Homologs in group_907

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_06085 EHELCC_06085 100.0 Morganella morganii S2 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
NLDBIP_06405 NLDBIP_06405 100.0 Morganella morganii S4 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
LHKJJB_03285 LHKJJB_03285 100.0 Morganella morganii S3 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
HKOGLL_06760 HKOGLL_06760 100.0 Morganella morganii S5 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
F4V73_RS09265 F4V73_RS09265 86.7 Morganella psychrotolerans - PatB family C-S lyase
PMI_RS06160 PMI_RS06160 29.8 Proteus mirabilis HI4320 - MalY/PatB family protein

Distribution of the homologs in the orthogroup group_907

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_907

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q08432 2.69e-86 270 35 4 391 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
P23256 1.83e-66 219 31 7 395 1 malY Protein MalY Escherichia coli (strain K12)
P9WQ83 1.45e-46 167 33 14 390 1 Rv2294 Putative cystathionine beta-lyase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ82 1.45e-46 167 33 14 390 3 MT2351 Putative cystathionine beta-lyase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63503 1.45e-46 167 33 14 390 3 BQ2027_MB2316 Putative cystathionine beta-lyase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CBM9 7.7e-45 162 31 14 386 3 ML1794 Putative cystathionine beta-lyase Mycobacterium leprae (strain TN)
Q5SHW0 2.49e-37 141 28 12 380 1 TTHA1620 Cystathionine beta-lyase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q93QC6 4.44e-33 130 25 10 389 1 metC Cystathionine beta-lyase Corynebacterium glutamicum
Q64HC5 8.29e-23 102 25 11 368 1 metC Cysteine-S-conjugate beta-lyase Corynebacterium striatum
O58489 5.15e-21 97 22 9 363 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O67781 1.11e-20 96 21 13 370 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
Q8DTM1 5.74e-19 91 20 12 370 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O33822 1.47e-18 89 22 10 362 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
P14909 1.97e-17 86 21 12 342 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P39643 2.14e-17 86 22 9 368 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
Q9V0L2 2.64e-17 86 20 10 370 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q3MDN5 7.73e-17 84 23 8 363 3 dapL2 LL-diaminopimelate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q795M6 1.88e-16 83 21 10 363 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q56232 2.51e-16 83 22 11 363 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B1I544 3.58e-16 82 25 9 363 3 dapL LL-diaminopimelate aminotransferase Desulforudis audaxviator (strain MP104C)
Q8YP73 4.85e-16 82 22 9 365 3 dapL2 LL-diaminopimelate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P53001 6.07e-16 82 20 10 365 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
Q3AC10 6.72e-16 82 22 9 365 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q972A2 2.93e-14 77 19 11 339 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
H3ZPU1 2.96e-14 77 20 7 362 1 OCC_04737 Aromatic-amino-acid aminotransferase 2 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
O66630 3.37e-14 77 23 14 371 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
Q9SIE1 3.75e-14 77 21 11 374 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
B8CX89 3.77e-14 76 21 10 364 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9HUI9 4.8e-14 76 22 11 394 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0LEA5 1.18e-13 75 22 10 364 1 dapL LL-diaminopimelate aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P23034 1.31e-13 75 19 9 363 1 None Aspartate aminotransferase Bacillus sp. (strain YM-2)
C6C2Z3 1.55e-13 75 20 10 354 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
Q60317 1.86e-13 74 18 11 392 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B2A250 1.86e-13 74 21 10 362 3 dapL LL-diaminopimelate aminotransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q59228 3.05e-13 73 21 11 366 3 aspC Aspartate aminotransferase Geobacillus stearothermophilus
Q02635 3.13e-13 73 23 14 378 1 aatA Aspartate/prephenate aminotransferase Rhizobium meliloti (strain 1021)
Q72BI1 3.26e-13 73 24 13 365 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VDD3 3.39e-13 73 24 13 365 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
B8DJJ6 4.12e-13 73 24 11 364 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q5WX92 5.8e-13 73 25 12 296 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Lens)
Q4J8X2 6.14e-13 73 18 12 376 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q987C8 6.71e-13 72 28 3 173 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5X5X0 1.07e-12 72 25 14 298 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Paris)
O27624 1.18e-12 72 23 10 277 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q6D410 1.22e-12 72 31 5 165 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z8H5 1.3e-12 72 20 8 363 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B2FPM0 2.91e-12 70 28 4 177 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
Q55128 3.88e-12 70 20 8 337 1 aspC Aspartate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q30ZX9 4.08e-12 70 24 14 367 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q5ZW88 4.6e-12 70 24 13 298 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C6DF75 5.82e-12 70 30 5 165 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4STN8 5.88e-12 70 29 4 170 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain R551-3)
Q6YP21 8.93e-12 69 24 5 191 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
C6BUK3 9.01e-12 69 23 13 364 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q0P8H7 1.03e-11 69 22 13 341 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1JTV9 1.86e-11 68 26 6 186 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
E9L7A5 1.89e-11 68 20 12 377 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
B8I5V1 2.2e-11 68 27 4 186 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q9PBC6 2.66e-11 68 30 5 176 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
C3LU31 3.56e-11 67 29 6 179 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 3.56e-11 67 29 6 179 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8TVG3 3.89e-11 67 23 15 363 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9KSX2 4.19e-11 67 29 6 179 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4WMJ9 4.22e-11 67 24 11 329 2 gliI Probable aminotransferase gliI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P77434 4.5e-11 67 21 10 371 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
Q3BUF6 4.51e-11 67 28 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9ZHE5 4.87e-11 67 26 5 160 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0DI07 4.92e-11 67 21 12 360 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 4.92e-11 67 21 12 360 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
O82030 5.61e-11 67 21 12 357 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
Q06191 5.81e-11 67 22 14 376 1 aatB Aspartate aminotransferase Rhizobium meliloti
Q9FEW2 6.2e-11 67 20 11 357 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
A4IQ80 6.26e-11 67 25 6 187 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
B9LNJ8 6.88e-11 66 23 7 234 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B0RSL5 7.67e-11 66 29 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
Q5WGR9 8.07e-11 66 26 8 208 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
Q0P5G4 8.31e-11 67 25 4 185 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
P58891 8.37e-11 66 28 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
B5XPE6 9.28e-11 66 28 5 165 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q60013 9.55e-11 66 22 6 235 3 aspC Aspartate aminotransferase Streptomyces virginiae
Q4JW58 1.05e-10 66 28 5 178 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
P57202 1.14e-10 66 27 5 169 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P9WPZ5 1.15e-10 66 24 5 227 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 1.15e-10 66 24 5 227 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8D707 1.23e-10 65 27 5 169 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 1.23e-10 65 27 5 169 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q9C969 1.27e-10 66 22 10 318 1 ISS1 Aromatic aminotransferase ISS1 Arabidopsis thaliana
A6TBC4 1.35e-10 65 28 5 165 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q4UU41 1.37e-10 65 29 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
Q9X0Y2 1.89e-10 65 19 9 361 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q71RI9 2.19e-10 65 21 8 273 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
A4TKK4 2.33e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 2.33e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 2.33e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 2.33e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 2.33e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8EQB9 2.39e-10 65 25 4 168 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q87C30 2.48e-10 65 29 5 176 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 2.48e-10 65 29 5 176 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
A7FJH1 2.55e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JPW1 2.57e-10 65 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A6LAM2 2.63e-10 64 25 13 293 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B0U3B2 2.67e-10 65 29 5 176 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
Q65RB2 3.06e-10 64 26 5 164 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q17CS8 3.1e-10 65 28 5 176 1 KAT Kynurenine aminotransferase Aedes aegypti
Q30TC9 3.43e-10 64 20 12 366 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5H0L0 3.67e-10 64 28 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K2 3.67e-10 64 28 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7T3E5 3.83e-10 64 21 9 332 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
Q66C50 4.27e-10 64 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 4.27e-10 64 29 5 162 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
P77806 4.53e-10 64 22 12 310 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
Q03VY3 4.6e-10 64 23 12 296 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9HQS0 4.83e-10 64 23 10 303 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 4.83e-10 64 23 10 303 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A5FRC5 6.14e-10 63 18 8 361 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P58892 6.17e-10 63 28 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q58097 7.31e-10 63 18 11 363 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7ZNJ3 8.79e-10 63 29 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2NEQ0 9.91e-10 63 22 9 277 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q7NDX4 1.19e-09 63 19 9 379 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5KXV3 1.24e-09 62 25 6 183 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
A4WC70 1.24e-09 62 27 6 165 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
Q7N6I1 1.3e-09 63 27 7 167 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B7GHJ8 1.38e-09 62 26 6 174 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q58FK9 1.39e-09 63 23 4 178 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
Q8FNZ1 1.4e-09 62 25 4 181 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0W253 1.57e-09 62 24 15 316 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q11VM5 1.7e-09 62 24 5 160 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q57MS2 1.8e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B0K625 1.8e-09 62 25 7 203 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
P58350 1.83e-09 62 22 15 376 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
A7MJP4 1.84e-09 62 26 5 165 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q82WA8 1.86e-09 62 19 10 381 1 aatA Aspartate/prephenate aminotransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
O14209 2.3e-09 62 21 10 333 3 SPAC6B12.04c Uncharacterized aminotransferase C6B12.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A9MSC2 2.34e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 2.34e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
O86459 2.35e-09 62 22 13 375 3 aspC Probable aspartate/prephenate aminotransferase Rhizobium leguminosarum bv. phaseoli
O28277 2.4e-09 61 22 11 290 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P16524 2.41e-09 62 20 9 365 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
B5BFB9 2.41e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 2.41e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q323J1 2.6e-09 62 28 6 165 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
B4T9N5 2.73e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
P10369 2.76e-09 62 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60999 2.76e-09 62 25 4 166 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5F4K8 2.78e-09 62 23 9 284 1 AAT Aspartate aminotransferase Pinus pinaster
B4TMR6 2.78e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 2.78e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 2.78e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 2.78e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
C0Q1K1 2.81e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
B5FDA0 3.06e-09 61 28 5 165 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
B6I848 3.23e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 3.23e-09 61 28 6 165 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 3.23e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 3.23e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 3.23e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
B1IZ53 3.29e-09 61 27 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7UT58 3.29e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q6LT75 3.35e-09 61 25 5 174 3 hisC Histidinol-phosphate aminotransferase Photobacterium profundum (strain SS9)
A8A1P5 3.38e-09 61 28 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
A8GC78 3.4e-09 61 26 5 165 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
B1LP20 3.7e-09 61 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q1RA52 3.83e-09 61 27 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 3.83e-09 61 27 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 3.83e-09 61 27 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A3PMF8 4.4e-09 61 20 11 372 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B1N009 4.43e-09 61 22 9 255 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
B7MWU0 4.47e-09 61 25 6 211 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
Q7VQW9 4.51e-09 61 25 5 165 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
B5FM42 4.87e-09 61 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
Q3Z0G4 5.31e-09 60 27 6 165 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
Q3ZXC8 5.36e-09 61 18 8 361 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
B7LUF2 5.7e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5YU77 5.7e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 5.7e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
Q9ZQI7 5.86e-09 61 24 5 232 1 ALD1 Aminotransferase ALD1, chloroplastic Arabidopsis thaliana
B7L9P8 5.91e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
Q83KJ6 6.24e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 6.24e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B7MDH5 6.24e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q87QL0 6.25e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q32EF0 7.28e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q5E637 7.42e-09 60 27 5 165 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8TUE9 7.95e-09 60 23 12 284 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P77730 8.11e-09 60 27 5 173 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
Q8Z5J9 8.51e-09 60 26 6 165 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
B0K735 9.34e-09 60 25 5 161 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B6EJ89 1.11e-08 59 26 5 165 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
Q0SHX9 1.15e-08 60 28 5 164 3 hisC Histidinol-phosphate aminotransferase Rhodococcus jostii (strain RHA1)
Q5YYP9 1.28e-08 60 29 6 161 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
Q5QWQ9 1.3e-08 59 29 7 182 3 hisC2 Histidinol-phosphate aminotransferase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B2TYF9 1.38e-08 59 27 6 165 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q18F03 1.43e-08 59 25 4 164 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A6QBY8 1.44e-08 59 18 5 243 3 hisC Histidinol-phosphate aminotransferase Sulfurovum sp. (strain NBC37-1)
B7NQG9 1.48e-08 59 26 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
C1ATZ5 1.63e-08 59 28 5 164 3 hisC Histidinol-phosphate aminotransferase Rhodococcus opacus (strain B4)
Q47XB7 1.86e-08 59 24 6 158 3 hisC Histidinol-phosphate aminotransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7MLS5 1.9e-08 59 26 5 165 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
B7NC61 1.93e-08 59 27 6 165 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q39M27 1.96e-08 59 30 6 165 3 hisC3 Histidinol-phosphate aminotransferase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2RK33 2.01e-08 59 22 10 362 1 dapL LL-diaminopimelate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A9ML15 2.33e-08 58 25 6 170 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9CLM3 2.78e-08 58 24 4 166 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q8PX17 3.24e-08 58 19 13 379 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B9DK21 3.31e-08 58 21 11 284 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
M1W859 3.76e-08 58 22 11 326 2 tcpI Probable aminotransferase tcpI Claviceps purpurea (strain 20.1)
A7MX17 3.77e-08 58 26 5 165 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
Q0S962 3.88e-08 58 27 7 187 3 pat Putative phenylalanine aminotransferase Rhodococcus jostii (strain RHA1)
Q2RL44 4e-08 58 25 4 176 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C5D3D2 4.09e-08 58 23 8 228 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
A1S6Z2 4.42e-08 58 29 5 155 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2NTX2 4.63e-08 58 27 7 166 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
P47039 5.44e-08 58 23 4 164 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q82DR2 6.81e-08 57 23 5 188 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8KDS8 6.85e-08 57 19 15 385 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q68XV9 8.03e-08 57 20 12 376 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7VSZ0 8.15e-08 57 28 6 167 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W2Y3 8.23e-08 57 28 6 167 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WDY3 8.6e-08 57 28 6 167 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q84I51 8.73e-08 57 24 6 166 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
A2SE05 1.02e-07 57 26 2 177 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A6Q1Z5 1.13e-07 57 19 5 250 3 hisC Histidinol-phosphate aminotransferase Nitratiruptor sp. (strain SB155-2)
A4QFG6 1.17e-07 57 23 5 189 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
Q492K2 1.27e-07 56 22 6 187 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
Q1LT68 1.54e-07 56 26 8 188 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q8TH25 1.75e-07 56 23 6 176 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
B2HQA3 1.81e-07 56 27 6 163 3 hisC Histidinol-phosphate aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
A2SSJ1 1.9e-07 56 22 4 162 3 hisC Histidinol-phosphate aminotransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q9KJU4 1.93e-07 56 22 5 189 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8D8Q1 2.08e-07 55 26 5 165 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
Q4UND3 2.17e-07 56 19 10 375 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P61005 2.31e-07 55 25 5 164 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0Q9F3 2.48e-07 55 25 5 164 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
A3Q7J9 2.53e-07 55 27 7 165 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
P96847 2.82e-07 55 20 10 334 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6LX26 2.86e-07 55 26 3 157 1 dapL LL-diaminopimelate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
C0ZCE7 2.98e-07 55 27 5 154 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q89AX7 2.99e-07 55 26 6 161 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q08415 3.49e-07 55 23 6 194 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Rattus norvegicus
Q5V4K3 3.74e-07 55 23 8 236 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
B8GIB0 3.76e-07 55 27 5 157 3 hisC Histidinol-phosphate aminotransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q9JYH7 3.94e-07 55 21 10 293 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8CTG8 4.08e-07 55 25 7 184 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR08 4.38e-07 55 25 7 184 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0PP15 4.49e-07 55 26 6 163 3 hisC Histidinol-phosphate aminotransferase Mycobacterium ulcerans (strain Agy99)
A1T8W2 4.66e-07 55 28 7 174 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P52893 5.01e-07 55 22 5 163 1 ALT1 Probable alanine aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A1KV06 5.59e-07 54 21 11 292 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 5.59e-07 54 21 11 292 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 5.59e-07 54 21 11 292 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q8F6W9 5.82e-07 54 21 16 378 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PG3 5.82e-07 54 21 16 378 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8BTY1 5.91e-07 54 24 10 252 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
Q9LVY1 6.02e-07 54 19 8 324 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q5FRR4 6.15e-07 54 24 9 219 3 hisC1 Histidinol-phosphate aminotransferase 1 Gluconobacter oxydans (strain 621H)
P44423 6.2e-07 54 22 7 249 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGY2 6.7e-07 54 22 7 249 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittGG)
A5UA19 6.88e-07 54 22 7 249 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittEE)
Q58786 6.91e-07 54 26 3 167 1 dapL LL-diaminopimelate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4QN73 7.53e-07 54 22 8 249 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain 86-028NP)
Q1RGV0 7.58e-07 54 19 12 373 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia bellii (strain RML369-C)
O93744 9.1e-07 53 21 14 337 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JFU6 9.13e-07 53 26 7 173 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q3AAT6 9.21e-07 53 22 11 287 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1R558 9.66e-07 53 24 5 182 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q5LNM6 1e-06 53 25 4 161 3 hisC Histidinol-phosphate aminotransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P61001 1.14e-06 53 26 6 175 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHI1 1.22e-06 53 26 6 175 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
A0A1U9YHZ6 1.45e-06 53 22 11 318 2 verI Aminotransferase verI Clonostachys rogersoniana
H3ZPL1 1.55e-06 53 22 15 366 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9X7B8 1.56e-06 53 25 7 176 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 1.56e-06 53 25 7 176 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
Q8R5Q4 1.85e-06 53 24 4 154 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1MFC0 2.02e-06 52 27 7 177 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q2W047 2.06e-06 53 25 4 162 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
C1B997 2.11e-06 52 28 5 157 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
P95957 2.35e-06 52 21 15 349 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A1VK38 2.5e-06 52 24 2 161 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
Q9SUR6 2.52e-06 52 21 13 314 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
B1VP97 2.64e-06 52 25 6 167 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q8VYP2 2.81e-06 52 22 13 312 2 At4g23590 Probable aminotransferase TAT4 Arabidopsis thaliana
Q9KCA8 3.11e-06 52 24 7 208 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q16773 3.26e-06 52 23 6 194 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q06402 3.27e-06 52 24 6 193 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
A0QX82 3.28e-06 52 28 9 171 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8KZ92 3.31e-06 52 22 6 201 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
Q8NTT4 3.44e-06 52 24 7 225 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P17731 3.65e-06 52 22 6 201 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis (strain 168)
Q2JPM4 3.77e-06 52 25 5 163 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
B3QP11 4.15e-06 52 22 13 293 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q49VS0 4.57e-06 52 22 4 166 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B4RJ05 4.89e-06 51 23 12 245 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 4.89e-06 51 23 12 245 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1B7G5 4.91e-06 52 25 10 181 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain MCS)
A1UHK7 4.91e-06 52 25 10 181 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain KMS)
A3Q130 4.91e-06 52 25 10 181 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain JLS)
A1TGS6 5.31e-06 51 23 7 177 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q6MDE0 5.48e-06 51 21 4 227 1 dapL LL-diaminopimelate aminotransferase Protochlamydia amoebophila (strain UWE25)
P29535 6.07e-06 51 24 9 203 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
A0A0P0VI36 7.81e-06 51 19 11 311 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
A4SE60 8.3e-06 51 23 3 164 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q24QJ1 8.83e-06 50 20 9 236 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
P56099 9.23e-06 50 23 7 184 3 HIS5 Histidinol-phosphate aminotransferase Candida maltosa
Q28TL1 9.48e-06 50 25 11 220 3 hisC Histidinol-phosphate aminotransferase Jannaschia sp. (strain CCS1)
Q46E46 1.18e-05 50 22 11 283 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
A0PXP5 1.21e-05 50 21 5 187 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
B0UN04 1.25e-05 50 24 10 281 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
Q4L4E7 1.34e-05 50 22 4 179 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
A5V022 1.4e-05 50 22 5 175 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q930J0 1.51e-05 50 22 4 179 3 hisC3 Histidinol-phosphate aminotransferase 3 Rhizobium meliloti (strain 1021)
Q04Z75 1.51e-05 50 21 14 371 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 1.51e-05 50 21 14 371 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A0M287 1.62e-05 50 26 5 155 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A5CZ78 1.63e-05 50 28 4 114 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q81P62 1.84e-05 50 23 5 172 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
Q7VIJ3 1.95e-05 50 21 8 246 3 hisC Histidinol-phosphate aminotransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q92JE7 1.96e-05 50 19 10 373 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2YSI3 1.98e-05 49 23 5 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
O87320 2.08e-05 50 18 9 348 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
A6GY79 2.47e-05 49 23 5 164 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q92MG0 2.53e-05 49 24 4 165 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
P36692 2.59e-05 48 22 2 114 3 aspC Probable aspartate aminotransferase (Fragment) Streptomyces griseus
A1W431 2.72e-05 49 24 4 163 3 hisC Histidinol-phosphate aminotransferase Acidovorax sp. (strain JS42)
Q00257 2.74e-05 49 27 4 151 2 ACS2 1-aminocyclopropane-1-carboxylate synthase CMA101 Cucurbita maxima
Q84CG1 2.85e-05 49 24 5 167 1 vioD Capreomycidine synthase Streptomyces vinaceus
C5A7A4 2.88e-05 49 25 7 187 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q88UE6 3.04e-05 49 19 4 172 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q10DK7 3.19e-05 49 26 3 144 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 3.19e-05 49 26 3 144 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
Q82FJ1 3.59e-05 48 26 13 267 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A4QAL4 4.27e-05 48 24 7 217 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
P9WQ91 4.4e-05 48 25 5 164 1 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ90 4.4e-05 48 25 5 164 3 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63499 4.4e-05 48 25 5 164 3 aspC Alanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3CWS8 4.45e-05 48 21 11 307 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q81SV5 4.86e-05 48 22 6 175 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
P16246 5.12e-05 48 23 7 212 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q63DL4 5.41e-05 48 22 6 175 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
Q6Q887 5.44e-05 48 20 9 330 2 sirI Probable aminotransferase sirI Leptosphaeria maculans
Q9A5B6 6.23e-05 48 22 6 174 3 hisC2 Histidinol-phosphate aminotransferase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P07172 6.38e-05 48 23 5 156 1 HIS5 Histidinol-phosphate aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2JLL9 7.51e-05 48 21 6 248 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9ZBY8 8.51e-05 47 25 13 267 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
C0ZM44 9.44e-05 47 24 8 197 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q3AD52 9.74e-05 47 23 4 168 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q73AX7 0.000102 47 21 8 209 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P28735 0.000113 46 30 5 113 3 hisC Histidinol-phosphate aminotransferase (Fragment) Mycolicibacterium smegmatis
Q81C43 0.000114 47 22 5 167 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GN55 0.000121 47 23 6 174 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9MDV4 0.000131 47 25 5 167 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
Q1GET3 0.000131 47 23 6 174 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
Q8Y0Y8 0.000141 47 25 14 297 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6HL37 0.000149 47 21 6 175 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q39K90 0.000154 47 23 6 182 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B0TY45 0.000158 47 22 6 161 3 hisC Histidinol-phosphate aminotransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
O28255 0.000164 47 24 12 228 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7NL03 0.000177 47 25 6 167 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P55648 0.000188 47 20 7 256 4 NGR_a01720 Uncharacterized protein y4rO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5LAZ9 0.000202 46 25 5 158 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P71348 0.000214 46 21 6 189 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q82WM3 0.000214 46 23 6 190 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9ST02 0.000236 46 20 11 316 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
Q46WL3 0.00026 46 24 11 241 1 hisC2 Histidinol-phosphate aminotransferase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9CMI7 0.000261 46 24 6 165 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
Q5Z3C0 0.000276 46 27 6 172 3 pat Putative phenylalanine aminotransferase Nocardia farcinica (strain IFM 10152)
P52892 0.000328 46 24 3 128 1 ALT2 Probable alanine aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q98G10 0.000366 45 22 8 248 3 hisC2 Histidinol-phosphate aminotransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q64RE8 0.000369 45 25 5 158 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
Q46Y48 0.000488 45 24 7 172 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9KJ19 0.000517 45 20 15 387 3 dapL LL-diaminopimelate aminotransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A7Z614 0.000521 45 19 6 201 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A6L2V8 0.000602 45 25 5 160 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B2IDA4 0.000622 45 21 9 297 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q9A671 0.000684 45 23 5 174 3 hisC1 Histidinol-phosphate aminotransferase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9SK47 0.000707 45 18 12 329 2 TAT3 Probable aminotransferase TAT3 Arabidopsis thaliana
Q63Q87 0.000776 45 24 6 172 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 0.000776 45 24 6 172 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q51687 0.000891 44 24 6 166 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
Q3JMZ7 0.001 44 24 6 172 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
P37821 0.001 44 26 3 144 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_04795
Feature type CDS
Gene malY
Product Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
Location 161295 - 162467 (strand: 1)
Length 1173 (nucleotides) / 390 (amino acids)

Contig

Accession contig_4
Length 199551 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_907
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1168 Amino acid transport and metabolism (E)
General function prediction only (R)
ER Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities

Kegg Ortholog Annotation(s)

Protein Sequence

MYDFDEIIERKSDRCRKWDHQYVCSRFGEVPQDFIPLWIADMDFKSPPAVIERFTQVAQHGTFGYTWCFDEFYDAVVRFQAERHQVTVQREWVTLSYGTVSTLHYLVQAFCQPGDCVMMNTPVYDPFAHAVTRQNVTVLTNPLVARDNRYHLDFDHIEAQMREHRPKVWLFCSPHNPSGRIWTAAEIKQVSDLCLQYGVLLVIDEVHAEHVLYGSFTGCLRPGCAAPENLILLTSPNKAFNLGGLKTSYSIIPDPALRAQFRRQLEKNSITSPNLFGVWGIIEAYNNSTDWLDELNRYLRGNADYLTQAVAEHFPDWQMMQPESSYLAWVNISATGRTATELTLDYARQTGVVVEDGSHYVADGEQYLRINFGTPRALLAEAVNRLKNAR

Flanking regions ( +/- flanking 50bp)

TGCAGAGTGTGAAATCCGGCATTGAAGCTTTAATTTAACAGGAACTGAGCATGTACGATTTTGATGAAATAATTGAGCGCAAAAGTGACCGCTGCCGGAAATGGGATCATCAGTATGTCTGTTCCCGCTTCGGGGAGGTCCCGCAGGACTTCATTCCGCTGTGGATAGCGGATATGGATTTCAAATCCCCGCCGGCGGTGATTGAGCGGTTCACGCAGGTGGCACAGCACGGTACCTTCGGCTACACCTGGTGCTTTGATGAATTTTACGATGCGGTGGTCCGCTTCCAGGCAGAGCGCCATCAGGTCACGGTTCAGCGGGAGTGGGTGACACTCAGTTACGGTACGGTTTCCACCCTGCACTATCTGGTGCAGGCATTCTGTCAGCCGGGCGACTGTGTGATGATGAATACACCGGTGTATGATCCGTTCGCCCATGCCGTGACCCGGCAAAATGTTACTGTGCTGACCAATCCGCTGGTGGCGCGGGATAACCGCTATCACCTTGATTTTGACCATATTGAGGCGCAGATGCGCGAACACCGGCCGAAAGTCTGGCTGTTCTGCTCGCCGCACAATCCGTCCGGCCGTATCTGGACGGCGGCGGAAATAAAACAGGTCTCGGATTTGTGTCTGCAATACGGTGTGCTGCTGGTGATTGATGAAGTGCATGCGGAACATGTGCTGTATGGCAGCTTCACCGGCTGTCTGCGCCCGGGATGTGCAGCGCCGGAGAATCTGATCCTCCTGACCTCACCGAACAAAGCCTTTAACCTCGGCGGGCTGAAAACCTCTTACAGCATCATTCCCGACCCGGCACTGCGGGCACAGTTCCGCCGTCAGCTGGAGAAAAACTCCATTACCTCACCTAATCTGTTCGGGGTATGGGGCATTATTGAGGCTTACAACAACAGCACTGACTGGCTGGATGAGCTGAACCGCTACCTGAGAGGCAATGCGGATTATCTGACACAGGCCGTTGCAGAGCATTTCCCTGACTGGCAGATGATGCAGCCGGAATCCTCTTACCTCGCCTGGGTGAATATCAGCGCCACCGGACGCACAGCGACAGAACTGACACTGGATTATGCCCGGCAGACCGGCGTGGTGGTTGAGGACGGCAGTCATTATGTGGCGGATGGTGAACAGTATCTGCGGATTAACTTCGGTACGCCGCGCGCACTGCTGGCGGAAGCGGTAAATCGTCTGAAAAACGCCCGGTAACAGAAAAAAATTGGCGACCTTGCTGTATTCCGTCAACAGGGTCGCCATAA