Homologs in group_751

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_07190 EHELCC_07190 100.0 Morganella morganii S2 mreC rod shape-determining protein MreC
NLDBIP_07515 NLDBIP_07515 100.0 Morganella morganii S4 mreC rod shape-determining protein MreC
LHKJJB_07050 LHKJJB_07050 100.0 Morganella morganii S3 mreC rod shape-determining protein MreC
HKOGLL_03880 HKOGLL_03880 100.0 Morganella morganii S5 mreC rod shape-determining protein MreC
F4V73_RS11590 F4V73_RS11590 87.2 Morganella psychrotolerans mreC rod shape-determining protein MreC
PMI_RS18070 PMI_RS18070 71.9 Proteus mirabilis HI4320 mreC rod shape-determining protein MreC

Distribution of the homologs in the orthogroup group_751

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_751

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16926 2.86e-152 436 69 2 338 1 mreC Cell shape-determining protein MreC Escherichia coli (strain K12)
P44475 5.84e-103 310 51 1 295 3 mreC Cell shape-determining protein MreC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q70AN6 3.98e-20 92 31 3 228 3 mreC Cell shape-determining protein MreC Cereibacter sphaeroides
B8H610 6.7e-19 90 31 7 241 1 mreC Cell shape-determining protein MreC Caulobacter vibrioides (strain NA1000 / CB15N)
Q8Y6Y4 1.92e-15 79 27 2 219 1 mreC Cell shape-determining protein MreC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P84480 2.27e-13 73 26 6 234 3 mreC Cell shape-determining protein MreC Geobacillus stearothermophilus
Q01466 2.27e-13 73 26 6 234 1 mreC Cell shape-determining protein MreC Bacillus subtilis (strain 168)
Q8DMY2 3.64e-09 60 26 3 187 1 mreC Cell shape-determining protein MreC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_03345
Feature type CDS
Gene mreC
Product rod shape-determining protein MreC
Location 70103 - 71224 (strand: -1)
Length 1122 (nucleotides) / 373 (amino acids)

Contig

Accession contig_3
Length 210665 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_751
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04085 rod shape-determining protein MreC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1792 Cell cycle control, cell division, chromosome partitioning (D)
Cytoskeleton (Z)		 DZ Cell shape-determining protein MreC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03570 rod shape-determining protein MreC - -

Protein Sequence

MKPIFSRGPSLQIRIVVAVIFAIGLIVVDNRIDAFTKIRNYLDTAVSPFYFLANGPRQLLDGISDNFATREQLEFENRALRQELLVKSSQNQLLEQFKQENARLRELLGSPLRQDEHMMVTQVMAGANTPYRDQVVIDKGSRDGVYDGQPVISDKGVVGQVIAVSQLTSRVLLICDTTHALPIQVLRNDIRVIASGTGCTDDLQLEPLPNNIDIRVGDVLVTSGLGGRFPEGYPVGIVSSVKVDNQRAYTIISAKPTADLQRLRYLLLLWGGDSNPREPSGPSEVYRAANERIMQVMPQVIPSVQTPETDPAAAAPDAPAAPAPSAGTTPPKPAGPKPAQPKPADTPATAAPAAQDPAADSAPARPLRMRPQQ

Flanking regions ( +/- flanking 50bp)

ACACTCTGTCTTCCCGGACGGAATTACTGTAGTGCCTGATATCGCATCCTATGAAGCCGATTTTTAGCCGGGGGCCTTCCCTTCAGATTCGCATTGTTGTTGCGGTTATTTTTGCCATCGGACTGATTGTGGTTGATAACCGGATTGATGCTTTTACCAAAATCCGTAACTATCTGGATACGGCGGTCAGCCCGTTCTATTTTTTAGCCAACGGCCCGCGTCAGTTACTGGACGGTATCTCTGATAACTTTGCCACCCGCGAGCAGCTGGAATTTGAAAACCGCGCTCTGCGCCAGGAATTGCTGGTTAAAAGCAGTCAGAATCAGCTGCTTGAACAATTTAAGCAGGAAAATGCCCGGCTGCGTGAACTGCTCGGTTCACCGCTGCGTCAGGATGAGCACATGATGGTCACTCAGGTGATGGCGGGAGCCAACACTCCGTACCGTGACCAGGTGGTGATCGACAAAGGCAGCCGTGACGGCGTGTATGACGGCCAGCCGGTGATCAGTGATAAAGGCGTGGTGGGGCAGGTGATTGCCGTGTCTCAGTTAACCAGCCGTGTTCTGCTGATCTGCGATACCACTCACGCACTGCCGATTCAGGTACTGCGTAACGACATTCGCGTCATTGCATCCGGCACCGGATGTACTGACGATTTACAGCTTGAACCACTGCCGAACAATATTGATATCCGCGTGGGGGATGTGCTGGTCACCTCCGGCCTCGGCGGCCGTTTCCCGGAAGGTTACCCGGTCGGGATTGTCTCTTCGGTAAAAGTGGATAATCAGCGCGCTTATACCATTATCAGTGCCAAACCGACGGCTGACCTTCAGCGTCTGCGTTATCTGCTCTTATTATGGGGCGGAGACAGCAACCCGCGTGAGCCTTCCGGCCCGTCTGAGGTGTACCGCGCGGCCAACGAACGTATCATGCAGGTTATGCCGCAGGTGATCCCGTCTGTTCAGACGCCGGAAACTGACCCGGCTGCGGCAGCCCCGGACGCACCTGCCGCTCCGGCACCTTCCGCCGGTACGACTCCGCCGAAACCGGCCGGGCCGAAGCCTGCACAGCCAAAACCGGCAGACACACCGGCCACTGCCGCACCGGCCGCTCAGGATCCGGCTGCTGATTCCGCACCGGCCCGGCCGCTGAGGATGAGGCCGCAACAATGAATACCTACCGGGGACAAAACCGGATTATTGTCTGGCTCTCCTTTCTGATA