Homologs in group_93

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10955 FBDBKF_10955 68.9 Morganella morganii S1 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
FBDBKF_13655 FBDBKF_13655 35.1 Morganella morganii S1 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
EHELCC_05270 EHELCC_05270 68.9 Morganella morganii S2 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
EHELCC_11325 EHELCC_11325 35.1 Morganella morganii S2 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
NLDBIP_05590 NLDBIP_05590 68.9 Morganella morganii S4 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
NLDBIP_11670 NLDBIP_11670 35.1 Morganella morganii S4 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
LHKJJB_02470 LHKJJB_02470 68.9 Morganella morganii S3 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
LHKJJB_11530 LHKJJB_11530 35.1 Morganella morganii S3 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
HKOGLL_10140 HKOGLL_10140 35.1 Morganella morganii S5 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
HKOGLL_15850 HKOGLL_15850 68.9 Morganella morganii S5 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
PMI_RS07480 PMI_RS07480 51.4 Proteus mirabilis HI4320 - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_93

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_93

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57213 6e-15 68 47 1 69 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q72FW5 8.44e-12 61 44 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q83LN2 2.68e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q0T6A8 2.68e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q9HYG4 2.69e-11 60 49 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6CYU2 2.78e-11 59 47 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z3I7 2.79e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q02QT1 2.83e-11 59 49 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P0AAI1 3.39e-11 59 46 1 69 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 3.39e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q0TJC1 3.46e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8KZQ6 3.56e-11 59 47 1 69 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q88R93 3.63e-11 59 47 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1RDS4 3.76e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 3.76e-11 59 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q4K441 3.93e-11 59 47 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1IGL4 5.13e-11 59 47 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q9PR37 5.18e-11 59 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q30V33 5.55e-11 59 42 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q04G50 5.8e-11 59 40 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q14Q07 6.15e-11 59 41 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q3K506 6.94e-11 58 47 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3M5J9 7.29e-11 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O31711 9.37e-11 58 40 1 74 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q21XJ9 9.62e-11 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q665B6 1.08e-10 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDR0 1.1e-10 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.1e-10 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.1e-10 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1QE80 1.12e-10 58 42 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8FJ95 1.16e-10 58 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8PHQ3 1.94e-10 57 44 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q48CA0 2.43e-10 57 47 1 69 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8EUR3 2.91e-10 57 42 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Malacoplasma penetrans (strain HF-2)
A0A0H2ZLL3 3.04e-10 57 39 1 73 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4ZLS1 3.36e-10 57 47 1 69 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q87UI3 3.46e-10 57 47 1 69 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0A9U2 3.68e-10 57 42 1 63 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 8.59e-06 44 40 1 60 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 3.68e-10 57 42 1 63 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 8.59e-06 44 40 1 60 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q1LNM0 4.67e-10 56 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q73YZ5 6.65e-10 55 40 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 6.65e-10 55 40 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q4L5B3 6.67e-10 56 40 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q0K9I2 6.86e-10 56 46 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8NR42 7.51e-10 55 46 2 71 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O07016 7.61e-10 56 36 0 68 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q1MQ44 8.29e-10 56 42 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q8XZQ4 8.81e-10 55 47 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5L222 9.32e-10 55 38 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q46YX6 1.11e-09 55 40 0 67 3 nodI Nod factor export ATP-binding protein I Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q110U3 1.14e-09 55 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
P45171 1.21e-09 55 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JUX4 1.21e-09 55 40 1 72 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P50332 1.21e-09 55 39 0 68 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q9JZW0 1.29e-09 55 40 1 72 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4QK57 1.33e-09 55 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q6LV32 1.38e-09 55 38 1 71 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q0T5R2 1.47e-09 55 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
A1TXH7 1.51e-09 55 40 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P56344 1.65e-09 54 43 1 69 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q5HQ70 1.66e-09 55 38 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8RI39 1.67e-09 55 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8CPN0 1.78e-09 55 38 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q49WM4 1.8e-09 55 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WKG4 1.81e-09 54 41 1 72 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
A0LM36 1.82e-09 55 44 2 69 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8T674 1.84e-09 55 39 1 68 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
Q8U648 2.14e-09 54 43 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q32EY4 2.38e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1RD28 2.38e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 2.38e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 2.5e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 2.5e-09 54 39 1 69 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 2.5e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 2.5e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 2.5e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q7A169 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 2.51e-09 54 37 1 70 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 2.51e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q2RPB4 2.53e-09 54 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8RGC8 2.59e-09 54 40 1 70 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2K8C8 3.15e-09 54 43 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q46ZU5 3.43e-09 54 44 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2NK31 3.49e-09 54 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q9KS33 3.52e-09 54 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6DB87 3.63e-09 54 33 0 68 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q07LQ4 3.64e-09 53 42 2 71 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
P72335 3.98e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q9CMS0 4.1e-09 53 40 1 71 3 modC Molybdenum import ATP-binding protein ModC Pasteurella multocida (strain Pm70)
P23703 4.1e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P36879 4.13e-09 53 37 0 72 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
Q7NWX3 4.17e-09 53 40 1 72 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 4.5e-09 53 43 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8KLG1 5.15e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q92WJ0 5.73e-09 53 43 1 69 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8DUF7 5.75e-09 53 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8A883 5.84e-09 53 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P47288 6.01e-09 53 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q6FFZ1 6.05e-09 53 44 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5WBL0 6.11e-09 53 44 1 69 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q63TX3 6.34e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q3JSQ0 6.34e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 6.34e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q1BWI2 6.6e-09 53 37 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q39GT7 6.6e-09 53 37 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8YM92 6.85e-09 53 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5M397 6.86e-09 53 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8ELR4 6.89e-09 53 36 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q92UV5 7.09e-09 53 42 1 69 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q5LYN4 7.27e-09 53 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q2SVP3 7.28e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q03ZQ0 7.3e-09 53 38 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
O85818 7.32e-09 53 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7NB11 7.34e-09 53 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q6D4E2 7.34e-09 53 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P44513 7.41e-09 53 42 1 69 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q03JH1 7.49e-09 53 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q4QP85 7.68e-09 53 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q1LKJ2 7.79e-09 53 38 0 67 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5E586 8.39e-09 53 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q04BG2 8.95e-09 53 34 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q6NA00 9.19e-09 53 42 1 69 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1GB17 9.58e-09 53 34 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5LBT4 9.61e-09 53 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q6YPR6 1e-08 53 37 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Onion yellows phytoplasma (strain OY-M)
Q64SQ6 1.01e-08 53 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q1M7W6 1.02e-08 52 40 0 67 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3Z2Z3 1.03e-08 53 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.03e-08 53 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q5LT05 1.05e-08 52 40 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3MAR5 1.1e-08 52 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q02R79 1.11e-08 52 42 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 1.11e-08 52 42 1 69 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8GNH6 1.11e-08 52 40 0 67 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q9CM80 1.11e-08 52 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q1MFL8 1.11e-08 52 44 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6LH11 1.13e-08 52 33 0 68 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q24XJ2 1.16e-08 52 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q03PF2 1.2e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
E9PX95 1.28e-08 52 40 0 52 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
E9PX95 7.43e-06 45 43 1 51 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
Q6KIP2 1.38e-08 52 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A3CMQ7 1.42e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q7NA79 1.44e-08 52 33 0 68 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P44531 1.44e-08 52 42 1 69 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0PAR0 1.44e-08 52 43 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q98HF7 1.48e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5HVG3 1.5e-08 52 43 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni (strain RM1221)
P31060 1.56e-08 52 50 0 52 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
P31060 1.34e-05 44 41 3 62 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
P32010 1.56e-08 52 35 0 68 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q13ZJ1 1.59e-08 52 37 0 67 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q7VP69 1.62e-08 52 39 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P74548 1.65e-08 52 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A3DDF6 1.67e-08 52 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3KCC5 1.68e-08 52 39 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
O83658 1.7e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q1AS06 1.72e-08 52 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q6N6K5 1.72e-08 52 42 2 71 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P10091 1.73e-08 52 38 2 70 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q8DPC2 1.86e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.86e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.86e-08 52 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2K2X0 1.92e-08 52 38 1 72 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P26050 1.94e-08 52 39 0 66 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8U6M1 1.95e-08 52 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KN37 1.99e-08 52 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9I2N4 2e-08 52 36 1 72 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9CP98 2.07e-08 52 32 0 68 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q1GIE5 2.08e-08 52 40 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q8XED0 2.16e-08 52 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O157:H7
P44986 2.17e-08 51 37 1 75 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLQ1 2.26e-08 51 37 1 75 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q6LR20 2.32e-08 52 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q8DZJ0 2.33e-08 52 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 2.33e-08 52 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 2.33e-08 52 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P55476 2.34e-08 52 41 0 67 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9KUI0 2.35e-08 52 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q98G43 2.36e-08 52 41 1 68 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O52618 2.4e-08 52 40 0 66 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q85A69 2.4e-08 52 40 2 69 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q8D7T7 2.49e-08 52 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q7MEV1 2.52e-08 52 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q9Z3I3 2.64e-08 51 39 0 66 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9STT7 2.66e-08 52 44 1 54 3 ABCA5 ABC transporter A family member 5 Arabidopsis thaliana
Q8RCU0 2.67e-08 51 38 0 68 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9CP06 2.69e-08 51 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q5E4V6 2.78e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8YCG3 2.81e-08 51 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0CZ35 2.81e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.81e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q5XCA4 2.81e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ34 2.81e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q63TW1 2.81e-08 51 44 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
O31339 2.84e-08 51 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3JSR6 2.86e-08 51 43 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q62K56 2.89e-08 51 44 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
P9WQL6 2.89e-08 51 43 0 67 3 MT2762 Fluoroquinolones export ATP-binding protein MT2762 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6HLQ9 2.9e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P9WQL7 2.92e-08 51 43 0 67 1 Rv2688c Fluoroquinolones export ATP-binding protein Rv2688c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q81TH8 2.93e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q63E84 2.95e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q81GC1 2.95e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73BM0 2.95e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.95e-08 51 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q65SC9 3.01e-08 51 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
E9PU17 3.03e-08 51 38 0 54 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
E9PU17 5.71e-06 45 41 1 51 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
Q87PH3 3.03e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1WSB9 3.06e-08 51 40 1 69 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q7MFC4 3.21e-08 51 38 1 67 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 3.21e-08 51 38 1 67 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q7W1F4 3.4e-08 51 36 1 68 3 modC Molybdenum import ATP-binding protein ModC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WP62 3.4e-08 51 36 1 68 3 modC Molybdenum import ATP-binding protein ModC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1J6Q6 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7CN92 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 3.42e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q042G7 3.53e-08 51 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q7VUJ5 3.54e-08 51 36 1 68 3 modC Molybdenum import ATP-binding protein ModC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q03AH0 3.6e-08 51 34 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q74K65 3.67e-08 51 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q32DZ9 3.7e-08 51 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Shigella dysenteriae serotype 1 (strain Sd197)
Q885N4 3.78e-08 51 40 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q18AM3 3.83e-08 51 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q4QN44 4.02e-08 51 30 0 68 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q6MPX9 4.04e-08 51 34 1 70 3 macB Macrolide export ATP-binding/permease protein MacB Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q1MA70 4.08e-08 51 38 1 72 3 modC Molybdenum import ATP-binding protein ModC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q98QE1 4.13e-08 51 40 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmopsis pulmonis (strain UAB CTIP)
Q5FL41 4.13e-08 51 31 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8RD43 4.14e-08 51 35 0 68 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 0.000341 40 30 0 66 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q6F0V4 4.19e-08 51 34 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
P44735 4.27e-08 51 30 0 68 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FBS3 4.27e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P04983 4.31e-08 51 32 0 68 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 4.31e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R4I3 4.35e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
P14788 4.43e-08 51 40 1 69 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8XAW7 4.44e-08 51 32 0 68 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8Z2R4 4.57e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q97KS6 4.58e-08 51 34 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5PJX5 4.66e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3Z3Q4 4.67e-08 51 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Shigella sonnei (strain Ss046)
P40790 4.71e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7H7 4.71e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q57QC8 4.71e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q3YVK8 4.75e-08 51 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q0TJH0 4.81e-08 51 36 1 68 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q4JTG9 4.88e-08 51 43 1 69 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q5PMK1 4.95e-08 51 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q83LR7 4.96e-08 51 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q1RE44 4.96e-08 51 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain UTI89 / UPEC)
P75831 4.96e-08 51 36 1 68 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain K12)
A1A9B7 4.96e-08 51 36 1 68 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Escherichia coli O1:K1 / APEC
Q82WT5 5.02e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q57293 5.04e-08 50 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q89ER4 5.06e-08 50 37 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1WVI7 5.12e-08 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q578K3 5.15e-08 50 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5.15e-08 50 42 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
A0PY57 5.19e-08 50 35 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
P10346 5.33e-08 50 39 0 68 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q9MUN1 5.35e-08 50 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q13ZK7 5.48e-08 50 43 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q9KL04 5.61e-08 50 38 1 67 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q660M8 5.72e-08 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
O51587 5.72e-08 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q65SW3 5.74e-08 50 37 1 69 3 modC Molybdenum import ATP-binding protein ModC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9K876 5.75e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KRT4 5.89e-08 50 39 1 69 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8D954 5.95e-08 50 39 1 69 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q0SRL2 6.02e-08 50 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
A1VYW8 6.02e-08 50 41 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P45022 6.03e-08 50 39 0 68 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SML1 6.13e-08 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q7MLB8 6.31e-08 50 39 1 69 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q6D201 6.5e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8DRS0 6.58e-08 50 41 0 68 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1B677 6.58e-08 50 40 1 69 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
P75059 6.94e-08 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q57R58 6.98e-08 50 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Salmonella choleraesuis (strain SC-B67)
Q5SSE9 7.02e-08 50 38 0 68 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 1.03e-05 44 33 1 66 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
O86751 7.03e-08 50 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5FA19 7.05e-08 50 39 1 73 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6LKD4 7.18e-08 50 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
O34979 7.31e-08 50 35 1 68 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q4W575 7.33e-08 50 40 1 72 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 7.33e-08 50 40 1 72 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0BUR6 7.36e-08 50 41 2 77 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q87H79 7.53e-08 50 30 0 68 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9X196 7.74e-08 50 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q50966 7.77e-08 50 40 1 72 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q881Q1 7.78e-08 50 39 1 68 2 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0BQ80 7.81e-08 50 32 0 71 3 modC Molybdenum import ATP-binding protein ModC Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q97UY8 7.85e-08 50 39 1 69 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q48FT0 8.18e-08 50 39 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0I3Y9 8.3e-08 50 34 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q9TKX3 8.37e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8F6Z1 8.67e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 8.67e-08 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9A7X1 8.77e-08 50 36 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q87GB5 8.97e-08 50 36 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6D734 9e-08 50 40 1 69 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8ZKV9 9.07e-08 50 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33360 9.17e-08 50 40 1 69 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q8Z824 9.27e-08 50 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Salmonella typhi
Q5NN23 9.38e-08 50 42 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8ZQE4 9.45e-08 50 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1CGD7 9.55e-08 50 36 1 68 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q66CL2 9.55e-08 50 36 1 68 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7CHI2 9.55e-08 50 36 1 68 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis
Q1CA99 9.55e-08 50 36 1 68 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q57HW1 9.62e-08 50 32 0 68 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q5PGK9 9.64e-08 50 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3KBH4 9.96e-08 50 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
P0C0E2 1e-07 49 41 0 68 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 1e-07 49 41 0 68 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q2SSS4 1.01e-07 50 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q92L31 1.02e-07 50 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
Q8DWR4 1.05e-07 50 39 0 68 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L3 1.05e-07 50 39 0 68 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF5 1.05e-07 50 39 0 68 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q6MU19 1.06e-07 50 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q0I2Z4 1.07e-07 50 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q4KC87 1.07e-07 50 37 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
F1MWM0 1.08e-07 50 46 0 54 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 0.000335 40 29 1 71 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
Q0BFQ0 1.11e-07 50 42 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5DZC6 1.11e-07 50 39 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1BWL4 1.12e-07 50 42 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.12e-07 50 42 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q7N6R3 1.12e-07 50 37 1 72 3 modC Molybdenum import ATP-binding protein ModC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 1.13e-07 50 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KHT9 1.13e-07 50 40 1 67 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 1.13e-07 50 40 1 67 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q5WCI1 1.14e-07 49 43 2 74 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q86UQ4 1.15e-07 50 44 0 54 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q86UQ4 4.22e-05 42 33 1 66 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q81GU1 1.15e-07 50 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q28VL7 1.16e-07 49 34 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q8Z0H0 1.17e-07 50 37 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6MCV4 1.17e-07 50 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q39GW5 1.19e-07 50 42 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P08720 1.19e-07 50 38 0 67 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q7NIW1 1.19e-07 50 36 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8XXY9 1.2e-07 50 35 0 67 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2SVN0 1.22e-07 50 43 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q04EY4 1.23e-07 49 44 1 63 3 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q92DL6 1.26e-07 50 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3SQZ1 1.27e-07 50 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P45092 1.27e-07 49 41 0 68 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Y8T6 1.29e-07 49 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q82JY6 1.29e-07 49 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q65S66 1.31e-07 49 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q722B1 1.31e-07 49 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q65UE1 1.33e-07 49 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0AGP9 1.35e-07 49 33 1 72 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8D653 1.35e-07 49 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q7VNG4 1.38e-07 49 34 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O34946 1.43e-07 49 36 1 68 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
P24693 1.48e-07 49 35 0 71 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P78363 1.5e-07 49 46 0 54 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 0.000332 40 29 1 71 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
Q9JVR5 1.54e-07 49 36 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q89UD2 1.55e-07 49 37 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2SMN9 1.56e-07 49 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Hahella chejuensis (strain KCTC 2396)
Q02Z10 1.57e-07 49 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q9K619 1.59e-07 49 41 4 74 3 bceA Bacitracin export ATP-binding protein BceA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9CGD4 1.62e-07 49 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q8E8K8 1.69e-07 49 39 1 69 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9FKF2 1.69e-07 49 39 1 69 3 ABCA11 ABC transporter A family member 11 Arabidopsis thaliana
Q57BC2 1.74e-07 49 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.74e-07 49 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q0I348 1.8e-07 49 28 0 73 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q82MV1 1.81e-07 49 39 1 73 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P77795 1.85e-07 49 36 1 69 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q38VW6 1.9e-07 49 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q88ZJ6 1.92e-07 49 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7TNJ2 1.93e-07 49 33 0 68 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q7TNJ2 0.000487 39 27 1 68 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q7N6F9 1.93e-07 49 36 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8FYU9 1.94e-07 49 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 1.94e-07 49 37 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8T6J0 1.97e-07 49 36 1 68 3 abcA7 ABC transporter A family member 7 Dictyostelium discoideum
Q91V24 1.99e-07 49 33 0 68 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q91V24 0.000693 39 27 1 68 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q9FLT5 2.04e-07 49 39 1 69 1 ABCA9 ABC transporter A family member 9 Arabidopsis thaliana
Q4KES7 2.05e-07 49 36 1 68 3 PFL_2149 Probable export ATP-binding/permease protein PFL_2149 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P39456 2.05e-07 48 44 0 68 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q5P6D5 2.07e-07 49 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6FYL0 2.07e-07 49 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Bartonella quintana (strain Toulouse)
O35600 2.09e-07 49 46 0 54 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 0.000389 40 30 1 68 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
Q08381 2.12e-07 49 34 1 72 3 modC Molybdenum import ATP-binding protein ModC Rhodobacter capsulatus
Q8XIZ5 2.13e-07 49 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 2.13e-07 49 32 1 70 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P9WQM1 2.15e-07 49 40 1 69 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 2.15e-07 49 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 2.15e-07 49 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8UCD5 2.29e-07 49 37 1 69 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6LK87 2.3e-07 49 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q1QDA8 2.35e-07 49 38 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3KE48 2.37e-07 49 38 1 68 3 Pfl01_2215 Probable export ATP-binding/permease protein Pfl01_2215 Pseudomonas fluorescens (strain Pf0-1)
P37388 2.42e-07 49 28 0 73 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q3ATR5 2.42e-07 49 41 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Chlorobium chlorochromatii (strain CaD3)
Q83J33 2.51e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q6NBT1 2.52e-07 48 37 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0SY86 2.56e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q5ZWE4 2.58e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q1R528 2.61e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q31V51 2.64e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 2.64e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q323M3 2.64e-07 48 35 1 68 3 macB Macrolide export ATP-binding/permease protein MacB Shigella boydii serotype 4 (strain Sb227)
Q8FCE2 2.67e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 2.67e-07 48 28 0 73 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8LPK0 2.67e-07 48 40 1 54 2 ABCA8 ABC transporter A family member 8 Arabidopsis thaliana
Q7NX01 2.68e-07 48 39 1 69 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5MK06 2.69e-07 48 36 1 72 1 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae
Q7MKU3 2.74e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 2.74e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q6F9A8 2.75e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7UC29 2.76e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
P20162 2.78e-07 48 33 0 68 3 lptB Lipopolysaccharide export system ATP-binding protein LptB (Fragment) Pseudomonas putida
P16676 2.79e-07 48 39 1 69 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8FFB3 2.79e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q4ZSF3 2.8e-07 48 30 0 73 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q4ZSF3 5.29e-05 42 37 0 72 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q5WXF0 2.84e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q9K0N7 2.86e-07 48 36 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F6V6 2.88e-07 48 36 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q84K47 2.98e-07 48 37 1 69 2 ABCA2 ABC transporter A family member 2 Arabidopsis thaliana
Q8XBJ8 2.99e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q1I966 3e-07 48 38 1 68 3 macB Probable export ATP-binding/permease protein MacB Pseudomonas entomophila (strain L48)
Q9STT8 3.01e-07 48 42 1 54 3 ABCA4 ABC transporter A family member 4 Arabidopsis thaliana
Q8D0W8 3.02e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8Z4V6 3.02e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8PY26 3.03e-07 48 36 0 68 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q88G95 3.05e-07 48 36 1 68 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45046 3.08e-07 48 30 0 73 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0VT01 3.09e-07 48 33 1 72 3 macB Macrolide export ATP-binding/permease protein MacB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q87SV4 3.12e-07 48 36 1 69 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q86UK0 3.15e-07 48 36 0 68 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q86UK0 9.2e-05 42 35 2 67 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q8FVV5 3.16e-07 48 40 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q2SJY7 3.17e-07 48 33 1 68 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q47T99 3.28e-07 48 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q6D2F6 3.31e-07 48 36 2 71 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7UBD0 3.37e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q0SXQ1 3.37e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
P40860 3.49e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3YUV0 3.5e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 3.5e-07 48 37 1 69 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 3.5e-07 48 37 1 69 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
Q0TA26 3.5e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P68188 3.5e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q4ZQE3 3.51e-07 48 39 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q60AI1 3.55e-07 48 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8DIA0 3.56e-07 48 36 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8FB37 3.6e-07 48 37 1 69 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8IZY2 3.61e-07 48 32 0 68 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q8IZY2 0.00025 40 29 1 68 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q5P4W2 3.64e-07 48 36 1 68 3 modC Molybdenum import ATP-binding protein ModC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P47433 3.71e-07 48 37 1 70 3 MG187 Putative ABC transporter ATP-binding protein MG187 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q97X60 3.76e-07 48 36 0 68 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97X60 3e-05 43 33 0 68 3 SSO1893 Putative ABC transporter ATP-binding protein SSO1893 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q830W6 3.78e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q8U8D6 3.81e-07 48 37 1 69 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q65M64 3.84e-07 48 44 1 54 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q92LU2 3.85e-07 48 34 1 72 3 modC Molybdenum import ATP-binding protein ModC Rhizobium meliloti (strain 1021)
Q7AH43 3.91e-07 48 39 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q58903 3.98e-07 48 38 1 68 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9HMZ4 4.1e-07 48 33 0 68 3 VNG_2317G Putative ABC transporter ATP-binding protein VNG_2317G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9G4F5 4.11e-07 48 37 1 69 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q5X627 4.13e-07 48 36 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q8UA73 4.39e-07 48 39 1 69 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
A0A0G2K1Q8 4.42e-07 48 38 0 52 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
A0A0G2K1Q8 9.59e-06 44 41 1 51 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
Q8U3E0 4.54e-07 48 34 1 64 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q58429 4.64e-07 48 39 0 64 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8EBC3 4.89e-07 48 37 1 69 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q668K6 5.02e-07 48 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
P37009 5.09e-07 48 39 1 69 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q7ULB5 5.2e-07 48 39 2 69 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B5Z7I4 5.22e-07 47 38 1 63 1 egtV Ergothioneine transport ATP-binding protein EgtV Helicobacter pylori (strain G27)
Q8PC11 5.24e-07 48 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q1B8U4 5.44e-07 47 34 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
A1B677 5.46e-07 48 36 1 68 3 macB1 Macrolide export ATP-binding/permease protein MacB 1/2 Paracoccus denitrificans (strain Pd 1222)
Q03ZL5 5.74e-07 48 33 0 68 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q5YRK2 5.82e-07 47 39 1 69 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Nocardia farcinica (strain IFM 10152)
Q9ESR9 5.84e-07 48 36 0 68 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 0.000194 40 34 1 69 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q160M2 5.93e-07 48 44 1 54 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0RKH4 6.09e-07 47 39 1 69 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q97WT4 6.32e-07 47 36 0 68 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97WT4 8.64e-06 44 33 0 68 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q63TY1 6.33e-07 47 34 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q9I6L0 6.33e-07 47 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0AGF4 6.35e-07 47 39 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
D4GP39 6.38e-07 47 31 1 70 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q82TL6 6.41e-07 47 37 1 69 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9PDN2 6.51e-07 47 39 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q54DT1 6.57e-07 47 36 1 68 3 abcA9 ABC transporter A family member 9 Dictyostelium discoideum
Q62K82 6.71e-07 47 34 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
E9Q876 6.77e-07 47 42 0 54 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
E9Q876 8.67e-05 42 35 2 67 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
Q73XU8 6.86e-07 47 40 1 69 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8RLB6 6.96e-07 47 39 1 69 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
P97027 7.13e-07 47 44 1 54 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS19660
Feature type CDS
Gene -
Product hypothetical protein
Location 1716368 - 1716592 (strand: -1)
Length 225 (nucleotides) / 74 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_93
Orthogroup size 12
N. genomes 7

Actions

Genomic region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1122 Inorganic ion transport and metabolism (P)
General function prediction only (R)
PR Energy-coupling factor transporter ATP-binding protein EcfA2

Protein Sequence

MARALISSPSLLLLDEPFSGLDRATRRQLWSQINMLKNEGITIVLVTHEPKESDAPAEYCIQIEDGKIRTTTIG

Flanking regions ( +/- flanking 50bp)

AAGCATTCTGTTGCTTTGTGCCGGCTGTAATGTCCGCATCGGTATAGGCACTGGCGCGGGCGCTTATTTCCTCTCCGTCACTTCTTTTACTGGATGAACCTTTCTCCGGGCTGGACCGGGCAACCCGCAGACAGCTATGGTCGCAGATTAATATGCTGAAAAATGAGGGGATAACGATCGTTTTGGTCACACATGAACCTAAAGAGTCAGATGCGCCGGCAGAATACTGTATACAAATAGAAGACGGAAAAATCCGAACGACGACAATAGGTTGAGAGAGATAAAATCCGGATGTAATAGTGATATTTTTGTCGCGTCATCTTCA