Homologs in group_719

Help

6 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_02615 EHELCC_02615 100.0 Morganella morganii S2 kdpD K+-sensing histidine kinase KdpD
NLDBIP_00845 NLDBIP_00845 100.0 Morganella morganii S4 kdpD K+-sensing histidine kinase KdpD
LHKJJB_01190 LHKJJB_01190 100.0 Morganella morganii S3 kdpD K+-sensing histidine kinase KdpD
HKOGLL_01230 HKOGLL_01230 100.0 Morganella morganii S5 kdpD K+-sensing histidine kinase KdpD
F4V73_RS03910 F4V73_RS03910 30.1 Morganella psychrotolerans - Cu(+)/Ag(+) sensor histidine kinase
F4V73_RS04495 F4V73_RS04495 72.7 Morganella psychrotolerans - ATP-binding protein

Distribution of the homologs in the orthogroup group_719

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_719

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76339 5.3e-92 289 38 7 437 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q44007 7.65e-43 160 24 7 440 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q47457 3.47e-41 155 28 12 460 3 pcoS Probable sensor protein PcoS Escherichia coli
P0DMK6 3.97e-36 142 25 10 455 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q8XBY4 1.59e-35 140 29 5 299 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P77485 2.94e-35 139 27 11 436 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8FK37 3.41e-35 139 27 11 436 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
I1WSZ3 6.17e-35 138 25 10 455 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q02541 6.01e-33 133 31 6 245 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q9ZHD4 1.54e-26 115 28 6 306 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q9HV31 1.06e-20 97 27 5 282 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L8M0 2.83e-19 93 31 9 246 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P23545 5.24e-19 93 32 7 216 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
O69729 1.34e-18 91 26 11 314 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0AE82 3.26e-18 90 29 7 242 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 3.26e-18 90 29 7 242 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 3.26e-18 90 29 7 242 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P94414 8.54e-18 89 26 9 288 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q03228 8.63e-18 89 31 6 222 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0QR01 1.99e-17 87 28 5 227 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45336 2.05e-17 87 26 8 315 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q70FG9 4.45e-17 85 26 9 304 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
A3Q5L8 3.68e-16 84 25 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 4.57e-16 84 25 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 4.57e-16 84 25 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A0A0H3GPN8 4.85e-16 83 27 6 240 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
A0R3I7 8.44e-16 83 25 6 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9M7M1 1.28e-15 83 27 7 247 2 ETR1 Ethylene receptor Prunus persica
A1TEL6 1.29e-15 82 23 9 292 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P0A4I8 1.33e-15 82 27 7 274 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.33e-15 82 27 7 274 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P35164 1.47e-15 82 28 5 213 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q8ZPP5 1.59e-15 82 25 11 346 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9F8D7 2.54e-15 82 29 8 239 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q8CRA8 2.93e-15 81 26 8 225 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O34638 4.58e-15 80 27 8 252 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q49ZT9 5.71e-15 80 23 17 461 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8GP19 6.06e-15 80 25 9 291 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P52101 6.42e-15 80 26 11 286 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P30844 9.78e-15 79 28 9 245 1 basS Sensor protein BasS Escherichia coli (strain K12)
P48027 1.09e-14 80 28 8 238 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q8X524 1.32e-14 79 24 6 314 2 qseC Sensor protein QseC Escherichia coli O157:H7
P9WGK5 1.36e-14 79 26 7 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.36e-14 79 26 7 231 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.36e-14 79 26 7 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2YY04 1.6e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 1.61e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 1.64e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 1.64e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 1.64e-14 79 24 6 229 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 1.64e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 1.64e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 1.64e-14 79 24 6 229 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 1.64e-14 79 24 6 229 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q8XA47 2.12e-14 78 26 11 286 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P54883 2.77e-14 78 27 7 236 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P40719 2.89e-14 78 24 6 314 1 qseC Sensor protein QseC Escherichia coli (strain K12)
A1KHB8 3.38e-14 78 24 7 283 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 3.38e-14 78 24 7 283 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5HLN1 3.68e-14 77 25 8 225 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q45614 6.45e-14 77 25 8 225 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P9WGL1 6.84e-14 77 24 7 283 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 6.84e-14 77 24 7 283 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 6.84e-14 77 24 7 283 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
B1WYT4 8.72e-14 76 25 7 245 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A0QBR0 8.84e-14 77 23 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q55630 8.94e-14 76 23 7 246 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7A5H7 9.3e-14 77 25 5 212 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 9.3e-14 77 25 5 212 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9L523 1.06e-13 76 25 5 212 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 1.14e-13 76 25 5 212 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.14e-13 76 25 5 212 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.14e-13 76 25 5 212 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.14e-13 76 25 5 212 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4L6C5 1.35e-13 76 20 11 462 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q9Z5G7 1.47e-13 76 25 8 272 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P21865 1.99e-13 76 27 6 211 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q6GGK7 2.53e-13 75 25 5 212 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q742C0 2.69e-13 75 23 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A8Z553 2.73e-13 75 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 2.73e-13 75 23 16 469 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 2.73e-13 75 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 2.73e-13 75 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 2.73e-13 75 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
A0PWB3 2.89e-13 75 23 6 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P08401 2.95e-13 75 26 10 286 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q52969 3.01e-13 75 27 6 219 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q49XM6 3.17e-13 75 22 6 324 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CSL7 4.4e-13 74 26 9 246 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q47745 4.63e-13 74 27 11 340 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q5HPC4 4.69e-13 74 24 7 250 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GE72 5.14e-13 74 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
P14377 5.82e-13 74 24 5 225 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q8DPL8 5.83e-13 73 25 7 222 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 5.83e-13 73 25 7 222 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P36557 5.9e-13 73 28 8 242 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A3X0 6.32e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 6.32e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 6.32e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 6.32e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 6.32e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NV46 8.04e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 8.04e-13 73 23 16 469 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q93CB7 1.33e-12 73 25 12 316 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P18392 1.64e-12 72 24 7 274 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q41342 1.67e-12 73 27 7 250 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q55932 1.69e-12 72 26 5 213 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KLK7 1.7e-12 73 27 6 203 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2FWH7 1.74e-12 73 24 4 211 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
B7K3M6 1.79e-12 72 25 6 252 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8E3C7 1.91e-12 72 25 7 212 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
O81122 2.27e-12 72 27 8 247 2 ETR1 Ethylene receptor Malus domestica
Q2YZ23 2.45e-12 72 25 7 243 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8Z3P2 2.66e-12 72 28 6 238 3 qseC Sensor protein QseC Salmonella typhi
Q8DKG0 2.68e-12 72 26 10 258 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B7KFU0 2.89e-12 71 25 7 265 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q8ZLZ9 2.91e-12 72 28 6 238 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O48929 3.13e-12 72 27 7 250 2 ETR1 Ethylene receptor Nicotiana tabacum
P37894 3.35e-12 72 28 10 232 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q04804 3.94e-12 71 25 4 224 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P49333 4.01e-12 72 26 7 243 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
O82436 4.12e-12 72 27 9 252 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9CCJ1 4.32e-12 71 24 10 290 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q9SSY6 6.18e-12 71 27 9 250 2 ETR1 Ethylene receptor 1 Cucumis sativus
P58402 9.22e-12 71 24 4 246 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q9APE0 9.9e-12 70 26 6 226 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
O49230 1.11e-11 70 26 8 244 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q8DXQ8 1.17e-11 69 25 7 212 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9XH58 1.18e-11 70 27 8 247 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
O49187 1.21e-11 70 25 7 248 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q06240 1.25e-11 69 24 5 215 1 vanS Sensor protein VanS Enterococcus faecium
Q8X614 1.47e-11 69 24 5 225 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
B2J946 1.48e-11 69 25 10 276 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8Z7H3 1.66e-11 69 27 12 290 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P30847 1.67e-11 69 25 6 227 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P0DM80 1.67e-11 69 27 12 290 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 1.67e-11 69 27 12 290 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 1.67e-11 69 27 12 290 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 1.67e-11 69 27 12 290 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 1.67e-11 69 27 12 290 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 1.67e-11 69 27 12 290 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
A0A4P7TSF2 2.29e-11 69 26 11 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.29e-11 69 26 11 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.29e-11 69 26 11 292 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q9XH57 2.35e-11 69 27 9 248 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
O34989 2.8e-11 69 24 6 231 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q06067 4.06e-11 68 26 8 222 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P37461 4.77e-11 68 24 6 225 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KHI5 4.83e-11 68 28 7 223 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q86CZ2 4.87e-11 68 26 7 219 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
P40330 5.48e-11 68 26 5 243 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A0QTK3 6.02e-11 68 23 9 287 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGK9 6.31e-11 68 25 10 251 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 6.42e-11 68 25 10 251 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 6.42e-11 68 25 10 251 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P20169 6.44e-11 68 25 7 215 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P30855 6.88e-11 68 23 4 246 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q08408 6.98e-11 67 22 6 220 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P16575 7.77e-11 68 26 5 243 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9RQQ9 8.32e-11 68 28 6 230 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P94608 9.06e-11 67 23 4 229 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P08982 1.14e-10 67 25 10 281 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.14e-10 67 25 10 281 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
Q8Z332 1.38e-10 66 24 6 225 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P26762 1.67e-10 67 26 5 243 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P41406 1.68e-10 66 25 10 281 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P44578 2.15e-10 65 25 11 323 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZWL6 2.29e-10 66 27 9 248 2 ETR1 Ethylene receptor Passiflora edulis
Q8DMT2 2.54e-10 65 24 6 242 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0A4I6 2.55e-10 65 29 7 203 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 2.55e-10 65 29 7 203 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q869S5 2.95e-10 66 27 6 213 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q8DN03 3.5e-10 65 24 9 305 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 3.5e-10 65 24 9 305 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9RDT3 3.61e-10 65 26 8 207 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q08430 4.65e-10 65 25 8 226 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q54SP4 4.66e-10 65 28 10 247 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.93e-05 51 25 12 313 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q8CU87 4.98e-10 65 26 8 211 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 4.98e-10 65 26 8 211 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5AHA0 5.16e-10 65 28 9 210 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P72292 5.47e-10 65 25 8 250 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q7A215 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 8.41e-10 64 26 8 207 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 8.41e-10 64 26 8 207 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 8.41e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QD58 8.49e-10 64 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7MD16 1.03e-09 64 27 7 204 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 1.03e-09 64 27 7 204 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q54YZ9 1.13e-09 64 29 12 250 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q83RR1 1.35e-09 63 26 7 225 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 1.35e-09 63 26 7 225 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 1.38e-09 63 26 7 225 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
P51392 1.46e-09 63 27 6 217 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q95PI2 2.98e-09 63 25 9 232 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q6GKS6 3.11e-09 62 26 8 207 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P59342 4.2e-09 62 26 9 224 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P33113 4.26e-09 62 23 8 274 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P37739 4.26e-09 62 27 10 231 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
P0AEC5 4.39e-09 62 26 9 224 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 4.39e-09 62 26 9 224 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 4.39e-09 62 26 9 224 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q4LAJ8 5.07e-09 62 25 7 208 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
A5A2P0 5.21e-09 61 23 8 226 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P45608 5.88e-09 61 22 3 214 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q8X739 6.45e-09 61 26 7 225 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q06904 7.74e-09 60 24 6 213 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8ZPP6 1.18e-08 60 24 7 206 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9P896 1.26e-08 60 25 9 258 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
T2KMF4 1.36e-08 61 24 8 229 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q4A159 1.64e-08 60 25 7 208 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P54302 1.67e-08 60 25 9 223 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
O34206 1.86e-08 60 23 6 198 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q551X9 2.02e-08 60 29 9 231 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q87GU5 2.22e-08 60 25 8 220 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7D9K1 2.38e-08 59 28 3 186 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9HUI3 2.39e-08 60 28 9 215 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C0F6 2.9e-08 59 23 5 216 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 2.95e-08 59 23 5 216 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
B8AY75 3.07e-08 59 23 8 247 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
O32193 3.3e-08 59 20 6 285 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q3AYV8 3.66e-08 58 26 10 241 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P08400 3.97e-08 58 23 5 215 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q0DKM0 5.32e-08 58 23 9 247 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q53RH0 5.37e-08 58 23 8 251 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 5.37e-08 58 23 8 251 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P96368 5.72e-08 58 27 13 256 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P39664 5.91e-08 58 25 5 204 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q07737 6.34e-08 58 25 11 273 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
O14002 8.94e-08 58 24 7 214 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6X5X4 9.08e-08 58 22 8 240 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q1XD95 9.76e-08 58 23 7 217 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q44930 1.05e-07 57 25 8 209 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P16497 1.21e-07 57 26 7 216 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q2JWK9 1.7e-07 56 24 6 203 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
O31661 1.78e-07 57 25 7 212 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q38846 1.82e-07 57 24 8 251 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P0AEC4 2.07e-07 57 22 9 277 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.07e-07 57 22 9 277 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 2.15e-07 57 22 9 277 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P9WGL3 3.12e-07 56 26 9 227 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
E0X9C7 3.13e-07 56 24 6 201 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 0.000538 46 24 11 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P9WGL2 3.26e-07 56 26 9 227 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5W4E3 3.59e-07 56 24 6 201 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 0.000607 46 24 11 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9HZ47 3.7e-07 55 25 12 240 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45609 4.05e-07 55 24 7 216 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P26489 4.46e-07 55 26 8 224 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
E5KK10 4.61e-07 56 24 16 355 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q7BWI3 4.78e-07 55 25 7 204 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8G5E7 4.82e-07 55 28 8 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q2JKD9 5.21e-07 55 23 6 219 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3S4A7 5.41e-07 55 24 8 249 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q7U871 5.59e-07 55 26 10 241 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P42422 5.68e-07 55 23 10 261 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q3M8A7 6.3e-07 55 25 9 226 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YR50 6.82e-07 55 25 9 226 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B0JK50 7.51e-07 54 22 5 203 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7V113 8.43e-07 54 26 7 202 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A3PDI2 8.43e-07 54 27 8 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q9P7Q7 8.67e-07 55 24 7 226 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2BRQ6 1.1e-06 54 27 8 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q8FZ86 1.2e-06 54 22 8 240 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.23e-06 54 22 8 240 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q2T0V9 1.42e-06 54 25 9 217 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q57BR6 1.79e-06 54 21 8 246 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.79e-06 54 21 8 246 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.79e-06 54 21 8 246 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
A9M715 1.84e-06 54 22 8 240 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8YIM6 1.87e-06 54 21 8 246 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8CTI3 1.97e-06 53 24 9 245 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.97e-06 53 24 9 245 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O24972 2.26e-06 53 25 5 186 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
A5VRX4 2.35e-06 53 21 8 246 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P42245 2.53e-06 52 23 11 245 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
O33071 2.86e-06 53 24 8 250 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
A2C884 3.78e-06 52 24 10 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q49VK4 4.76e-06 52 25 8 215 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9LCC2 5.35e-06 52 23 12 294 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9C5U2 6.62e-06 52 21 8 302 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q03069 6.72e-06 51 25 7 222 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q4L482 7.75e-06 51 25 8 221 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
A1A696 8.33e-06 52 22 10 310 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A2WYI4 8.63e-06 52 22 10 310 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
Q54YH4 8.71e-06 52 23 7 234 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P9WGK7 9.11e-06 51 23 8 284 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 9.11e-06 51 23 8 284 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 9.11e-06 51 23 8 284 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5A599 9.36e-06 52 25 6 206 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P39764 9.47e-06 51 24 11 263 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q9SXL4 1.06e-05 52 20 5 267 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9HWR3 1.13e-05 51 26 8 200 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZS62 1.18e-05 51 20 9 250 2 PHYB1 Phytochrome B1 Solanum lycopersicum
Q6GIT7 1.27e-05 50 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.33e-05 50 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.33e-05 50 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.33e-05 50 23 10 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.33e-05 50 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.33e-05 50 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P34094 1.51e-05 51 21 9 250 3 PHYB Phytochrome B Solanum tuberosum
Q9RZA4 1.51e-05 51 21 9 291 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A1A697 1.66e-05 51 22 8 277 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q7A6Z3 1.7e-05 50 23 6 216 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 1.7e-05 50 23 6 216 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 1.7e-05 50 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 1.7e-05 50 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 1.7e-05 50 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
O31671 1.74e-05 50 22 6 215 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q04943 1.8e-05 50 26 9 230 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q840P7 3.19e-05 49 23 10 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q8KIY1 3.31e-05 50 24 8 202 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q5HHW5 3.46e-05 49 23 10 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 3.46e-05 49 23 10 263 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 3.46e-05 49 23 10 263 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q8NXR5 3.59e-05 49 23 6 216 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 3.59e-05 49 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
A8Z182 3.69e-05 49 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 3.69e-05 49 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 3.69e-05 49 23 6 216 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 3.69e-05 49 23 6 216 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 3.69e-05 49 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q2YSS1 3.89e-05 49 23 6 216 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q82EB2 3.91e-05 49 24 15 298 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P58356 4.12e-05 50 24 8 203 3 torS Sensor protein TorS Escherichia coli O157:H7
Q55168 4.59e-05 49 23 9 250 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74111 5.56e-05 49 24 10 241 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A7HD43 6.09e-05 48 25 8 221 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
P39453 6.86e-05 49 24 8 203 1 torS Sensor protein TorS Escherichia coli (strain K12)
P29130 7.05e-05 49 20 8 246 2 PHYB Phytochrome B Nicotiana tabacum
Q54W36 7.29e-05 49 25 3 145 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P58662 7.47e-05 48 25 8 216 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O06979 7.99e-05 48 21 6 218 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
Q6GJ10 8.95e-05 48 23 7 217 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q8CTL4 0.000123 47 23 8 219 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 0.000123 47 23 8 219 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q56128 0.000232 47 25 8 216 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
A3BE68 0.000448 46 25 4 141 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 0.000472 46 25 4 141 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q10MG9 0.000533 46 20 9 242 2 PHYB Phytochrome B Oryza sativa subsp. japonica
A2XFW2 0.000537 46 20 9 242 3 PHYB Phytochrome B Oryza sativa subsp. indica
P33639 0.000549 46 23 10 236 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10955 0.000808 45 23 7 211 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P0AFB7 0.000891 45 22 12 266 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 0.000891 45 22 12 266 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 0.000891 45 22 12 266 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
P45670 0.001 45 20 8 226 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02145
Feature type CDS
Gene kdpD
Product K+-sensing histidine kinase KdpD
Location 118401 - 119777 (strand: 1)
Length 1377 (nucleotides) / 458 (amino acids)
In genomic island -

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_719
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Protein Sequence

MMKIRSLRFKIVSLFMLLMVANAGFVTLILYHSLKNELASKDDDILINRADQLAKLIVSGIDIKSLPVYFRRMMDMRQDVIKIADADNHVIVDTNPEITLNTRDKLNYPDSQETPLISYQNTDDNMPVSVVNFEIQAPEGKLYVTLAKRSVDRSSVLRGYLQQSLIVSVIAILLMVVFSIWLIRRGLQDITHLSRITAKTDLHSLGQTVDISRLPDELKSLGDSLNIMRSRLKNDFVRLTQLADDLAHELRTPINAIKIQNEITLQKTRTADEYEAIIASNTEELDKLAKIIQNILFIARAENKNINLKRETIVVSELVEDIYELLAFYADEKNIRLVNKISDVTVSADKVLLMQIMVNVVSNAVKYSYENTEVIACAENNHGSTVISVMNKGDVVANSEQVFTRFWRGDNARTSEGSGLGLSIVQAITELHSGEVRFERTGSYNTVTLIFPDTHPLS

Flanking regions ( +/- flanking 50bp)

AAATTAATTGAAACTGTCCGTGGTATGGGATACCGCCTGAACGGATCGGAATGATGAAAATACGCTCACTGAGATTTAAAATTGTATCATTATTTATGTTGCTGATGGTGGCAAACGCAGGTTTTGTCACACTGATCCTTTATCACTCTCTGAAAAATGAACTTGCCTCAAAAGATGATGACATCCTGATTAACCGTGCCGACCAACTGGCTAAACTGATTGTCAGTGGTATTGATATTAAATCGTTACCTGTTTATTTCCGGCGGATGATGGATATGCGGCAGGATGTTATTAAGATAGCAGATGCTGATAATCACGTTATTGTGGATACCAACCCGGAGATAACCCTGAATACCCGGGACAAACTTAATTATCCGGATAGTCAGGAAACGCCTTTAATCTCATACCAGAATACGGATGATAACATGCCGGTTTCCGTGGTTAATTTTGAGATTCAGGCTCCTGAAGGTAAATTATATGTCACTCTGGCAAAGCGTTCGGTTGATCGCAGCAGTGTTTTACGCGGATATTTACAGCAAAGTCTGATTGTTTCCGTTATTGCTATTCTTCTGATGGTCGTCTTCAGTATATGGCTTATCCGCCGGGGATTGCAGGATATTACGCATCTCAGCCGGATCACCGCGAAAACAGATCTGCACTCTCTGGGACAGACGGTGGATATCAGCCGCTTACCGGATGAACTGAAAAGTTTGGGTGATTCATTGAATATCATGCGCTCACGGCTGAAAAATGATTTTGTCCGGCTGACACAACTTGCGGATGATTTAGCGCATGAATTAAGAACACCCATTAATGCCATTAAAATTCAGAATGAAATCACATTACAAAAAACGCGCACTGCGGATGAGTATGAAGCGATTATCGCCAGCAATACAGAAGAGCTGGATAAACTGGCAAAAATAATACAAAACATTCTGTTTATCGCCAGAGCAGAGAATAAAAATATTAATCTGAAGCGGGAAACCATCGTTGTTTCTGAGCTGGTTGAGGATATTTATGAGTTACTGGCATTTTATGCCGATGAGAAAAATATCCGGCTGGTTAATAAAATATCGGATGTGACGGTATCAGCAGACAAAGTATTGCTGATGCAGATTATGGTTAATGTTGTGTCAAATGCGGTTAAATATTCATATGAAAATACGGAGGTTATTGCCTGTGCAGAAAATAATCATGGCAGCACCGTCATTTCAGTGATGAACAAAGGTGATGTTGTTGCAAACAGTGAACAGGTCTTTACCCGCTTTTGGCGCGGAGATAATGCGAGAACGTCAGAAGGAAGCGGGCTGGGCTTATCGATTGTTCAGGCAATAACAGAATTGCATTCAGGTGAGGTCAGATTTGAACGTACCGGGTCATATAACACGGTAACCTTAATTTTTCCGGATACTCATCCCCTTTCATGACAAATTTGTCATCGTCCTGTCAGCTTTAAATTCAGATTATGCGGTATAAC