2 1.79e-43 154 35 6 310 3 xerC Tyrosine recombinase XerC Rhodospirillum centenum (strain ATCC 51521 / SW)
Q253S9 2.09e-43 154 30 6 313 3 xerC Tyrosine recombinase XerC Chlamydia felis (strain Fe/C-56)
Q9JV76 5.53e-43 152 35 6 291 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8PCQ9 8.4e-43 152 37 7 313 3 xerD Tyrosine recombinase XerD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PGR5 1.08e-42 152 36 6 304 3 xerD Tyrosine recombinase XerD Xanthomonas axonopodis pv. citri (strain 306)
Q8XWD0 2.2e-42 151 34 7 294 3 xerD Tyrosine recombinase XerD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2NB52 9.87e-42 149 36 8 296 3 xerC Tyrosine recombinase XerC Erythrobacter litoralis (strain HTCC2594)
Q8U9U6 1.15e-41 149 32 7 322 3 xerD Tyrosine recombinase XerD Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5JHA3 2.43e-41 147 37 10 285 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q87DN0 2.37e-40 146 35 6 303 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0UNY7 2.62e-40 145 36 6 308 3 xerC Tyrosine recombinase XerC Methylobacterium sp. (strain 4-46)
Q98ED9 3.11e-40 145 35 6 309 3 xerC Tyrosine recombinase XerC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98FX8 4.28e-40 145 34 7 304 3 xerD Tyrosine recombinase XerD Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7ZAN6 4.28e-40 145 36 7 306 3 xerD Tyrosine recombinase XerD Brucella suis biovar 1 (strain 1330)
Q92ME3 8.56e-40 144 33 10 327 3 xerD Tyrosine recombinase XerD Rhizobium meliloti (strain 1021)
Q89XW5 1.33e-39 144 32 6 307 3 xerD Tyrosine recombinase XerD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O59490 1.33e-39 143 35 10 279 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8YJP2 1.99e-39 143 35 7 306 3 xerD Tyrosine recombinase XerD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9Z6N5 4.21e-39 142 32 9 295 3 xerD Tyrosine recombinase XerD Chlamydia pneumoniae
Q9PL53 6.64e-39 142 30 9 300 3 xerD Tyrosine recombinase XerD Chlamydia muridarum (strain MoPn / Nigg)
P0C122 8.81e-39 141 35 7 306 3 xerD Tyrosine recombinase XerD Brucella abortus biovar 1 (strain 9-941)
Q2YR40 8.81e-39 141 35 7 306 2 xerD Tyrosine recombinase XerD Brucella abortus (strain 2308)
O84872 1.73e-38 140 30 8 295 3 xerD Tyrosine recombinase XerD Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A8F033 3e-38 140 29 7 311 3 xerC Tyrosine recombinase XerC Rickettsia canadensis (strain McKiel)
B6YWN8 3.6e-38 139 35 8 281 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
O26979 5.05e-38 139 32 8 292 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q68VT2 7.69e-38 139 30 7 311 3 xerC Tyrosine recombinase XerC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UJZ3 3.09e-37 137 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZCE0 3.86e-37 137 29 7 311 3 xerC Tyrosine recombinase XerC Rickettsia prowazekii (strain Madrid E)
A8GXV3 6.61e-37 136 28 7 311 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain OSU 85-389)
Q73NE4 1.84e-36 135 31 7 303 3 xerC Tyrosine recombinase XerC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8XTL6 2.44e-36 136 36 6 223 3 xerC2 Tyrosine recombinase XerC 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C3PLU8 2.49e-36 135 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia africae (strain ESF-5)
A8F2V6 3.8e-36 134 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia massiliae (strain Mtu5)
Q92G55 4.17e-36 134 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1RK56 5.66e-36 134 28 7 311 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain RML369-C)
C4K256 9.38e-36 133 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia peacockii (strain Rustic)
A8GQ15 1.29e-35 133 29 7 311 3 xerC Tyrosine recombinase XerC Rickettsia akari (strain Hartford)
Q8TZV9 2.02e-35 132 32 9 287 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A8GTV8 4.94e-35 131 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Sheila Smith)
B0BVE6 4.94e-35 131 30 9 315 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Iowa)
Q9V1P5 7.93e-35 130 35 10 281 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
A8F7B4 2.15e-34 129 32 6 276 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q8RAB1 1.08e-33 127 27 5 288 3 TTE1313 Putative tyrosine recombinase TTE1313 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B7IFN3 4.98e-32 123 30 8 277 3 THA_404 Tyrosine recombinase THA_404 Thermosipho africanus (strain TCF52B)
B7GQE1 8.64e-32 124 30 13 352 3 xerC Tyrosine recombinase XerC Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B3DQV1 2.4e-31 123 29 13 352 3 xerC Tyrosine recombinase XerC Bifidobacterium longum (strain DJO10A)
C4ZGY6 7.76e-31 120 25 7 308 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q8RA66 5.62e-28 114 27 8 294 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P55636 5.62e-24 102 30 10 290 3 NGR_a01840 Putative integrase/recombinase y4rC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O25386 4.75e-21 95 32 6 198 1 xerH Tyrosine recombinase XerH Helicobacter pylori (strain ATCC 700392 / 26695)
P55429 6.97e-20 90 31 6 211 3 NGR_a03870 Putative integrase/recombinase y4eF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55632 1.03e-18 87 31 5 213 3 NGR_a01870 Putative integrase/recombinase y4qK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P72680 1.49e-16 82 27 6 233 3 xerC Tyrosine recombinase slr0733 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P62592 1.56e-16 82 27 6 222 3 int Integrase/recombinase Salmonella typhi
P62591 1.56e-16 82 27 6 222 3 int Integrase/recombinase Pseudomonas aeruginosa
P62590 1.56e-16 82 27 6 222 3 int Integrase/recombinase Escherichia coli
P55634 3.84e-16 81 28 10 294 3 NGR_a01860 Putative integrase/recombinase y4rA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0PA27 3.92e-16 81 30 6 186 1 xerH Tyrosine recombinase XerH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B9DUD2 5.05e-15 77 31 3 151 3 xerS Tyrosine recombinase XerS Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P55639 5.15e-15 78 31 7 221 3 NGR_a01810 Putative integrase/recombinase y4rF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A2RKP9 3.12e-14 75 31 4 161 1 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain MG1363)
Q02YZ4 3.46e-14 75 31 4 161 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain SK11)
A3CN22 4.34e-14 75 31 4 160 3 xerS Tyrosine recombinase XerS Streptococcus sanguinis (strain SK36)
A8AXA5 4.43e-14 75 31 4 160 3 xerS Tyrosine recombinase XerS Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C0MBC3 4.6e-14 75 33 4 151 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. equi (strain 4047)
Q9CG78 5.35e-14 75 31 4 161 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. lactis (strain IL1403)
Q97QP2 6e-14 74 32 4 151 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1IBW3 6.91e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Hungary19A-6)
C1CKQ9 7.11e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain P1031)
B5E4Q4 7.97e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 19F (strain G54)
B8ZQ39 8.2e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7D0 8.2e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain 70585)
C1CRN6 8.43e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Taiwan19F-14)
C1CEC5 8.43e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain JJA)
Q7ZAK7 8.43e-14 74 32 4 151 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IPW6 8.43e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain CGSP14)
Q04KF1 8.43e-14 74 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q5M4E9 2.3e-13 73 31 4 151 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZT9 2.65e-13 72 31 4 151 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain CNRZ 1066)
C0MFD9 2.88e-13 72 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain H70)
Q03KP9 3.14e-13 72 31 4 151 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B4U2Z3 3.2e-13 72 32 4 151 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
P0ADH9 3.49e-13 70 28 3 175 3 fimE Type 1 fimbriae regulatory protein FimE Shigella flexneri
P0ADH7 3.49e-13 70 28 3 175 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli (strain K12)
P0ADH8 3.49e-13 70 28 3 175 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q980D9 5.52e-13 71 27 6 211 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P67633 8.2e-13 71 26 7 256 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67632 8.2e-13 71 26 7 256 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype III (strain NEM316)
Q3K1A9 8.2e-13 71 26 7 256 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5XC26 8.84e-13 71 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A2RED8 9.53e-13 71 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M5 (strain Manfredo)
Q48TG2 1.15e-12 71 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0DH45 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1J6H1 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JBN4 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8P0Y8 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DH44 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67634 1.17e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M1
P10020 1.24e-12 70 31 4 148 3 tnpI TnP I resolvase Bacillus thuringiensis
Q1JGQ2 1.24e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M2 (strain MGAS10270)
B5XLN3 1.27e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JLL7 1.29e-12 70 30 4 151 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS9429)
O69155 3.11e-12 69 31 4 151 3 xerS Tyrosine recombinase XerS Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A4VUQ8 4.69e-12 69 33 4 151 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 05ZYH33)
A4W104 4.69e-12 69 33 4 151 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 98HAH33)
P0ADH5 1.37e-11 65 28 4 183 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli (strain K12)
P0ADH6 1.37e-11 65 28 4 183 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli O157:H7
P55638 2.03e-10 63 33 9 186 3 NGR_a01820 Putative integrase/recombinase y4rE Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9PQS0 3.94e-10 62 22 8 280 3 xerC Tyrosine recombinase UU222 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q8R890 1.57e-09 62 26 10 241 3 TTE2127 Tyrosine recombinase XerC-like Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P0A052 5.62e-09 60 23 11 348 3 tnpA Transposase A from transposon Tn554 Staphylococcus aureus
P0A051 5.62e-09 60 23 11 348 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain N315)
P0A050 5.62e-09 60 23 11 348 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8KUV2 2.21e-08 58 29 6 171 3 Synpcc7942_B2651 Tyrosine recombinase Synpcc7942_B2651 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P62905 4.23e-08 57 21 9 283 3 int Transposase from transposon Tn1545 Streptococcus pneumoniae
P62904 4.23e-08 57 21 9 283 3 int Transposase from transposon Tn1545 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P22886 4.8e-08 57 21 9 283 1 Int-Tn Transposase from transposon Tn916 Enterococcus faecalis
P55459 1.57e-06 51 23 5 188 3 NGR_a03610 Putative integrase/recombinase y4gC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P18021 2.85e-06 51 22 7 201 3 resD Resolvase Escherichia coli
Q9F771 3.1e-06 52 25 4 157 3 xerC Putative tyrosine recombinase XerC Pseudomonas aeruginosa
P42540 3.86e-06 51 20 5 166 3 None Probable integrase/recombinase Acholeplasma phage L2
P96629 1.07e-05 50 24 8 241 3 int ICEBs1 integrase Bacillus subtilis (strain 168)
Q38067 1.28e-05 49 37 1 58 3 None Putative integrase Pseudomonas phage Pf1
P20709 1.4e-05 49 21 7 217 3 int Integrase Staphylococcus phage L54a
P06615 3.31e-05 48 22 6 197 3 resD Resolvase Escherichia coli (strain K12)
Q57813 7.31e-05 47 23 4 166 3 MJ0367 Probable integrase/recombinase protein MJ0367 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P55637 0.000116 46 25 9 235 3 NGR_a01830 Putative integrase/recombinase y4rD Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P36932 0.000249 45 39 0 46 1 int Integrase Escherichia phage P2
Q47036 0.000386 44 24 6 160 3 int Probable site-specific recombinase in afa region Escherichia coli
P76168 0.000402 45 22 7 236 1 intQ Putative defective protein IntQ Escherichia coli (strain K12)
P21442 0.000573 44 38 0 44 1 int Integrase Haemophilus phage HP1 (strain HP1c1)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08355
Feature type CDS
Gene xerC
Product tyrosine recombinase XerC
Location 45803 - 46720 (strand: 1)
Length 918 (nucleotides) / 305 (amino acids)

Contig

Accession contig_9
Length 163724 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_189
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00589 Phage integrase family
PF02899 Phage integrase, N-terminal SAM-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4973 Replication, recombination and repair (L) L Site-specific recombinase XerC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03733 integrase/recombinase XerC - -

Protein Sequence

MTDSAADDLLVTAEQFLQYLRVERRLSPVTITNYRRQLTALAEMMAAGKLRCWAQLEPATVRMLAAKSRRNGLQPASLALRLSALRSFLDWQVSNGLLPANPAKAVSAPKQGRHLPKNMDVDDITRLMDISSNDPLTVRDRTMLEVMYGAGLRLSELVGLNTGDFDLATGEVRVLGKGSKERKVPLGKTAVACLERWLPLRELYDPEDRAVFISTKSGKRISARNVQKRFEYWGLHQGLNSHLNPHKLRHSFATHILESSGDLRAVQELLGHANLSTTQIYTHLDFQHLANVYDVAHPRAKRGKP

Flanking regions ( +/- flanking 50bp)

CAGGTAGCCTATTTCCTGCCGCAGCTGCTGCAGCGCTGGGTGGAGCTGGCATGACGGACAGCGCGGCAGATGACCTGCTGGTCACGGCAGAACAGTTTCTGCAGTATCTGCGGGTAGAGCGCCGGTTAAGTCCGGTCACGATTACCAATTACCGCCGCCAGCTCACCGCGCTGGCGGAAATGATGGCCGCCGGTAAACTCCGCTGCTGGGCACAACTGGAACCGGCAACAGTGCGGATGCTGGCCGCAAAAAGCCGCCGTAACGGGTTACAGCCCGCCAGTCTGGCGCTGCGTCTTTCCGCTCTCCGTTCATTTCTTGACTGGCAGGTCAGTAACGGCCTGCTGCCCGCCAATCCGGCCAAGGCTGTCAGTGCCCCGAAACAGGGACGGCACCTGCCGAAAAATATGGATGTGGATGATATTACCCGGCTGATGGATATCAGCAGTAATGATCCGCTGACCGTGCGTGACCGTACCATGCTGGAAGTGATGTACGGCGCGGGGCTGCGTTTATCGGAGCTGGTCGGGCTGAATACCGGGGATTTTGACCTGGCCACCGGCGAAGTGCGGGTGCTGGGGAAGGGCAGCAAAGAGCGCAAAGTGCCGCTCGGCAAAACGGCAGTTGCCTGTCTGGAGCGCTGGCTGCCGCTGCGTGAGCTGTATGACCCGGAAGACCGGGCGGTGTTTATCTCCACCAAAAGCGGTAAGCGGATTTCAGCGCGTAATGTGCAGAAACGGTTTGAATACTGGGGCCTGCACCAGGGGCTGAACAGCCATCTGAACCCGCATAAACTACGCCACTCCTTTGCGACTCATATTCTGGAATCCAGCGGTGACCTGCGTGCCGTGCAGGAATTGCTGGGGCATGCTAATCTGTCCACCACGCAAATCTATACCCATCTGGATTTTCAGCATCTTGCCAATGTGTATGATGTTGCACATCCGCGGGCCAAACGAGGAAAACCGTAATGCGTTTTTACCGCCCCCTTTCACCTGTCCGCGCCATGACGTTCGATCTT