Homologs in group_50

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02420 FBDBKF_02420 32.4 Morganella morganii S1 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
FBDBKF_04795 FBDBKF_04795 86.7 Morganella morganii S1 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
EHELCC_02890 EHELCC_02890 32.4 Morganella morganii S2 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
EHELCC_06085 EHELCC_06085 86.7 Morganella morganii S2 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
NLDBIP_00570 NLDBIP_00570 32.4 Morganella morganii S4 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
NLDBIP_06405 NLDBIP_06405 86.7 Morganella morganii S4 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
LHKJJB_01465 LHKJJB_01465 32.4 Morganella morganii S3 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
LHKJJB_03285 LHKJJB_03285 86.7 Morganella morganii S3 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
HKOGLL_01505 HKOGLL_01505 32.4 Morganella morganii S5 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
HKOGLL_06760 HKOGLL_06760 86.7 Morganella morganii S5 malY Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities
F4V73_RS04795 F4V73_RS04795 32.4 Morganella psychrotolerans - MalY/PatB family protein
PMI_RS06160 PMI_RS06160 30.1 Proteus mirabilis HI4320 - MalY/PatB family protein

Distribution of the homologs in the orthogroup group_50

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_50

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q08432 2.83e-89 277 36 4 387 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
P23256 2.4e-67 221 31 7 392 1 malY Protein MalY Escherichia coli (strain K12)
Q9CBM9 1.83e-46 167 31 12 385 3 ML1794 Putative cystathionine beta-lyase Mycobacterium leprae (strain TN)
P9WQ83 2.35e-44 161 30 11 386 1 Rv2294 Putative cystathionine beta-lyase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ82 2.35e-44 161 30 11 386 3 MT2351 Putative cystathionine beta-lyase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63503 2.35e-44 161 30 11 386 3 BQ2027_MB2316 Putative cystathionine beta-lyase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5SHW0 7.28e-41 150 28 10 369 1 TTHA1620 Cystathionine beta-lyase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q93QC6 2.2e-34 134 25 10 386 1 metC Cystathionine beta-lyase Corynebacterium glutamicum
Q64HC5 3.93e-27 114 26 13 395 1 metC Cysteine-S-conjugate beta-lyase Corynebacterium striatum
O58489 6.07e-21 97 21 7 362 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O33822 8.39e-21 96 23 10 359 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
O67781 1.14e-20 96 20 10 366 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
Q56232 2.03e-20 95 23 11 365 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9SIE1 1.23e-18 90 22 12 372 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
Q9V0L2 3.23e-18 89 21 10 365 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q3MDN5 2.26e-17 86 22 9 361 3 dapL2 LL-diaminopimelate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q795M6 8.17e-17 84 20 10 369 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q3AC10 9.58e-17 84 21 8 361 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q60317 2.79e-16 83 19 8 369 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8YP73 5.23e-16 82 21 10 366 3 dapL2 LL-diaminopimelate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P53001 7.31e-16 82 20 11 368 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
P39643 8.64e-16 81 20 8 363 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
H3ZPU1 8.75e-16 81 19 7 363 1 OCC_04737 Aromatic-amino-acid aminotransferase 2 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
B1I544 1.17e-15 81 24 8 361 3 dapL LL-diaminopimelate aminotransferase Desulforudis audaxviator (strain MP104C)
P23034 1.82e-15 80 20 10 366 1 None Aspartate aminotransferase Bacillus sp. (strain YM-2)
Q5WX92 5.59e-15 79 26 14 314 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Lens)
Q5ZW88 1.35e-14 77 26 13 298 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
O27624 1.65e-14 77 24 10 277 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P14909 3.54e-14 77 19 10 337 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6D410 3.95e-14 76 30 5 165 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5X5X0 8.61e-14 75 25 14 314 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Paris)
B1N009 1.09e-13 75 24 9 270 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
Q59228 1.29e-13 75 22 14 378 3 aspC Aspartate aminotransferase Geobacillus stearothermophilus
Q987C8 1.89e-13 74 28 3 184 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9X0Y2 1.96e-13 74 18 10 359 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B8CX89 2.19e-13 74 20 9 364 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B2A250 2.32e-13 74 22 11 362 3 dapL LL-diaminopimelate aminotransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
E9L7A5 2.53e-13 74 21 9 371 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
B2FPM0 2.75e-13 73 27 4 177 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
B4STN8 2.93e-13 73 28 4 177 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain R551-3)
Q58097 1.05e-12 72 19 10 361 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4J8X2 1.12e-12 72 18 12 377 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q6YP21 1.29e-12 72 26 5 228 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
Q82WA8 1.7e-12 72 20 13 385 1 aatA Aspartate/prephenate aminotransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A0LEA5 1.83e-12 71 20 10 366 1 dapL LL-diaminopimelate aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B0K625 2.06e-12 71 28 6 177 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
Q3Z8H5 2.39e-12 71 21 10 362 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B0K735 2.72e-12 70 28 7 178 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A4IQ80 3.09e-12 70 25 6 187 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
Q65RB2 3.1e-12 70 26 6 178 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4WMJ9 3.6e-12 70 23 13 335 2 gliI Probable aminotransferase gliI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
C6DF75 4.8e-12 70 27 5 165 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q5F4K8 5.62e-12 70 21 12 378 1 AAT Aspartate aminotransferase Pinus pinaster
Q30ZX9 6.04e-12 70 23 12 362 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q02635 6.95e-12 70 21 11 375 1 aatA Aspartate/prephenate aminotransferase Rhizobium meliloti (strain 1021)
P77806 7.65e-12 69 22 14 357 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
A6QBY8 8.87e-12 69 20 6 248 3 hisC Histidinol-phosphate aminotransferase Sulfurovum sp. (strain NBC37-1)
Q9PBC6 9.34e-12 69 28 6 180 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
Q7T3E5 9.42e-12 69 22 11 327 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
Q9HUI9 1.1e-11 69 19 9 383 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q03VY3 1.1e-11 68 23 14 312 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q55128 1.3e-11 68 19 9 363 1 aspC Aspartate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6Q1Z5 1.44e-11 68 20 10 376 3 hisC Histidinol-phosphate aminotransferase Nitratiruptor sp. (strain SB155-2)
A4TKK4 1.45e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 1.45e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 1.45e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 1.45e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 1.45e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q71RI9 1.86e-11 68 21 8 319 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
B1JPW1 1.86e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FJH1 1.9e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
O66630 1.92e-11 68 21 13 369 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
B7GHJ8 2.09e-11 68 27 6 177 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q972A2 2.31e-11 68 20 7 245 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q66C50 2.38e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 2.38e-11 68 26 6 189 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A5FRC5 2.49e-11 68 20 10 362 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P77434 2.6e-11 68 22 11 354 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
Q9FEW2 2.7e-11 68 20 11 357 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
Q8DTM1 2.75e-11 68 20 14 374 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8EQB9 2.8e-11 67 25 5 189 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A1JTV9 3.1e-11 67 25 6 186 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q9CLM3 3.13e-11 67 25 5 168 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q0P8H7 5.13e-11 67 26 7 211 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0P5G4 5.31e-11 67 25 5 228 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
B8I5V1 5.57e-11 67 26 3 167 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q7M7Y6 6.49e-11 67 22 17 366 3 hisC Histidinol-phosphate aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9C969 7.27e-11 67 22 9 331 1 ISS1 Aromatic aminotransferase ISS1 Arabidopsis thaliana
Q5WGR9 8.37e-11 66 26 8 208 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
O82030 9.9e-11 66 20 11 357 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
M1W859 1.01e-10 66 22 12 327 2 tcpI Probable aminotransferase tcpI Claviceps purpurea (strain 20.1)
Q0W253 1.14e-10 66 23 14 367 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q17CS8 1.23e-10 66 26 5 176 1 KAT Kynurenine aminotransferase Aedes aegypti
Q87C30 1.37e-10 65 27 6 179 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 1.37e-10 65 27 6 179 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
B0U3B2 1.58e-10 65 27 6 179 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
Q47XB7 1.82e-10 65 24 5 170 3 hisC Histidinol-phosphate aminotransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B5XPE6 1.82e-10 65 26 5 165 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
P9WPZ5 1.86e-10 65 22 5 227 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 1.86e-10 65 22 5 227 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A6TBC4 1.92e-10 65 25 5 166 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3ZXC8 1.94e-10 65 19 10 362 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
C3LU31 1.97e-10 65 25 5 174 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 1.97e-10 65 25 5 174 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7NDX4 1.98e-10 65 20 9 365 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q15RU8 2.05e-10 65 23 16 316 3 hisC Histidinol-phosphate aminotransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q60013 2.19e-10 65 22 6 222 3 aspC Aspartate aminotransferase Streptomyces virginiae
B6EJ89 2.57e-10 64 25 5 166 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
P0DI07 2.82e-10 65 20 12 360 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 2.82e-10 65 20 12 360 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
Q8TVG3 3.78e-10 64 21 14 367 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P77730 3.95e-10 64 29 3 140 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
Q58FK9 4.08e-10 64 22 9 313 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
Q3AAT6 4.26e-10 64 27 5 173 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B8DJJ6 4.42e-10 64 23 13 371 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q87QL0 4.68e-10 63 25 5 176 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q04Z75 4.77e-10 64 23 15 373 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 4.77e-10 64 23 15 373 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q4JW58 4.8e-10 64 27 5 179 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
Q9KSX2 4.81e-10 63 25 5 174 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8VYP2 4.92e-10 64 23 15 335 2 At4g23590 Probable aminotransferase TAT4 Arabidopsis thaliana
O31665 4.94e-10 64 20 7 319 1 mtnE L-glutamine--4-(methylsulfanyl)-2-oxobutanoate aminotransferase Bacillus subtilis (strain 168)
Q9ZHE5 4.99e-10 63 25 5 173 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q57MS2 5.41e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B5FDA0 5.88e-10 63 24 5 177 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
P96847 6.25e-10 63 20 8 331 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A7MJP4 6.4e-10 63 25 5 171 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
A9MSC2 6.55e-10 63 25 10 227 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 6.55e-10 63 25 10 227 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
Q5KXV3 6.66e-10 63 24 6 183 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
B5BFB9 6.79e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 6.79e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FM42 6.98e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
B4T9N5 8.06e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
P10369 8.51e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q39M27 8.61e-10 63 26 9 238 3 hisC3 Histidinol-phosphate aminotransferase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4TMR6 8.67e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 8.67e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 8.67e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 8.67e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
C0Q1K1 8.83e-10 63 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
A7ZNJ3 9.79e-10 63 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2NEQ0 9.82e-10 63 21 13 332 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q1RGV0 9.99e-10 63 19 12 376 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia bellii (strain RML369-C)
A4WC70 1.1e-09 63 27 7 179 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
O28277 1.13e-09 62 22 13 288 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6LT75 1.17e-09 63 25 5 174 3 hisC Histidinol-phosphate aminotransferase Photobacterium profundum (strain SS9)
P57202 1.21e-09 62 24 5 177 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D707 1.22e-09 62 24 5 177 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 1.22e-09 62 24 5 177 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q4UU41 1.54e-09 62 27 4 176 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
Q4UND3 1.6e-09 62 19 13 379 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P60999 1.64e-09 62 24 3 179 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A3PMF8 1.73e-09 62 19 10 370 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
O14209 1.84e-09 62 22 12 340 3 SPAC6B12.04c Uncharacterized aminotransferase C6B12.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q30TC9 1.84e-09 62 20 13 364 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5E637 1.95e-09 62 24 5 177 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7MWU0 2.15e-09 62 25 8 211 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
Q7WDY3 2.17e-09 62 29 3 131 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W2Y3 2.25e-09 62 29 3 131 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8Z5J9 2.36e-09 62 24 10 227 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
Q7VSZ0 2.56e-09 62 29 3 131 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
C6C2Z3 2.76e-09 62 20 11 353 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
Q323J1 2.85e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
A9ML15 3.07e-09 61 24 9 222 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B0RSL5 3.17e-09 61 27 4 176 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
B5YU77 3.17e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 3.17e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
B7L9P8 3.41e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
Q32EF0 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
B6I848 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 3.5e-09 61 25 6 185 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
B7MDH5 3.5e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
P52893 3.53e-09 62 24 4 162 1 ALT1 Probable alanine aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A8A1P5 3.57e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
A6LAM2 3.72e-09 61 23 9 294 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q83KJ6 4.05e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 4.05e-09 61 25 6 185 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B1IZ53 4.16e-09 61 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q65I37 4.17e-09 61 24 6 187 3 hisC Histidinol-phosphate aminotransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q18F03 4.18e-09 61 25 4 167 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B9LNJ8 4.22e-09 61 24 9 235 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B7UT58 4.72e-09 61 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q11VM5 5.03e-09 60 23 13 301 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B7LUF2 5.07e-09 60 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RA52 5.12e-09 60 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 5.12e-09 60 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 5.12e-09 60 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5FRR4 5.24e-09 61 26 10 221 3 hisC1 Histidinol-phosphate aminotransferase 1 Gluconobacter oxydans (strain 621H)
C5A7A4 5.65e-09 60 23 12 297 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
B2TYF9 6.08e-09 60 25 6 185 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q5QWQ9 6.27e-09 60 28 6 184 3 hisC2 Histidinol-phosphate aminotransferase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3BUF6 6.36e-09 60 26 4 176 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A7MX17 6.54e-09 60 23 5 176 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
Q8FNZ1 6.64e-09 60 22 4 197 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A2SE05 6.86e-09 60 25 2 177 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
C5D3D2 7.68e-09 60 22 8 228 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
A1R558 8.78e-09 60 25 4 182 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q3Z879 9.36e-09 60 26 8 201 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q88UE6 1.02e-08 60 23 5 174 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q0SHX9 1.07e-08 60 28 4 164 3 hisC Histidinol-phosphate aminotransferase Rhodococcus jostii (strain RHA1)
Q7N6I1 1.1e-08 60 25 7 172 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7MLS5 1.11e-08 59 23 5 176 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
B7NQG9 1.17e-08 59 24 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9ZE56 1.2e-08 60 20 15 378 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia prowazekii (strain Madrid E)
P16524 1.24e-08 60 20 11 370 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
A8AEK3 1.25e-08 59 23 5 171 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3Z0G4 1.52e-08 59 24 7 185 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
P58891 1.55e-08 59 26 4 176 3 hisC Histidinol-phosphate aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
C1ATZ5 1.65e-08 59 28 4 164 3 hisC Histidinol-phosphate aminotransferase Rhodococcus opacus (strain B4)
Q49VS0 1.82e-08 59 24 5 174 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2JPM4 1.87e-08 59 23 14 304 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8R5Q4 1.87e-08 59 24 5 168 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8PX17 1.96e-08 59 20 13 363 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B2GBR8 2.07e-08 59 23 5 172 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8F6W9 2.2e-08 58 21 16 378 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PG3 2.2e-08 58 21 16 378 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A7HCR6 2.31e-08 58 23 4 167 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
B7NC61 2.43e-08 58 24 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q5H0L0 2.81e-08 58 26 5 178 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K2 2.81e-08 58 26 5 178 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4QFG6 2.86e-08 58 22 4 181 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
Q82DR2 2.89e-08 58 22 8 234 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O86459 3.12e-08 58 20 12 376 3 aspC Probable aspartate/prephenate aminotransferase Rhizobium leguminosarum bv. phaseoli
B1LP20 3.3e-08 58 24 6 185 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
A1S6Z2 3.38e-08 58 29 4 155 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7VQW9 3.71e-08 58 24 5 163 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
Q92JE7 3.95e-08 58 19 13 379 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8TUE9 4.42e-08 58 22 12 286 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A3Q130 4.65e-08 58 26 7 190 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain JLS)
Q9KJU4 4.73e-08 58 21 4 181 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1B7G5 4.86e-08 58 26 7 190 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain MCS)
A1UHK7 4.86e-08 58 26 7 190 3 hisC Histidinol-phosphate aminotransferase Mycobacterium sp. (strain KMS)
P58892 5.89e-08 57 27 4 174 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A0M287 6.28e-08 57 24 15 314 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q5V4K3 6.64e-08 57 24 5 169 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A1ACN3 6.96e-08 57 23 5 171 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
Q84I51 6.98e-08 57 25 6 159 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
A2SSJ1 7.75e-08 57 21 4 162 3 hisC Histidinol-phosphate aminotransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
B8FP20 8.01e-08 57 21 7 228 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B9DK21 8.35e-08 57 24 4 166 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
Q9HQS0 8.4e-08 57 23 6 214 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 8.4e-08 57 23 6 214 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q58365 8.75e-08 57 20 10 282 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8CTG8 8.87e-08 57 26 8 179 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR08 9.36e-08 57 26 8 179 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6GY79 1.09e-07 57 24 6 169 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q9SUR6 1.13e-07 57 20 12 329 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
A8EWM9 1.14e-07 57 18 12 385 3 hisC Histidinol-phosphate aminotransferase Aliarcobacter butzleri (strain RM4018)
A0A1U9YHZ6 1.16e-07 57 29 4 129 2 verI Aminotransferase verI Clonostachys rogersoniana
B1MFC0 1.16e-07 56 27 7 177 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
C0ZCE7 1.18e-07 57 24 5 172 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
O87320 1.18e-07 57 18 9 348 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
Q8D8Q1 1.29e-07 56 22 5 176 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
Q16773 1.33e-07 57 23 7 243 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q9ZQI7 1.45e-07 57 22 4 227 1 ALD1 Aminotransferase ALD1, chloroplastic Arabidopsis thaliana
P61001 1.62e-07 56 25 4 192 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHI1 1.65e-07 56 25 4 192 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
P47039 1.77e-07 56 20 14 350 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2RL44 1.88e-07 56 22 9 309 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8KDS8 2e-07 56 21 8 238 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8GIB0 2.03e-07 55 25 4 156 3 hisC Histidinol-phosphate aminotransferase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q9LVY1 2.07e-07 56 19 13 408 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q492K2 2.58e-07 55 22 6 216 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
A5V022 2.61e-07 55 22 5 175 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q9KCA8 2.92e-07 55 23 7 208 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0QX82 3.03e-07 55 29 7 174 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q24QJ1 3.05e-07 55 21 7 228 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
O07587 3.12e-07 55 21 8 222 3 yhdR Putative aspartate aminotransferase YhdR Bacillus subtilis (strain 168)
P61005 3.25e-07 55 24 5 164 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0Q9F3 3.37e-07 55 24 5 164 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
A5CZ78 4.19e-07 55 29 4 114 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A1BGB4 4.32e-07 55 21 5 194 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q5YYP9 4.44e-07 55 25 5 171 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
A1T8W2 4.58e-07 55 29 7 175 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9X7B8 4.84e-07 55 26 5 173 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 4.84e-07 55 26 5 173 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
Q06191 5.54e-07 55 21 15 375 1 aatB Aspartate aminotransferase Rhizobium meliloti
A0KKB7 6.49e-07 54 22 5 165 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q2RK33 7.03e-07 54 21 10 364 1 dapL LL-diaminopimelate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A4SMP7 8.02e-07 54 22 5 165 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
Q58786 8.33e-07 54 23 9 263 1 dapL LL-diaminopimelate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q08415 8.79e-07 54 22 4 187 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Rattus norvegicus
A1TGS6 8.97e-07 53 22 7 191 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8TH25 9.12e-07 53 22 6 193 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q970Z4 9.48e-07 53 21 6 232 3 hisC Histidinol-phosphate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q2NTX2 1.02e-06 53 23 6 165 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
P58350 1.04e-06 53 21 15 373 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
A1A2H6 1.08e-06 53 23 5 234 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
O93744 1.12e-06 53 23 9 207 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A3Q7J9 1.23e-06 53 25 5 163 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
Q3SV41 1.26e-06 53 22 11 309 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A1VK38 1.29e-06 53 24 2 165 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
Q2YSI3 1.45e-06 53 26 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4QN73 1.5e-06 53 21 9 251 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain 86-028NP)
A7H084 1.51e-06 53 20 12 362 3 hisC Histidinol-phosphate aminotransferase Campylobacter curvus (strain 525.92)
Q1B1Z8 1.53e-06 53 25 5 163 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain MCS)
A1UN51 1.53e-06 53 25 5 163 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain KMS)
A5UA19 1.6e-06 53 21 9 251 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittEE)
A5UGY2 1.64e-06 53 21 9 251 3 hisC Histidinol-phosphate aminotransferase Haemophilus influenzae (strain PittGG)
Q1LT68 1.67e-06 53 23 7 187 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
P44423 2.09e-06 53 21 8 249 3 hisC1 Histidinol-phosphate aminotransferase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P95957 2.29e-06 52 20 13 343 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0A0P0VI36 2.74e-06 52 20 4 153 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
Q3B3L3 3.11e-06 52 19 5 167 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A8YZZ5 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 3.29e-06 52 25 6 163 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 3.29e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GIR8 3.38e-06 52 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
Q8BTY1 3.48e-06 52 21 10 313 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
Q8G4S8 4.02e-06 52 25 5 189 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium longum (strain NCC 2705)
Q8NXN3 4.75e-06 51 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 4.75e-06 51 25 6 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q67Y55 4.94e-06 52 19 12 332 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
A0PXP5 4.98e-06 51 22 5 175 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
P29535 5.71e-06 52 24 9 201 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
A1KV06 5.73e-06 51 22 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 5.73e-06 51 22 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 5.73e-06 51 22 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q9A5B6 5.93e-06 51 21 6 174 3 hisC2 Histidinol-phosphate aminotransferase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q92MG0 6.21e-06 51 23 4 177 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
B0UN04 6.24e-06 51 25 8 219 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
Q6LX26 6.37e-06 51 25 3 164 1 dapL LL-diaminopimelate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q9JYH7 6.55e-06 51 23 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8ABA8 6.72e-06 51 20 12 291 3 hisC Histidinol-phosphate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6ABX6 7.41e-06 51 26 8 182 3 pat Putative phenylalanine aminotransferase Leifsonia xyli subsp. xyli (strain CTCB07)
Q9SIV0 7.77e-06 51 18 9 313 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
C1B997 7.82e-06 51 25 5 157 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
Q5LAZ9 8.08e-06 51 23 5 175 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P55648 8.12e-06 51 21 7 275 4 NGR_a01720 Uncharacterized protein y4rO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A5UKY0 9.38e-06 50 19 12 371 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A4XMY1 9.69e-06 50 22 7 183 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q6Q887 9.87e-06 50 19 7 325 2 sirI Probable aminotransferase sirI Leptosphaeria maculans
Q64RE8 1.02e-05 50 24 5 175 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
P71348 1.12e-05 50 19 4 185 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A7Z614 1.17e-05 50 20 6 201 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q3AD52 1.2e-05 50 26 7 171 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q5JFU6 1.24e-05 50 23 6 173 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1MR87 1.33e-05 50 20 13 388 3 dapL LL-diaminopimelate aminotransferase Lawsonia intracellularis (strain PHE/MN1-00)
A4SE60 1.35e-05 50 21 4 164 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q06402 1.57e-05 50 23 7 193 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
Q81SV5 1.59e-05 50 21 7 177 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
A0R5X8 1.8e-05 50 22 6 179 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B2HQA3 2.07e-05 50 25 7 176 3 hisC Histidinol-phosphate aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
A7NFV2 2.29e-05 49 21 4 161 3 hisC Histidinol-phosphate aminotransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B4RJ05 2.9e-05 49 22 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 2.9e-05 49 22 5 159 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8BGT5 3.06e-05 49 26 5 172 1 Gpt2 Alanine aminotransferase 2 Mus musculus
Q63DL4 3.17e-05 49 21 7 177 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
A5G9G1 3.57e-05 48 22 5 172 3 hisC Histidinol-phosphate aminotransferase Geotalea uraniireducens (strain Rf4)
A3CWS8 4.18e-05 48 21 4 157 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
B2HLJ8 4.31e-05 48 22 5 181 3 pat Putative phenylalanine aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
P52892 4.36e-05 49 22 4 159 1 ALT2 Probable alanine aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6HL37 4.95e-05 48 20 7 177 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63A05 5.08e-05 48 19 8 228 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q6MDE0 5.09e-05 48 19 14 412 1 dapL LL-diaminopimelate aminotransferase Protochlamydia amoebophila (strain UWE25)
Q6HHF6 5.31e-05 48 20 8 228 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q01912 5.43e-05 48 27 5 151 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
A0PP15 5.45e-05 48 25 7 176 3 hisC Histidinol-phosphate aminotransferase Mycobacterium ulcerans (strain Agy99)
P16246 6.16e-05 48 20 6 210 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82WM3 6.52e-05 48 20 4 181 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q253K9 6.6e-05 48 18 3 170 3 dapL LL-diaminopimelate aminotransferase Chlamydia felis (strain Fe/C-56)
Q67KI2 7.55e-05 48 19 4 167 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2RP86 8.31e-05 48 23 6 177 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q51687 8.67e-05 47 24 6 175 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
P61000 9.34e-05 47 22 4 171 3 hisC Histidinol-phosphate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P9WQ91 9.39e-05 48 24 5 166 1 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ90 9.39e-05 48 24 5 166 3 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63499 9.39e-05 48 24 5 166 3 aspC Alanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C0ZM44 0.000101 47 22 7 189 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
P28735 0.000104 46 29 5 131 3 hisC Histidinol-phosphate aminotransferase (Fragment) Mycolicibacterium smegmatis
Q96QU6 0.000106 47 21 6 178 1 ACCS 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Homo sapiens
Q3AW44 0.00011 47 19 10 350 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain CC9902)
Q73AX7 0.000113 47 21 7 177 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
B9LZ53 0.000118 47 22 5 170 3 hisC Histidinol-phosphate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q20YH9 0.000122 47 20 6 240 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
Q9SAR0 0.000126 47 23 6 187 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
Q81P62 0.00013 47 19 8 228 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
A6UTL8 0.000132 47 22 12 241 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q39YP6 0.000139 47 22 4 170 1 hisC Histidinol-phosphate aminotransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q84CG1 0.000156 47 21 6 187 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q4K8N0 0.000157 47 24 14 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P61004 0.000177 47 22 9 274 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P36692 0.000187 45 20 2 136 3 aspC Probable aspartate aminotransferase (Fragment) Streptomyces griseus
Q9ST02 0.0002 47 20 3 139 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
Q8FU28 0.000202 46 25 7 172 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P39389 0.000204 47 20 16 366 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
A9BCJ1 0.000206 47 20 11 384 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9211)
A1W431 0.000215 46 22 4 165 3 hisC Histidinol-phosphate aminotransferase Acidovorax sp. (strain JS42)
Q10DK7 0.000247 46 25 3 144 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 0.000247 46 25 3 144 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
Q0ID68 0.000248 46 19 10 347 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain CC9311)
Q5Z3C0 0.000248 46 26 6 164 3 pat Putative phenylalanine aminotransferase Nocardia farcinica (strain IFM 10152)
B9MDV4 0.000252 46 22 4 165 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
Q3M504 0.000255 46 21 4 194 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9MB95 0.000296 46 22 7 214 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
Q2JTG5 0.000304 46 21 7 239 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
Q8NTT4 0.000306 46 21 6 220 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q07IG8 0.000307 46 20 6 240 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
Q824A4 0.000314 46 21 9 258 3 dapL LL-diaminopimelate aminotransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B2IDA4 0.000332 46 24 6 187 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q7NL03 0.000347 45 23 6 167 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q930J0 0.000401 45 22 4 176 3 hisC3 Histidinol-phosphate aminotransferase 3 Rhizobium meliloti (strain 1021)
Q5L6M0 0.000411 45 20 10 314 3 dapL LL-diaminopimelate aminotransferase Chlamydia abortus (strain DSM 27085 / S26/3)
P37821 0.000443 45 23 6 188 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
Q4AC99 0.000444 46 22 4 158 1 ACCSL Probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2 Homo sapiens
Q9ST03 0.000454 45 20 3 139 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
Q0BVW4 0.000504 45 23 5 180 3 hisC Histidinol-phosphate aminotransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A8MEH2 0.000519 45 20 5 169 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
A7XRY8 0.000576 45 19 16 385 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q1QQD5 0.000657 45 22 11 299 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A4QAL4 0.000692 45 21 6 215 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
A9KJ19 0.000736 45 19 13 385 3 dapL LL-diaminopimelate aminotransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q0C348 0.000837 44 19 3 161 3 hisC Histidinol-phosphate aminotransferase Hyphomonas neptunium (strain ATCC 15444)
Q31GD4 0.00087 44 23 6 184 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A5CVR5 0.001 44 23 7 190 3 hisC Histidinol-phosphate aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09265
Feature type CDS
Gene -
Product PatB family C-S lyase
Location 1940913 - 1942085 (strand: 1)
Length 1173 (nucleotides) / 390 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_50
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1168 Amino acid transport and metabolism (E)
General function prediction only (R)
ER Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities

Kegg Ortholog Annotation(s)

Protein Sequence

MYNFDEIIERKSDRCRKWDHQYVCSRFGDVPQDFIPLWIADMDFKSPPAVIERFSQIAQHGTFGYTWCFDEFYEAVVRFQAQRHQVQITPDWITLSYGTVSTLHYLVQAFCQPGDSVMMNTPVYDPFAHAVTRQNVTVLTNPLVVRDSRYHLDFDNIEKQMREHQPKVWLFCSPHNPSGRIWTGAEIKQVSDLCQQYGVLLVIDEVHAEHVLYGTFTSCLQPDCAAPENLILLTSPNKAFNLGGLKTSYSIIPDPVLRAQFRRRLEKNSITSPNLFGVWGIIEAYNNSSAWLDALNIYLKGNADYLAQAVSDYFPDWRMMQPESSYLAWIDISATGRTATELTHYYAQKTGVVVEDGSHYVADGENYLRINFGTPRRLLTDAFERLHRTT

Flanking regions ( +/- flanking 50bp)

ACAGAGTGTGAAATCCGGCCTTGAAGCCTTAATTTAAACAGGAAGTGAGCATGTACAATTTTGACGAAATCATTGAGCGAAAAAGTGACCGCTGCCGGAAATGGGATCATCAGTATGTCTGTTCGCGCTTCGGTGATGTTCCGCAGGACTTCATTCCGTTGTGGATTGCAGATATGGATTTTAAATCCCCTCCGGCGGTGATTGAGCGCTTTTCTCAGATAGCACAGCACGGAACATTCGGCTACACCTGGTGCTTTGATGAATTCTATGAGGCCGTCGTCCGTTTTCAGGCACAACGGCATCAGGTACAGATTACCCCGGACTGGATAACACTGAGCTACGGCACCGTCTCTACCCTGCACTATCTGGTGCAGGCATTTTGTCAGCCGGGTGACAGTGTGATGATGAATACCCCGGTTTATGATCCCTTTGCCCATGCCGTCACCCGGCAAAATGTCACCGTACTGACCAATCCGCTGGTTGTGCGTGATAGCCGCTATCATCTTGATTTTGATAATATCGAAAAACAGATGCGGGAGCATCAGCCAAAAGTATGGCTGTTTTGTTCTCCGCATAACCCGTCCGGGCGGATCTGGACGGGTGCAGAGATAAAACAGGTTTCTGATTTATGTCAGCAATACGGCGTTCTGCTGGTGATTGATGAAGTGCATGCAGAGCATGTTTTATACGGAACATTTACCAGTTGCCTTCAGCCGGACTGTGCTGCACCGGAAAACCTGATTTTACTGACCTCACCGAATAAAGCCTTTAATCTCGGCGGATTGAAAACCTCATACAGTATTATTCCTGATCCTGTGCTGCGCGCACAATTTCGCCGCCGGCTGGAAAAAAACTCCATCACGTCGCCCAATCTGTTTGGTGTATGGGGAATTATTGAAGCTTACAACAATAGTTCCGCATGGCTGGATGCACTGAATATCTATCTGAAAGGAAACGCGGATTATCTGGCACAGGCTGTTTCGGATTATTTCCCTGACTGGCGCATGATGCAGCCGGAATCATCTTATCTTGCCTGGATTGATATCAGTGCAACAGGGCGGACGGCTACAGAGCTGACACACTATTACGCACAAAAAACAGGTGTGGTAGTGGAGGACGGCAGCCATTATGTTGCTGACGGAGAAAACTATCTGCGGATCAATTTCGGGACACCACGGCGTTTACTGACAGATGCGTTTGAACGCCTGCACCGGACAACATAAACTAAAAAATTGGCGACCATGCTGTATTCCATCAACAGGGTCGCCATAAT