Homologs in group_719

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02145 FBDBKF_02145 30.1 Morganella morganii S1 kdpD K+-sensing histidine kinase KdpD
EHELCC_02615 EHELCC_02615 30.1 Morganella morganii S2 kdpD K+-sensing histidine kinase KdpD
NLDBIP_00845 NLDBIP_00845 30.1 Morganella morganii S4 kdpD K+-sensing histidine kinase KdpD
LHKJJB_01190 LHKJJB_01190 30.1 Morganella morganii S3 kdpD K+-sensing histidine kinase KdpD
HKOGLL_01230 HKOGLL_01230 30.1 Morganella morganii S5 kdpD K+-sensing histidine kinase KdpD
F4V73_RS04495 F4V73_RS04495 30.6 Morganella psychrotolerans - ATP-binding protein

Distribution of the homologs in the orthogroup group_719

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_719

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZHD4 0.0 531 55 6 487 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q8XBY4 0.0 519 55 5 485 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P77485 0.0 517 55 3 479 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8FK37 8.75e-180 514 55 3 479 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q02541 3.57e-75 246 35 8 432 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q47457 3.46e-61 209 29 7 455 3 pcoS Probable sensor protein PcoS Escherichia coli
I1WSZ3 8.45e-59 203 38 2 273 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P0DMK6 3.37e-58 201 38 2 273 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q44007 4.3e-55 193 27 6 458 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P23545 1.33e-32 134 34 7 250 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P76339 1.35e-32 132 28 6 305 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P45336 1.52e-29 123 25 17 468 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5HPC4 2.13e-28 120 27 4 313 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0A4I8 3.39e-28 119 29 3 271 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 3.39e-28 119 29 3 271 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8CSL7 4.32e-28 119 27 4 313 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A0W5 2.07e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.07e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.07e-27 117 25 12 458 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.07e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.07e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.07e-27 117 25 12 458 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.07e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 2.39e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 2.82e-27 117 25 12 458 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q8DPL8 4.68e-27 116 30 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 4.68e-27 116 30 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9HV31 1.02e-26 115 31 4 262 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AE82 1.36e-25 112 29 7 275 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.36e-25 112 29 7 275 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.36e-25 112 29 7 275 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P30847 1.41e-25 112 29 3 255 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q49XM6 2.06e-25 111 27 3 288 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P35164 2.06e-25 112 32 5 227 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
O69729 3.96e-25 110 26 12 354 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H3GPN8 9.44e-25 109 29 7 275 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q7A5H7 1.35e-24 110 33 6 227 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.35e-24 110 33 6 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWF3 1.71e-24 110 33 7 230 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.71e-24 110 33 7 230 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.71e-24 110 33 7 230 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.71e-24 110 33 7 230 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CU87 1.8e-24 110 31 5 222 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.8e-24 110 31 5 222 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9L523 1.8e-24 110 33 7 230 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6GGK7 2.21e-24 109 33 7 230 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q742C0 3.01e-24 108 24 14 474 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8CRA8 3.06e-24 108 30 6 240 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q45614 4.24e-24 108 31 4 210 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q8GP19 5.83e-24 107 29 9 291 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q4A159 6.22e-24 108 31 5 222 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A0QR01 6.88e-24 106 27 2 218 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4L6C5 8.09e-24 107 25 10 405 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
A0QBR0 8.78e-24 107 24 14 475 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q5HLN1 1.86e-23 105 29 6 240 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAJ8 2.44e-23 106 31 6 223 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
P45609 2.56e-23 105 33 6 221 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q9RDT3 3.04e-23 104 30 3 220 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
A6QD58 6.09e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q9Z5G7 6.53e-23 104 27 8 315 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q7A215 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 6.61e-23 105 30 3 220 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 6.61e-23 105 30 3 220 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 6.61e-23 105 30 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P08400 6.84e-23 103 32 4 220 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P9WGL1 7.51e-23 104 26 9 322 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 7.51e-23 104 26 9 322 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 7.51e-23 104 26 9 322 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KHB8 9.21e-23 104 26 9 322 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 9.21e-23 104 26 9 322 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6GKS6 2.46e-22 103 29 3 220 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
A1TEL6 2.83e-22 102 26 8 325 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P45608 4.33e-22 101 30 3 218 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q55932 6.36e-22 101 27 5 223 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5A2P0 1e-21 100 30 7 226 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A8Z553 1.12e-21 100 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 1.12e-21 100 30 6 246 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 1.12e-21 100 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 1.12e-21 100 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 1.12e-21 100 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q8DXQ8 1.77e-21 99 27 4 233 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q7A3X0 2.08e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.08e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.08e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.08e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.08e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8E3C7 2.15e-21 99 27 4 233 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8NV46 3.54e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 3.54e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q1B3X9 3.79e-21 99 26 10 332 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 3.79e-21 99 26 10 332 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 4.05e-21 99 26 10 332 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
A0PWB3 4.2e-21 99 24 12 416 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q2YZ23 4.3e-21 99 30 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0R3I7 7.2e-21 98 28 6 242 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4L8M0 1.21e-20 97 25 7 293 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q49ZT9 2.67e-20 96 25 3 243 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GE72 6.46e-20 95 29 6 246 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
P0DMC6 7.5e-20 96 26 7 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 7.5e-20 96 26 7 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P58662 7.63e-20 96 27 7 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4I6 1.43e-19 94 28 2 210 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.43e-19 94 28 2 210 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P96368 1.47e-19 94 27 11 360 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK5 1.53e-19 94 27 3 221 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.53e-19 94 27 3 221 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.53e-19 94 27 3 221 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q56128 2.26e-19 95 26 7 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
B7KFU0 5.59e-19 92 27 9 282 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P54883 1.16e-18 91 27 3 219 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q06240 1.42e-18 90 25 4 221 1 vanS Sensor protein VanS Enterococcus faecium
Q07737 1.88e-18 91 23 10 390 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
B0JK50 4.8e-18 89 24 10 282 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
O34638 6.34e-18 89 27 6 253 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
P40719 9.22e-18 89 27 13 322 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P18392 2.34e-17 87 28 4 241 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q93CB7 2.77e-17 87 22 9 317 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8X524 4.62e-17 86 31 10 269 2 qseC Sensor protein QseC Escherichia coli O157:H7
B7K3M6 6.06e-17 85 26 7 244 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P23621 6.75e-17 86 28 3 220 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KHI5 7.24e-17 87 29 4 216 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q08408 7.55e-17 86 28 5 228 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P9WGK9 9.65e-17 86 23 7 284 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 9.83e-17 86 23 7 284 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 9.83e-17 86 23 7 284 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1WYT4 1.31e-16 84 26 7 224 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A0QTK3 2.38e-16 85 23 7 285 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P16497 4.65e-16 84 30 6 220 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q9CCJ1 4.82e-16 84 22 11 350 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
T2KMF4 5.97e-16 84 26 4 234 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q5A599 7.21e-16 84 26 4 220 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9M7M1 1.07e-15 83 29 8 234 2 ETR1 Ethylene receptor Prunus persica
P72292 1.44e-15 82 24 9 316 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P94414 1.55e-15 82 26 12 317 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P74111 2.46e-15 82 28 5 220 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DKG0 2.83e-15 82 29 9 238 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8D5Z6 3.82e-15 81 25 7 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8KIY1 4.02e-15 81 27 8 244 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 3.41e-09 63 27 10 238 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q47745 4.19e-15 80 24 5 305 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q7MD16 4.47e-15 81 24 6 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q54SP4 5.09e-15 81 25 3 219 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 4.91e-11 68 23 7 270 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
O32193 5.9e-15 80 25 10 309 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P39664 6.57e-15 80 29 6 231 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8ZLZ9 7.4e-15 80 29 6 232 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 7.67e-15 80 29 6 232 3 qseC Sensor protein QseC Salmonella typhi
P71380 1.27e-14 79 26 4 242 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42245 1.79e-14 77 25 5 220 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P54302 1.88e-14 79 26 9 236 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P20169 1.89e-14 79 25 6 221 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DMT2 1.95e-14 78 25 5 225 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B2J946 2.24e-14 78 26 8 233 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
O81122 2.48e-14 79 28 6 228 2 ETR1 Ethylene receptor Malus domestica
Q06904 2.68e-14 77 25 5 226 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8YR50 3.34e-14 77 28 9 230 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P30844 3.89e-14 77 26 9 283 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q53RH0 4.84e-14 78 26 6 238 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 4.84e-14 78 26 6 238 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9XH57 4.9e-14 78 25 5 240 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q3M8A7 4.94e-14 77 28 9 230 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O49230 5e-14 78 26 6 225 2 ETR1 Ethylene receptor 1 Brassica oleracea
O34989 5.68e-14 77 25 4 219 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P37894 5.79e-14 78 26 12 317 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P49333 6.2e-14 77 28 8 230 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q70FG9 6.48e-14 76 24 9 303 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q9XH58 6.6e-14 77 26 7 240 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P94608 9.98e-14 77 24 3 210 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O14002 1.05e-13 77 27 7 219 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q04804 1.14e-13 76 24 9 285 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54YZ9 1.29e-13 77 23 9 293 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YH4 1.43e-13 77 28 9 226 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
E0X9C7 2.49e-13 76 27 8 238 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 2.27e-05 50 25 8 237 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q55630 3.84e-13 74 23 7 247 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2JKD9 4.1e-13 74 29 12 266 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q87GU5 7.38e-13 74 24 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5W4E3 8.23e-13 74 27 8 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.21e-05 50 25 8 237 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9KLK7 8.34e-13 74 24 6 227 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P36557 8.85e-13 72 25 10 308 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPP5 9.24e-13 74 24 7 245 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9RQQ9 1.12e-12 73 23 3 219 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q52969 1.67e-12 73 26 6 230 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q8THF6 1.72e-12 73 35 0 101 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O82436 3.76e-12 72 27 8 234 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9APE0 4.21e-12 71 27 6 216 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
O34206 5.42e-12 71 26 7 225 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P08401 5.54e-12 71 22 12 388 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q9SSY6 5.94e-12 71 27 9 236 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q1XD95 7.36e-12 71 24 6 228 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q869S5 7.84e-12 71 25 5 218 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q41342 8.68e-12 71 24 6 228 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9KM66 9.22e-12 70 26 11 235 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2JWK9 9.27e-12 70 26 9 240 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q38846 1.08e-11 70 26 7 231 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P0C0F7 1.56e-11 70 22 11 336 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 1.57e-11 70 22 11 336 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A0A4P7TSF2 1.73e-11 69 27 8 248 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.73e-11 69 27 8 248 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.73e-11 69 27 8 248 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q9ZWL6 1.79e-11 70 26 7 234 2 ETR1 Ethylene receptor Passiflora edulis
P58402 1.8e-11 70 24 8 230 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q86CZ2 1.86e-11 70 24 5 255 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q03228 1.93e-11 69 22 5 233 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q551X9 1.97e-11 70 26 4 220 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q840P7 2.23e-11 68 22 7 292 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q5HHW5 2.36e-11 68 22 7 292 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 2.36e-11 68 22 7 292 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 2.36e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
O48929 2.39e-11 69 25 7 234 2 ETR1 Ethylene receptor Nicotiana tabacum
Q7A1J2 2.42e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 2.42e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 2.42e-11 68 22 7 292 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 2.42e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 2.42e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 2.51e-11 68 22 7 292 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q54RP6 2.74e-11 69 26 6 211 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q9HUI3 2.9e-11 69 28 5 217 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CTI3 4.01e-11 67 23 6 248 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 4.01e-11 67 23 6 248 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O49187 4.45e-11 68 25 8 234 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q0DKM0 4.49e-11 68 25 6 228 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q2T0V9 4.9e-11 68 21 10 323 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8X739 5.09e-11 68 23 11 296 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P51392 5.57e-11 68 25 6 228 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
P23837 6.3e-11 67 23 11 296 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 6.47e-11 67 23 11 296 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83RR1 6.76e-11 67 23 11 296 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8DMC5 7.04e-11 67 26 8 232 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P48027 8.06e-11 68 24 5 226 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P30855 9.29e-11 68 24 8 230 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q49VK4 1.04e-10 66 28 8 195 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P08982 1.26e-10 67 25 8 248 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.26e-10 67 25 8 248 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P44578 1.29e-10 66 25 5 195 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5AHA0 1.66e-10 67 27 9 245 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9F8D7 1.67e-10 67 20 17 495 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
B8AY75 1.96e-10 66 24 6 228 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
P59342 2.87e-10 66 23 9 302 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0AEC5 3.08e-10 66 23 9 302 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 3.08e-10 66 23 9 302 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 3.08e-10 66 23 9 302 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q2FWH7 3.65e-10 66 24 7 231 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P39764 4.59e-10 65 25 8 269 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q8X614 4.6e-10 65 25 4 221 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q04943 5.11e-10 65 26 10 265 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P14377 5.43e-10 65 25 4 221 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
A7HD43 5.46e-10 64 25 7 253 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
O31671 6.45e-10 64 27 8 226 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q44930 6.77e-10 64 24 9 267 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q9SXL4 7.32e-10 65 21 4 254 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q0IBF4 7.5e-10 64 27 9 218 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P39453 8.67e-10 65 27 9 259 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8Z332 1.05e-09 63 25 5 224 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P58356 1.2e-09 64 27 9 259 3 torS Sensor protein TorS Escherichia coli O157:H7
P41406 1.26e-09 63 25 8 248 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
O31661 1.47e-09 63 27 8 225 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q92H24 1.48e-09 63 24 12 301 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P73276 1.77e-09 63 27 8 239 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
E5KK10 1.91e-09 63 23 8 252 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q3AYV8 2.02e-09 62 27 8 220 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P37461 3.07e-09 62 25 5 224 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16575 3.12e-09 63 25 6 212 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7BWI3 4.1e-09 62 27 10 218 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3S4A7 4.35e-09 62 25 8 254 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9HWR3 4.44e-09 62 24 5 221 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4UMD4 4.63e-09 62 23 13 358 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7V113 6.07e-09 61 28 12 221 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q54U87 6.22e-09 62 22 6 227 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
P0DM80 7.34e-09 61 21 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 7.34e-09 61 21 9 294 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 7.34e-09 61 21 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
Q8Z7H3 7.34e-09 61 21 10 295 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
D0ZV89 7.34e-09 61 21 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 7.34e-09 61 21 9 294 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 7.34e-09 61 21 9 294 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
P40330 8.02e-09 62 24 4 210 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P26762 8.16e-09 62 24 4 210 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9HZ47 8.68e-09 61 22 8 270 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7U871 1.17e-08 60 26 8 220 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q68WC5 1.23e-08 60 22 11 370 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8G5E7 1.38e-08 60 26 10 220 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
P52101 1.46e-08 60 24 6 233 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q4L482 1.53e-08 60 25 9 220 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
Q8XA47 1.66e-08 60 24 6 233 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q9I0I2 1.83e-08 60 23 10 250 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9C5U1 2.03e-08 60 22 7 261 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
A2BRQ6 2.12e-08 59 27 10 209 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q9P896 2.5e-08 60 25 11 251 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P58363 2.63e-08 60 22 6 225 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q9ZCU7 2.64e-08 60 22 11 370 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
P0AEC4 2.72e-08 60 22 6 225 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.72e-08 60 22 6 225 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
A6X5X4 3.12e-08 60 26 10 255 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P23222 3.84e-08 59 23 7 217 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7A6Z3 4.56e-08 58 22 5 190 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 4.56e-08 58 22 5 190 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 4.56e-08 58 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 4.56e-08 58 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 4.56e-08 58 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q95PI2 4.85e-08 59 25 7 226 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
A3PDI2 5.26e-08 58 27 9 207 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q31AE8 8.73e-08 57 27 10 207 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q8YIM6 9.16e-08 58 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BR6 9.48e-08 58 25 9 255 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 9.48e-08 58 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 9.48e-08 58 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q02482 1.01e-07 58 30 2 111 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
A1A696 1.2e-07 58 21 7 267 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q7V6P7 1.24e-07 57 24 6 216 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q06067 1.27e-07 57 26 6 203 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q2YSS1 1.28e-07 57 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A2WYI4 1.36e-07 57 21 7 267 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
Q7D9K1 1.36e-07 57 26 5 164 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A8Z182 1.46e-07 57 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 1.46e-07 57 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 1.46e-07 57 22 5 190 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 1.46e-07 57 22 5 190 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 1.46e-07 57 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 1.53e-07 57 22 5 190 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 1.53e-07 57 22 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
A2C884 1.69e-07 56 24 6 216 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q8CTL4 3.04e-07 55 22 9 266 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 3.04e-07 55 22 9 266 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55168 4.93e-07 55 22 9 226 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55E44 5.16e-07 56 26 2 146 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P26489 5.41e-07 55 23 9 265 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9R6X3 7.11e-07 55 27 7 188 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P21865 7.21e-07 55 26 8 225 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q8FZ86 8.7e-07 55 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 8.85e-07 55 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q9KM24 1e-06 54 27 7 218 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q54W36 1.14e-06 55 24 2 153 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
A5VRX4 1.32e-06 54 25 9 255 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P33113 1.37e-06 54 29 1 92 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q08430 1.6e-06 53 22 7 231 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
A7N6S2 1.63e-06 54 23 11 241 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q82EB2 1.79e-06 53 29 9 195 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q54Q69 1.83e-06 54 21 5 259 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P96601 1.91e-06 53 29 3 107 3 dctS Probable C4-dicarboxylate sensor kinase Bacillus subtilis (strain 168)
A1A697 2.28e-06 53 24 6 224 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A9M715 2.72e-06 53 24 8 255 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P9WGK7 3.04e-06 53 22 13 334 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 3.04e-06 53 22 13 334 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 3.04e-06 53 22 13 334 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P09431 5.72e-06 52 26 12 235 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54444 6.48e-06 52 22 7 238 3 yrkQ Sensor histidine kinase YrkQ Bacillus subtilis (strain 168)
Q6GJ10 9.54e-06 51 21 5 190 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q03069 1.21e-05 50 21 7 227 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q9C5U2 1.27e-05 51 22 7 251 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
P10047 2e-05 50 24 6 229 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
A3BE68 2.17e-05 50 26 4 166 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 2.42e-05 50 26 4 166 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q1RJB3 2.62e-05 50 27 13 271 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
O06979 2.75e-05 49 30 3 106 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
Q9ZEP3 3.05e-05 50 28 9 193 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8DN03 3.2e-05 50 31 3 83 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 3.2e-05 50 31 3 83 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P33529 3.72e-05 50 22 7 240 2 PHY Phytochrome Mougeotia scalaris
Q9P7Q7 4.57e-05 50 22 6 225 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WGL2 5.08e-05 49 26 9 217 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 5.25e-05 49 26 9 217 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P39928 5.91e-05 49 27 4 152 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O22267 7.81e-05 49 20 6 253 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q9LCC2 0.000109 48 27 4 122 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5A872 0.000177 48 24 3 147 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P30663 0.000348 46 22 3 118 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
P37739 0.0005 46 23 8 251 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
P13633 0.000609 46 24 5 221 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
Q9I4F8 0.000784 45 21 14 468 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34971 0.001 45 23 6 176 3 kdpD Sensor protein KdpD Rathayibacter rathayi

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03910
Feature type CDS
Gene -
Product Cu(+)/Ag(+) sensor histidine kinase
Location 828333 - 829730 (strand: -1)
Length 1398 (nucleotides) / 465 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_719
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF21085 CusS sensor domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07644 two-component system, OmpR family, heavy metal sensor histidine kinase CusS [EC:2.7.13.3] Two-component system Imipenem resistance, repression of porin OprD

Protein Sequence

MKNKPCRPFSLATRLTFFISLATVAAFVAFTWIMLHSVEKHFAQQDDSDLRQISATINSILQDNSESESQRLGTLNSVLNNYPNIAAILLDKNNNVLFRSEKGPDFNVIIDSPEFAQKSYGDRVFRWEKENDPTAYRILITPAGAHYTLLISLSINFHLHYIDELKHNLMMTASAISLLIIIIVLFAVYTGHQPLRSVSDKIKNITSEDLTVRLDPENVPIELAQLVISFNHMLGRIEDVFTRQANFSADIAHEIRTPITNLLTQTEIALSQPRTTKELEDILDSGMEEYHRLAKMVTDMLFLAQADNNQLIPEQSRLNLHTEAMKVIDYYDIVAEEQGISLMLTGDPAYINGDSAMIRRVINNLLSNAVRYTPPEGTITIAIKQEDNLITLMVKNPGTPIAAEHLPRLFDRLYRVDPARRRNGEGSGIGLAIVKSIVTAHHGKIQAESDEDSTRFIISFPVITD

Flanking regions ( +/- flanking 50bp)

ACTGATCCATACCATCCGCAGTGTCGGTTATGTCCTTGAGATCCCCGATGATAAAAAATAAGCCCTGCCGCCCCTTTTCCCTTGCCACCCGGCTGACCTTTTTTATCAGCCTGGCAACAGTGGCTGCCTTTGTCGCATTCACCTGGATAATGCTTCATTCCGTGGAGAAACATTTTGCCCAGCAGGATGACAGTGACCTGCGGCAAATCAGTGCAACAATTAACAGTATTCTTCAGGACAACAGTGAATCAGAATCTCAGCGGCTCGGTACACTGAATTCAGTCCTGAATAATTACCCGAACATTGCGGCGATCTTGCTTGATAAAAACAATAATGTTCTGTTCCGATCAGAGAAAGGTCCTGATTTTAATGTCATTATTGACTCTCCGGAATTCGCTCAGAAATCATATGGTGACCGGGTATTCCGTTGGGAAAAAGAGAATGACCCAACCGCCTACCGCATCCTTATCACCCCGGCGGGTGCGCACTATACCTTATTAATTTCACTCTCAATCAATTTCCATCTGCATTACATTGATGAACTGAAACATAATTTAATGATGACAGCATCCGCCATCAGTCTGCTGATTATCATCATTGTGTTATTTGCGGTTTATACCGGGCATCAGCCGCTGCGCAGTGTCAGCGATAAAATTAAAAATATTACCTCTGAAGATTTAACTGTCAGGTTAGATCCGGAAAATGTGCCGATTGAATTGGCACAATTAGTTATTTCGTTTAACCATATGCTCGGCAGGATAGAAGATGTCTTTACCCGCCAGGCTAATTTCTCTGCGGATATTGCGCATGAAATACGCACGCCTATTACCAACCTGCTGACACAAACAGAAATTGCATTAAGTCAGCCGCGTACCACAAAAGAGCTGGAGGATATTCTGGACTCCGGTATGGAGGAATATCACCGGCTGGCTAAAATGGTGACAGATATGCTTTTTCTGGCGCAGGCCGATAATAATCAGCTTATTCCGGAGCAATCCAGGCTGAATTTGCACACTGAAGCCATGAAGGTAATTGATTATTACGATATCGTCGCCGAAGAGCAGGGAATTTCATTAATGCTGACAGGCGACCCTGCATATATTAATGGTGATTCAGCGATGATCCGCAGGGTTATTAATAATTTACTCTCCAATGCCGTCCGCTATACCCCGCCGGAAGGCACTATTACTATTGCAATAAAACAAGAAGATAATCTTATTACACTGATGGTAAAAAACCCCGGAACGCCGATTGCAGCAGAGCACCTTCCCCGCCTGTTTGACCGGTTGTACCGGGTTGACCCTGCAAGGCGGCGCAATGGTGAAGGCAGCGGCATCGGGCTGGCGATTGTCAAATCCATTGTTACCGCTCATCACGGCAAAATACAGGCTGAATCTGATGAAGATTCCACCCGGTTTATTATTTCATTCCCTGTTATTACTGACTGAATGCAGCCAACGAACCAGCAGTTTGAATAAATAAGGGTATATGACAAACA