Homologs in group_3215

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_03265 EHELCC_03265 100.0 Morganella morganii S2 glxA Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain
NLDBIP_00195 NLDBIP_00195 100.0 Morganella morganii S4 glxA Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain
LHKJJB_01840 LHKJJB_01840 100.0 Morganella morganii S3 glxA Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain
HKOGLL_01880 HKOGLL_01880 100.0 Morganella morganii S5 glxA Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain

Distribution of the homologs in the orthogroup group_3215

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3215

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8G9F9 2.62e-32 121 34 5 226 1 inhA Isonitrile hydratase Pseudomonas putida
Q5JGM7 1.43e-06 50 26 4 149 3 TK1284 Deglycase TK1284 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q51732 1.18e-05 47 28 3 123 1 pfpI Deglycase PfpI Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O59413 4.99e-05 46 26 2 126 1 PH1704 Deglycase PH1704 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V1F8 0.000103 45 27 3 123 3 PYRAB04690 Deglycase PYRAB04690 Pyrococcus abyssi (strain GE5 / Orsay)
Q54MG7 0.000193 45 31 4 105 3 DDB_G0285969 Protein DJ-1 homolog Dictyostelium discoideum
P80876 0.00082 42 28 3 129 1 yfkM General stress protein 18 Bacillus subtilis (strain 168)
Q49WT1 0.001 42 26 5 172 3 SSP1625 Uncharacterized protein SSP1625 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02795
Feature type CDS
Gene glxA
Product Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain
Location 255814 - 256599 (strand: -1)
Length 786 (nucleotides) / 261 (amino acids)
In genomic island -

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3215
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF01965 DJ-1/PfpI family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4977 Transcription (K) K Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K18199 cyclohexyl-isocyanide hydratase [EC:4.2.1.103] Caprolactam degradation
Microbial metabolism in diverse environments
-

Protein Sequence

MSDHDYAVETIYGLSTPSIQALIAAGRASQPALLKIGIFVCPGYMPMDINGAQSVFTIAGAEIYLIWKRRELVEGYIGWPTMPTMTFDECPDDLDVLVTGMVPPEVIEDPEVIRFFAQAGQKAKYVIGTCYGSLMLGTAGLLKGRRATSNSNVVPMLPDVGAVAVGGSDVVIDDTIYTSGPATGSFDASLLVLKALRGEELAALVELAIEYDPRPPFRTGSPQLAGPEMTAISQSMTAPLNRQYHEAAKRGYARYQQMIQD

Flanking regions ( +/- flanking 50bp)

CATGCATTATTTTACCGGTTAGTAAATAAATGTTGTCACGGAGTATTTTGATGTCTGATCATGATTATGCAGTTGAAACGATTTACGGGCTGAGCACGCCTTCCATTCAGGCGCTGATCGCTGCCGGACGCGCATCACAGCCCGCATTACTGAAAATCGGAATTTTTGTCTGTCCGGGTTATATGCCGATGGATATCAACGGCGCGCAGTCTGTTTTTACGATTGCAGGGGCGGAAATCTATCTTATCTGGAAACGCCGGGAGCTGGTGGAGGGCTATATCGGCTGGCCGACGATGCCGACAATGACCTTTGATGAGTGTCCGGATGATCTGGATGTACTGGTGACCGGAATGGTGCCGCCGGAGGTGATTGAAGATCCGGAAGTGATCCGCTTTTTCGCACAGGCAGGGCAAAAAGCAAAATACGTGATTGGCACCTGTTACGGTTCGCTGATGCTGGGCACGGCCGGATTACTGAAAGGCAGAAGGGCAACCAGTAACAGTAATGTGGTGCCGATGCTGCCGGATGTCGGGGCTGTTGCCGTCGGCGGCAGTGATGTGGTGATAGACGATACTATCTACACCTCCGGCCCGGCTACCGGTTCGTTTGATGCCTCATTACTGGTGCTGAAAGCCCTGCGGGGTGAGGAACTGGCTGCGCTGGTTGAACTGGCGATTGAGTATGACCCGCGCCCGCCGTTCCGCACCGGTTCCCCGCAACTTGCAGGGCCGGAAATGACCGCCATATCACAAAGTATGACCGCGCCGCTGAACCGGCAATATCACGAAGCGGCGAAACGGGGCTATGCCCGTTATCAGCAGATGATTCAGGACTGACAAACCGGGTAATAGGCTGTCAAATCCGGGATTTTGTTTTTTATCCAGTC