Homologs in group_967

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_12265 EHELCC_12265 100.0 Morganella morganii S2 gsiA Glutathione import ATP-binding protein GsiA
NLDBIP_12605 NLDBIP_12605 100.0 Morganella morganii S4 gsiA Glutathione import ATP-binding protein GsiA
LHKJJB_12465 LHKJJB_12465 100.0 Morganella morganii S3 gsiA Glutathione import ATP-binding protein GsiA
HKOGLL_11080 HKOGLL_11080 100.0 Morganella morganii S5 gsiA Glutathione import ATP-binding protein GsiA
F4V73_RS05780 F4V73_RS05780 89.8 Morganella psychrotolerans - ABC transporter ATP-binding protein
PMI_RS07185 PMI_RS07185 63.9 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_967

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_967

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C0SP98 8.76e-58 189 43 5 237 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
P45051 6.77e-56 184 40 3 236 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42065 1.08e-55 184 44 3 211 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
P18766 8.46e-54 178 44 4 228 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q6D3A9 1.41e-52 182 44 5 237 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 8.69e-34 131 35 9 254 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P24137 2.02e-52 174 41 4 229 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
P0CZ33 7.12e-52 173 41 4 229 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 7.12e-52 173 41 4 229 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 7.12e-52 173 41 4 229 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 7.12e-52 173 41 4 229 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
P77622 6.36e-51 171 47 3 197 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q8P2L5 6.89e-51 171 41 4 229 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
A0A0H2ZH52 9.72e-51 171 45 2 197 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
P08007 4.06e-50 169 44 2 197 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YJJ8 4.81e-50 169 40 4 247 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 4.81e-50 169 40 4 247 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
P77737 6.64e-50 169 44 3 199 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
Q0T6D3 8.56e-50 175 41 4 257 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 2.68e-32 127 34 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q83LT3 9.1e-50 175 41 4 257 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 6.9e-33 129 34 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q3Z3V4 1.93e-49 174 44 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 1.55e-34 133 35 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
P75796 2.18e-49 174 44 4 236 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 1.01e-34 134 35 7 244 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q32IB5 2.71e-49 174 44 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 3.79e-34 132 34 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
P72479 6.4e-49 166 38 4 232 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0TJM0 9.21e-49 172 43 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 7.03e-35 134 35 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A2V5 1.57e-48 165 43 2 193 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 1.57e-48 165 43 2 193 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
Q1RE96 2.05e-48 171 43 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 8.16e-35 134 35 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q323W5 2.37e-48 171 43 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 1.35e-34 133 35 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q8X6W1 2.47e-48 171 43 4 236 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 4.48e-34 132 34 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8YDH1 3.75e-48 166 40 4 245 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FJL0 5.12e-48 170 42 4 240 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 3.94e-34 132 34 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A967 2.36e-47 168 43 5 237 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 7.61e-35 134 35 7 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q5PGP3 1.19e-46 166 43 4 237 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 2.07e-33 130 35 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57RB2 1.43e-46 166 43 4 237 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 9.59e-34 131 35 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q8Z864 1.58e-46 166 43 4 232 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 1.54e-33 130 35 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8ZQM4 1.63e-46 166 43 4 232 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 2.15e-33 130 35 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45094 4.09e-46 159 43 2 197 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI78 6.43e-45 155 37 4 228 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
P63396 1.21e-44 161 43 2 214 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 7.69e-36 137 32 6 252 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 1.21e-44 161 43 2 214 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 7.69e-36 137 32 6 252 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 1.21e-44 161 43 2 214 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 7.69e-36 137 32 6 252 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A9CKL2 1.66e-44 159 40 6 239 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 8.39e-44 157 43 4 201 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P37313 5.61e-44 154 41 3 201 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
Q53194 1.89e-43 153 41 5 233 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2FVF1 9.82e-42 145 36 2 217 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6D4E2 1.4e-41 149 38 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PMK1 2.41e-41 148 40 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z7H7 2.54e-41 148 40 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
P40790 2.63e-41 148 40 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.63e-41 148 40 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
P33916 6.14e-41 150 38 6 242 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 2.63e-38 142 38 7 231 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P26905 8.52e-41 145 38 5 231 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
Q88ZJ6 9.4e-41 146 39 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8FVN0 1.12e-40 143 36 4 240 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
A0A0H3JT74 1.65e-40 142 36 2 217 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KS33 2.52e-40 145 39 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8YCN7 3.44e-40 142 37 5 232 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 3.44e-40 142 37 5 232 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 3.44e-40 142 37 5 232 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q31VE6 3.5e-40 142 37 2 204 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q8YDH0 5.93e-40 143 39 7 246 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3YW48 7.41e-40 141 37 2 204 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
P33594 8.08e-40 141 37 2 204 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q1RD28 1.11e-39 144 39 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.11e-39 144 39 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q32AQ1 1.14e-39 140 37 2 204 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q9X196 1.2e-39 143 40 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8YBN5 1.36e-39 142 39 4 230 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 1.36e-39 142 39 4 230 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 1.36e-39 142 39 4 230 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 1.36e-39 142 39 4 230 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 1.36e-39 142 39 4 230 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8X4L6 1.45e-39 140 37 2 204 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q32EY4 1.64e-39 143 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R5D8 2.12e-39 140 37 2 204 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 2.12e-39 140 37 2 204 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 2.12e-39 140 37 2 204 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2RS22 2.77e-39 140 39 3 209 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0T5R2 2.87e-39 142 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
P69877 3.47e-39 142 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 3.47e-39 142 39 5 222 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 3.47e-39 142 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 3.47e-39 142 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 3.47e-39 142 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q8FUW8 5.81e-39 140 38 7 246 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 5.81e-39 140 38 7 246 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 5.81e-39 140 38 7 246 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
Q0SZJ3 5.84e-39 139 36 2 204 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q6LR20 6.12e-39 141 37 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q3Z2Z3 7.26e-39 141 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 7.26e-39 141 39 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q0I3Y9 9.13e-39 141 38 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
A5VU87 1.48e-38 139 37 7 238 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q83J77 1.98e-38 137 36 2 204 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q5E586 2.48e-38 140 38 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1B8V9 2.82e-38 140 36 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.82e-38 140 36 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
P0AAI0 3.23e-38 137 34 4 227 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 3.23e-38 137 34 4 227 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 3.23e-38 137 34 4 227 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2SJY7 4.82e-38 139 39 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q18C09 5.51e-38 138 36 4 218 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q8FWP1 5.56e-38 138 37 7 238 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
Q8YBN6 6.79e-38 138 37 7 238 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5HV18 7.79e-38 137 33 4 235 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 7.79e-38 137 33 4 235 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O85818 8.07e-38 139 38 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q53193 9.04e-38 137 35 5 231 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q65UE1 9.74e-38 138 40 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q3A9G5 1.31e-37 137 37 7 228 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2YK63 1.34e-37 137 37 7 238 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 1.34e-37 137 37 7 238 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
Q7MKU3 1.62e-37 138 37 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1.62e-37 138 37 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
P24136 1.74e-37 137 34 7 234 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
O83658 1.83e-37 137 39 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
P45052 1.95e-37 136 35 5 229 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VNG4 1.96e-37 137 39 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1TAI4 2.03e-37 137 37 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q63GR8 2.15e-37 137 38 7 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q5PCG9 2.63e-37 136 37 6 224 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q87PH3 2.68e-37 137 38 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ZR89 3.02e-37 136 37 6 224 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45171 3.75e-37 137 37 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QK57 3.75e-37 137 37 7 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q7NQN5 3.78e-37 136 38 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P04285 3.93e-37 136 35 7 236 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42064 4.51e-37 135 35 5 233 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
Q9HY19 4.85e-37 136 37 5 222 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P36638 4.97e-37 134 33 4 227 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02R79 5.27e-37 136 37 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q73EL7 5.45e-37 135 37 6 231 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1B677 5.81e-37 135 38 5 221 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q97KD5 6.93e-37 135 36 5 229 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9CP06 7.85e-37 136 37 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q81ZF5 8.31e-37 135 38 7 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6HP89 8.31e-37 135 38 7 230 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P55662 8.99e-37 133 35 6 234 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q57S53 9.54e-37 135 37 6 224 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q8ELQ6 1.21e-36 135 37 7 224 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6D201 1.34e-36 134 37 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q81IN8 1.52e-36 134 38 7 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8FV85 1.88e-36 135 36 4 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.88e-36 135 36 4 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.88e-36 135 36 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.88e-36 135 36 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q8PP41 2.03e-36 132 40 6 203 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q8Z8R5 2.13e-36 134 37 6 224 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q5WVL8 3.07e-36 134 37 4 218 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q5YRD1 3.32e-36 133 37 7 227 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q03PF2 3.48e-36 134 37 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q5ZUG5 3.72e-36 133 37 4 218 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8KZQ6 4.65e-36 131 37 7 237 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
P54537 6.91e-36 130 35 5 218 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q3MAR5 7.92e-36 133 37 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8U648 9.89e-36 130 37 5 219 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q88R93 1.12e-35 130 36 7 237 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A2RI77 1.17e-35 132 34 5 234 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
Q7M816 1.22e-35 131 40 6 210 3 metN Methionine import ATP-binding protein MetN Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P50980 1.33e-35 132 34 6 233 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
D8KFN1 1.34e-35 132 35 6 238 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 1.34e-35 132 35 6 238 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q5X484 1.53e-35 132 37 4 218 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q0S0Z3 1.53e-35 132 35 3 214 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q5WXF0 1.63e-35 132 36 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q8YM92 1.73e-35 132 37 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8DIA0 1.81e-35 131 37 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A0A0H2ZGN6 1.86e-35 131 35 7 228 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9K876 1.92e-35 132 37 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q07733 2.1e-35 131 34 6 233 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
Q0SBZ1 2.15e-35 131 35 3 214 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q72FW5 2.22e-35 132 38 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6FFZ1 2.42e-35 129 37 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q98HF7 2.49e-35 132 38 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9G4F5 2.5e-35 131 39 5 222 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
P0AAF9 2.56e-35 129 35 6 230 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 2.56e-35 129 35 6 230 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 2.56e-35 129 35 6 230 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 2.56e-35 129 35 6 230 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q6D3Q6 2.82e-35 131 37 6 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q032A0 2.82e-35 132 35 6 238 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q1IGL4 3.67e-35 129 36 5 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q6D5H7 3.94e-35 130 38 5 226 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5WKL3 4.03e-35 131 36 7 229 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q895C4 5.03e-35 130 32 4 218 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q4K441 5.58e-35 129 35 7 242 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7N6Z2 5.9e-35 130 38 4 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9CIN4 8.93e-35 130 35 6 238 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q8CQS7 9.03e-35 130 33 5 222 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 9.03e-35 130 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q3K506 1.13e-34 128 36 7 238 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q5ZWE4 1.27e-34 130 35 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P45095 1.29e-34 129 33 6 245 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8PGE8 1.34e-34 129 40 6 214 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q87AL9 1.4e-34 129 41 4 197 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q110U3 1.66e-34 130 36 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
P76027 1.71e-34 129 33 5 231 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
Q48CA0 1.81e-34 127 36 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5X627 1.84e-34 129 35 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
A1TXH7 1.87e-34 129 35 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8DPC2 2.33e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.33e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.33e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8DZJ0 2.73e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 2.73e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 2.73e-34 129 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5H503 3.18e-34 128 40 7 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q47T99 3.4e-34 129 38 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q9A502 3.44e-34 128 38 5 219 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2P7S3 3.46e-34 128 40 7 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2YAD6 3.49e-34 129 37 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3BNZ3 3.61e-34 128 40 6 214 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q0RYP7 3.63e-34 128 35 3 214 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q8YA75 3.67e-34 128 37 5 220 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8ZRM9 3.72e-34 128 36 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAG2 4.17e-34 127 35 7 242 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 4.17e-34 127 35 7 242 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 4.17e-34 127 35 7 242 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
O34677 4.48e-34 125 34 5 221 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q4L5B3 4.67e-34 128 35 6 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q03AH0 4.95e-34 128 37 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q57T09 5e-34 128 36 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q8ELR4 5.31e-34 128 36 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EBC3 5.84e-34 128 40 8 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q4ZLS1 7.28e-34 125 36 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q325U1 7.45e-34 127 36 5 222 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
P0CZ35 7.59e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 7.59e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 7.59e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5XCA4 7.75e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P77795 8.44e-34 127 38 6 221 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q8DUF7 8.51e-34 128 38 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q7CN92 9.15e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 9.15e-34 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q8E3S0 1.06e-33 127 36 6 231 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
P27675 1.07e-33 124 36 7 216 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q1J6Q6 1.13e-33 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.13e-33 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.13e-33 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.13e-33 128 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q65M34 1.15e-33 127 37 4 197 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9KUI0 1.21e-33 127 37 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P31134 1.25e-33 127 36 7 223 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q03Z27 1.27e-33 127 35 8 246 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q3M5J9 1.27e-33 124 34 4 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6D1C4 1.29e-33 127 36 6 226 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q32JQ8 1.31e-33 127 36 5 222 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q8DY54 1.32e-33 127 36 6 231 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.32e-33 127 36 6 231 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5L222 1.33e-33 127 36 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q88AS5 1.43e-33 126 37 5 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q38VW6 1.43e-33 127 36 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q724C0 1.6e-33 126 36 5 220 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q9I6L0 1.71e-33 126 37 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3Z5F8 1.82e-33 126 36 5 222 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.82e-33 126 36 5 222 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.82e-33 126 36 5 222 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLD2 1.82e-33 126 36 5 222 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P63356 1.82e-33 126 36 5 222 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q830W6 1.87e-33 127 36 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q87UI3 1.91e-33 124 35 7 240 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1QE80 1.98e-33 127 35 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9JZW0 2.33e-33 126 36 4 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0BMC9 2.35e-33 126 35 5 222 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 2.35e-33 126 35 5 222 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q2YVT7 2.55e-33 126 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8A883 2.66e-33 128 34 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7VZE5 2.78e-33 126 38 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9JUX4 3.03e-33 126 36 4 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q1AS06 3.08e-33 126 37 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P30750 3.2e-33 125 36 5 222 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q7W9U5 3.39e-33 126 38 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P10346 3.45e-33 123 34 5 228 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q5PID0 3.55e-33 125 36 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7WGW1 3.61e-33 126 38 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1MQ44 3.69e-33 126 37 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5HIL5 3.8e-33 125 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 3.8e-33 125 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 3.8e-33 125 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
P16676 3.8e-33 126 37 6 227 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q7UC29 3.88e-33 126 37 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8XBJ8 3.92e-33 126 37 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
A3CMQ7 4.12e-33 126 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q8FFB3 4.13e-33 126 37 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8RI39 4.5e-33 126 37 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1CFH7 4.97e-33 125 37 8 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.97e-33 125 37 8 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.97e-33 125 37 8 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q6MCV4 5.06e-33 126 36 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q1WVI7 5.2e-33 125 36 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q8G5P8 5.49e-33 126 35 5 233 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
P0A2U9 5.71e-33 125 35 9 240 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 5.71e-33 125 35 9 240 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8Z990 5.76e-33 125 36 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q5NFU5 5.84e-33 125 35 5 222 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q8P4S7 5.85e-33 125 39 6 214 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 5.85e-33 125 39 6 214 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q7A7E3 5.96e-33 125 33 6 225 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 5.96e-33 125 33 6 225 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q667L9 6.13e-33 125 37 8 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q82TL6 6.29e-33 125 35 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q92EZ6 6.52e-33 125 36 5 220 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q88CL2 6.76e-33 124 37 5 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q14H97 6.91e-33 125 35 5 222 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q83MC5 7.02e-33 125 36 5 222 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 7.02e-33 125 36 5 222 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q64SQ6 7.36e-33 127 34 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 7.58e-33 127 34 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q0SML1 7.89e-33 125 33 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0AGF4 8.2e-33 125 36 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q30V33 8.25e-33 125 36 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q89UD2 8.29e-33 125 38 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6NBT1 8.56e-33 125 37 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0K9I2 1.01e-32 124 36 7 231 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q668K6 1.22e-32 124 38 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
P45092 1.24e-32 122 33 6 222 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8NY21 1.31e-32 124 32 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 1.31e-32 124 32 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q82WT5 1.37e-32 124 38 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6GJL2 1.41e-32 124 33 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q722B1 1.49e-32 124 36 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8XZQ4 1.51e-32 122 37 7 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q881U6 1.62e-32 121 39 7 215 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9CGD4 1.66e-32 125 37 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q92DL6 1.72e-32 124 36 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q63TY1 1.77e-32 124 37 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q7NWX3 1.79e-32 124 37 5 226 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q02Z10 1.81e-32 125 37 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q8Z0H0 1.84e-32 124 36 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q81GC1 1.9e-32 123 33 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9PF03 1.98e-32 123 41 5 197 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q8Y8T6 2.12e-32 124 36 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P47650 2.15e-32 123 33 7 228 3 pstB Phosphate import ATP-binding protein PstB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P14788 2.24e-32 124 35 5 227 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7NIW1 2.41e-32 123 37 5 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9MUN1 2.44e-32 124 36 6 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q53I83 2.68e-32 124 39 5 213 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q62K82 2.89e-32 123 37 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8DWR3 3.05e-32 122 33 6 240 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 3.05e-32 122 33 6 240 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 3.05e-32 122 33 6 240 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A0AGP9 3.38e-32 124 36 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q02QT1 3.59e-32 121 35 5 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q03JH1 3.9e-32 124 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q21XJ9 3.97e-32 121 35 6 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8RFN2 4.02e-32 122 36 4 202 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P74548 4.02e-32 123 37 5 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HYG4 4.12e-32 121 35 5 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04G50 4.15e-32 123 33 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q5M397 4.51e-32 124 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN4 4.51e-32 124 37 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q9CIS9 4.55e-32 121 36 7 224 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q74IV9 4.6e-32 123 35 4 225 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
O51587 5.41e-32 122 32 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8D0W8 5.76e-32 123 38 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q032H4 5.81e-32 121 36 7 224 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 5.81e-32 121 36 7 224 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
Q6CYU2 5.84e-32 120 33 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9A7X1 6.13e-32 122 34 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q660M8 6.13e-32 122 32 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q03ZQ0 6.21e-32 123 34 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q65F80 6.23e-32 122 37 5 213 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q88HL0 6.42e-32 120 38 2 211 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HT70 6.52e-32 122 39 5 206 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 6.52e-32 122 39 5 206 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2NRN5 6.53e-32 122 38 5 198 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q88RL5 6.94e-32 122 39 4 193 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2FVF0 6.97e-32 120 30 5 240 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5FM17 7.23e-32 120 34 6 226 3 pstB2 Phosphate import ATP-binding protein PstB 2 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q7MNI7 7.28e-32 120 35 7 235 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio vulnificus (strain YJ016)
Q8DEW5 7.28e-32 120 35 7 235 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio vulnificus (strain CMCP6)
Q5YZY9 8.9e-32 122 37 2 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q07LQ4 9.58e-32 120 34 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q49WM4 9.96e-32 122 33 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q14Q07 1.01e-31 122 35 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q3ILC5 1.07e-31 120 32 6 246 3 pstB Phosphate import ATP-binding protein PstB Pseudoalteromonas translucida (strain TAC 125)
Q0AU85 1.07e-31 122 35 5 222 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q5WKG4 1.19e-31 119 35 4 211 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q8DMX9 1.21e-31 120 35 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 1.21e-31 120 35 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 1.21e-31 120 35 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q5HQ70 1.24e-31 122 34 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0SRL2 1.29e-31 122 33 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q63E84 1.32e-31 121 32 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 1.32e-31 121 32 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 1.32e-31 121 32 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q12L15 1.33e-31 120 34 6 226 3 pstB Phosphate import ATP-binding protein PstB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q6MU19 1.35e-31 122 36 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q665B6 1.4e-31 120 34 5 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
A0A0H3JXA3 1.4e-31 120 30 5 240 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q93DX8 1.4e-31 119 37 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q3KBH4 1.44e-31 122 36 6 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q6HLQ9 1.5e-31 121 32 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
D4GP38 1.73e-31 122 33 6 223 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9S4Z0 1.73e-31 120 40 5 186 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
A3DDF6 1.86e-31 121 35 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8ELA5 1.9e-31 121 35 6 227 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1IGZ0 1.96e-31 121 40 4 193 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q160M2 1.99e-31 121 36 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2SSS4 2.1e-31 121 35 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A0PY57 2.1e-31 121 34 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q18AM3 2.17e-31 121 35 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q8U8D6 2.25e-31 119 36 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8F6Z1 2.54e-31 121 36 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.54e-31 121 36 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q0SFW6 2.59e-31 120 35 7 229 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q81TH8 2.61e-31 120 32 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q609Q1 2.66e-31 120 37 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8RQL7 2.78e-31 118 32 6 226 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q03A07 2.82e-31 120 39 5 193 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8DRR9 2.84e-31 119 33 8 245 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5E3B8 2.85e-31 119 34 7 235 3 pstB2 Phosphate import ATP-binding protein PstB 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8EPK1 2.86e-31 120 37 6 206 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P75186 3.04e-31 120 33 8 254 3 pstB Phosphate import ATP-binding protein PstB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O32169 3.21e-31 120 36 5 211 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
O34900 3.28e-31 118 36 6 222 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
D5AQY6 3.46e-31 118 36 6 225 1 nikO Nickel import ATP-binding protein NikO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q6F0V4 3.58e-31 120 35 7 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q832Y6 3.69e-31 120 34 5 232 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8FJ95 4.16e-31 118 35 5 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q4K681 4.3e-31 120 37 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q48IB9 4.77e-31 117 37 5 206 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P40860 5.35e-31 120 35 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1RDS4 5.36e-31 118 35 5 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 5.36e-31 118 35 5 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q0HTE5 5.44e-31 118 34 7 235 3 pstB Phosphate import ATP-binding protein PstB Shewanella sp. (strain MR-7)
Q0HH38 5.44e-31 118 34 7 235 3 pstB Phosphate import ATP-binding protein PstB Shewanella sp. (strain MR-4)
Q2NHA1 5.58e-31 118 33 4 217 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q67SV5 5.6e-31 119 37 7 224 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3KK97 5.92e-31 119 38 5 201 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q6LU82 6.44e-31 118 34 7 235 3 pstB1 Phosphate import ATP-binding protein PstB 1 Photobacterium profundum (strain SS9)
Q98DT6 6.52e-31 118 36 5 211 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4KKK8 6.64e-31 119 40 5 196 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8Z4V6 6.68e-31 120 35 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8RGC8 7.49e-31 120 31 4 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1CDR0 7.78e-31 118 34 5 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 7.78e-31 118 34 5 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 7.78e-31 118 34 5 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q827Y0 7.9e-31 119 38 7 216 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5LT05 8.07e-31 120 38 5 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q89ER4 8.42e-31 118 33 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q13VD7 9.73e-31 119 34 6 226 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q8CPN0 9.81e-31 119 33 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1LQF6 1e-30 119 35 6 224 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q81IZ6 1.04e-30 119 34 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7NX01 1.09e-30 119 36 4 222 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q47Y12 1.13e-30 117 35 7 237 3 pstB Phosphate import ATP-binding protein PstB Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q02ME3 1.17e-30 119 37 6 223 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9YGA6 1.21e-30 119 34 5 211 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9I1C8 1.23e-30 119 37 6 223 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5M5Z2 1.25e-30 119 32 4 233 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q0TJC1 1.26e-30 117 35 5 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9I6T2 1.32e-30 119 38 5 196 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1LNM0 1.37e-30 117 36 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P55604 1.41e-30 119 34 6 218 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P44513 1.41e-30 119 33 3 218 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q83F44 1.44e-30 119 32 5 234 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q084V3 1.53e-30 117 33 7 235 3 pstB Phosphate import ATP-binding protein PstB Shewanella frigidimarina (strain NCIMB 400)
Q5M243 1.64e-30 117 34 6 225 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ3 1.64e-30 117 34 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain CNRZ 1066)
Q03I82 1.84e-30 117 34 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q65VG9 1.89e-30 118 35 6 222 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q52666 1.91e-30 116 35 5 219 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8EG82 1.93e-30 117 34 6 226 3 pstB1 Phosphate import ATP-binding protein PstB 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q92WJ0 1.93e-30 119 36 5 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8XIZ5 1.94e-30 119 33 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.94e-30 119 33 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9PDN2 1.97e-30 118 35 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8NSN2 1.98e-30 119 34 6 224 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5M1F6 2.08e-30 119 32 4 233 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q4QP85 2.12e-30 118 33 3 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q2RM86 2.38e-30 116 33 8 239 3 pstB Phosphate import ATP-binding protein PstB Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8D653 2.55e-30 118 36 4 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q4ZTG9 2.61e-30 115 38 7 222 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. syringae (strain B728a)
Q98G43 2.62e-30 118 33 3 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8P2K6 2.63e-30 118 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q58488 2.78e-30 116 32 4 220 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q38WL5 2.79e-30 118 35 4 209 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
P72297 2.83e-30 116 33 7 236 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
Q03P57 2.89e-30 118 35 8 239 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q3IS07 2.96e-30 116 33 6 233 3 pstB1 Phosphate import ATP-binding protein PstB 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P56344 3.02e-30 115 34 6 221 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q1J0N0 3.06e-30 115 34 6 228 3 pstB Phosphate import ATP-binding protein PstB Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q88WA5 3.33e-30 118 36 8 231 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q24XJ2 3.35e-30 118 33 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q92UV5 3.69e-30 119 40 7 203 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q65T42 3.72e-30 118 35 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5LX21 3.75e-30 118 33 6 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q46Y69 3.81e-30 117 35 6 227 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7MN25 4.23e-30 117 34 6 222 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q87DT9 4.3e-30 117 35 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8DFC3 4.45e-30 117 34 6 222 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
P0CZ31 4.61e-30 117 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1JII9 4.61e-30 117 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
P0CZ30 4.61e-30 117 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1JNE0 4.81e-30 117 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 4.81e-30 117 33 4 235 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q6N6K5 5.17e-30 116 33 5 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P55453 5.35e-30 117 36 6 230 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7VM95 5.48e-30 117 36 8 225 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_05325
Feature type CDS
Gene gsiA
Product Glutathione import ATP-binding protein GsiA
Location 72145 - 72879 (strand: 1)
Length 735 (nucleotides) / 244 (amino acids)

Contig

Accession contig_5
Length 181448 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_967
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1124 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Protein Sequence

MPENNSAPIIEVNNLSVSFGQRQVVCQAGFHLSAGETFSLIGESGCGKSTILRVIAGLQREWLGGVQLLSQHIHPGQRYQGALRRNVQMVFQDPYASLHPFHTIHRALSEPLRIHRENDIGSRVAEAIVSVGLPPDVAQRYPHQLSGGQRQRIAIARALMLHPQILLLDEPTSALDMSVQAEILNLLNHLKTAHGMTYLLVSHDADVVAHMSDRAAFMANGKIEREFDRAALLRGDHRMENREI

Flanking regions ( +/- flanking 50bp)

GGTATTGGATCGCACCGCCCTGCAGGCGTTACTGACTCAGGAGACACATCATGCCGGAAAATAATTCAGCGCCGATTATTGAAGTTAATAATCTTTCCGTCAGCTTCGGACAGCGGCAGGTGGTTTGTCAGGCCGGTTTTCATCTCAGTGCCGGAGAGACGTTCAGTCTTATCGGTGAGTCCGGCTGCGGAAAATCCACCATTTTGCGGGTGATCGCCGGATTACAGCGGGAGTGGCTGGGCGGCGTGCAACTGCTGTCACAGCATATCCACCCCGGCCAGCGTTATCAGGGGGCTTTGCGCCGCAATGTGCAGATGGTCTTCCAGGATCCCTATGCGTCTCTGCATCCGTTCCATACTATTCACCGGGCGCTTTCGGAGCCATTACGCATTCACCGCGAAAATGACATCGGCAGCCGGGTGGCAGAGGCCATTGTATCTGTCGGGCTGCCGCCGGATGTGGCACAGCGTTATCCGCATCAGCTCTCCGGCGGGCAGCGCCAGCGCATTGCCATTGCCCGCGCCCTGATGCTGCACCCGCAGATCCTGTTACTCGATGAACCGACATCCGCACTTGATATGTCTGTACAGGCTGAAATTCTCAATCTGCTTAATCACCTGAAAACCGCCCACGGCATGACCTATCTGCTGGTCAGCCATGATGCCGATGTGGTGGCGCATATGTCAGACCGGGCGGCATTTATGGCGAACGGGAAAATTGAACGGGAATTTGATCGCGCCGCCCTGCTGCGCGGCGACCACCGGATGGAGAACAGAGAGATATAAAAACGGGGCCGATGGCCCCGTTCTGATAATAATGAACTACGTGATTATGA