Homologs in group_93

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10955 FBDBKF_10955 37.2 Morganella morganii S1 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
FBDBKF_13655 FBDBKF_13655 100.0 Morganella morganii S1 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
EHELCC_05270 EHELCC_05270 37.2 Morganella morganii S2 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
NLDBIP_05590 NLDBIP_05590 37.2 Morganella morganii S4 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
NLDBIP_11670 NLDBIP_11670 100.0 Morganella morganii S4 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
LHKJJB_02470 LHKJJB_02470 37.2 Morganella morganii S3 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
LHKJJB_11530 LHKJJB_11530 100.0 Morganella morganii S3 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
HKOGLL_10140 HKOGLL_10140 100.0 Morganella morganii S5 potA ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
HKOGLL_15850 HKOGLL_15850 37.2 Morganella morganii S5 tauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component
F4V73_RS19660 F4V73_RS19660 35.1 Morganella psychrotolerans - hypothetical protein
PMI_RS07480 PMI_RS07480 38.2 Proteus mirabilis HI4320 - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_93

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_93

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q47T99 2.84e-60 197 44 2 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
P31134 4.38e-60 196 47 3 226 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q88ZJ6 5.04e-60 196 49 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1QE80 4.54e-59 194 48 2 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P96063 2.58e-58 191 48 4 223 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3KBH4 3.55e-58 191 48 2 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q5PFQ7 4.46e-58 191 48 4 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z8W8 4.86e-58 191 48 4 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q57SD6 5.59e-58 190 48 4 223 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
P44513 5.7e-58 190 47 1 204 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O85818 9.69e-58 190 45 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q0RAT5 1.02e-57 192 49 3 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q4QP85 2.71e-57 188 43 2 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q6D4E2 2.83e-57 189 47 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1TXH7 5.61e-57 188 45 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q160M2 7.28e-57 187 50 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5E586 7.55e-57 187 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5FA19 1.3e-56 186 44 2 216 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P45171 1.38e-56 187 44 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4W575 1.54e-56 186 44 2 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.54e-56 186 44 2 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q4QK57 1.82e-56 186 44 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q98HF7 2.05e-56 186 47 2 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6LR20 2.23e-56 186 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q9KS33 2.45e-56 186 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74548 2.67e-56 186 46 3 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YCB1 3.91e-56 185 43 3 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q60AI1 6.89e-56 185 48 3 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q65UE1 8.67e-56 185 46 2 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5ZWE4 1.15e-55 184 44 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8FW07 1.22e-55 184 43 3 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 1.22e-55 184 43 3 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q2YKR8 1.22e-55 184 43 3 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q7MKU3 2.41e-55 184 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 2.41e-55 184 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q9KUI0 2.62e-55 184 46 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CP06 5.99e-55 182 45 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9MUN1 6.82e-55 182 43 3 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q0I3Y9 8.05e-55 182 45 3 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q92UV5 8.51e-55 183 47 2 207 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q5X627 8.91e-55 182 44 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q2YAD6 1.17e-54 182 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8RGC8 1.21e-54 182 42 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5WXF0 1.33e-54 181 44 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q03PF2 1.83e-54 181 44 2 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q30V33 2.36e-54 181 46 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7VNG4 2.4e-54 181 45 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1AS06 4.26e-54 181 47 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q9X196 4.82e-54 180 46 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A0LUE6 5.98e-54 180 43 3 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q87PH3 6.14e-54 180 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7NIW1 7.38e-54 179 44 3 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NWX3 8.82e-54 179 48 3 203 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4K681 9.59e-54 179 46 2 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9TKX3 1.23e-53 178 43 3 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9YGA6 1.29e-53 179 45 2 202 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q8Z0H0 1.85e-53 178 45 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z7H7 2.53e-53 179 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
A1TAI4 2.78e-53 178 44 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q5PMK1 3.1e-53 178 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P40790 3.24e-53 178 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 3.24e-53 178 46 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q65T42 3.46e-53 177 43 3 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q32EY4 4.1e-53 178 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q5LT05 4.41e-53 177 47 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q88CL2 5.06e-53 176 46 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0T5R2 6.09e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q1RD28 6.22e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 6.22e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 6.36e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 6.36e-53 177 45 2 203 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 6.36e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 6.36e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 6.36e-53 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q110U3 6.55e-53 177 47 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q0SBZ1 6.88e-53 177 43 4 228 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
A0PY57 7.69e-53 176 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q3Z2Z3 1.25e-52 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.25e-52 177 45 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q0S0Z3 1.68e-52 176 42 4 228 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q1GIE5 1.92e-52 176 45 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q9JZW0 3.94e-52 175 46 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q2K8C8 3.97e-52 175 44 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9JUX4 4.48e-52 175 46 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q92WD6 5.58e-52 174 41 3 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q50966 6.28e-52 174 42 2 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q88AS5 6.74e-52 173 47 3 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1B9Q7 7.73e-52 174 41 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q8EBC3 9.19e-52 174 45 4 224 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q38VW6 9.77e-52 174 46 2 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8U6M1 9.78e-52 174 42 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2SJY7 1.18e-51 174 46 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q1MQ44 1.27e-51 174 46 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q72FW5 1.4e-51 174 45 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P56344 1.75e-51 169 41 3 220 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q4KC87 1.91e-51 173 46 4 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3MAR5 1.94e-51 174 44 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q18AM3 2.05e-51 173 44 3 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q9I6T2 2.18e-51 173 45 2 218 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1B8V9 2.36e-51 174 43 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.36e-51 174 43 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q8YM92 3.35e-51 173 44 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q92DL6 4.66e-51 172 42 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q578K3 5.68e-51 172 43 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5.68e-51 172 43 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8DIA0 5.71e-51 171 44 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8UH62 6.45e-51 171 45 2 211 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9I6L0 7.03e-51 171 46 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0AGP9 7.07e-51 172 42 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q89UD2 7.2e-51 171 42 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8D653 7.88e-51 171 45 2 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q0RYP7 8.8e-51 171 42 4 228 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0SRL2 9.89e-51 171 41 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6LKD4 1.04e-50 171 41 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q14Q07 1.08e-50 171 42 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8XZP8 1.24e-50 171 43 3 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8YCG3 1.27e-50 171 43 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q97KS6 1.29e-50 171 41 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q03AH0 1.32e-50 171 43 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P63354 1.69e-50 171 46 2 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.69e-50 171 46 2 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q73XU8 1.77e-50 171 41 3 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q609Q1 1.86e-50 170 45 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q92WJ0 2.08e-50 170 42 3 230 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q722B1 2.42e-50 171 41 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8XIZ5 2.74e-50 170 41 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 2.74e-50 170 41 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P9WQM1 2.76e-50 170 42 3 228 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 2.76e-50 170 42 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 2.76e-50 170 42 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6D201 2.85e-50 169 40 3 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6MCV4 2.89e-50 171 44 3 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8FVV5 3.51e-50 170 44 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q6F9A8 3.78e-50 170 46 2 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8Y8T6 3.87e-50 170 41 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3KCC5 6.01e-50 169 42 4 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q6NBT1 6.1e-50 169 42 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q63TY1 6.56e-50 169 44 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 6.85e-50 169 44 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q9G4F5 7.05e-50 169 47 3 204 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q830W6 8e-50 169 44 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
A1SWH9 8.14e-50 169 41 4 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7NQN5 8.63e-50 169 42 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q64SQ6 9.41e-50 171 40 3 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 9.41e-50 171 40 3 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P14788 9.86e-50 168 47 2 200 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q63E84 1.43e-49 167 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 1.43e-49 167 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 1.43e-49 167 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 1.52e-49 167 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8UA73 1.65e-49 167 44 2 202 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7N8B9 1.83e-49 168 41 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q82TL6 1.92e-49 168 44 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8E8K8 1.93e-49 168 40 3 230 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2K6L3 2.04e-49 167 42 2 200 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q81TH8 2.1e-49 167 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q46ZM0 2.32e-49 168 41 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K998 4.07e-49 167 42 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q02R79 4.85e-49 167 41 3 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0I2Z4 4.99e-49 167 39 3 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q63Q62 5.47e-49 167 42 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q9HY19 5.51e-49 167 41 3 231 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q56927 5.68e-49 166 43 2 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q5L222 5.99e-49 167 45 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q62GB4 6.29e-49 167 42 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q3JMW7 6.64e-49 167 42 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q5YZY9 6.64e-49 166 45 2 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q03ZQ0 6.75e-49 167 42 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q7NRX5 6.85e-49 167 42 4 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q82JY6 6.95e-49 166 42 3 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q1LLP5 7.03e-49 167 42 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0AGF4 7.76e-49 167 41 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q81GC1 7.86e-49 166 41 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6D734 8.5e-49 166 42 2 203 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3DDF6 8.97e-49 166 40 3 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8UB29 1.09e-48 166 40 3 219 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KLQ5 1.29e-48 166 41 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RI39 1.3e-48 166 43 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9K876 1.44e-48 166 42 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7NX01 1.99e-48 165 42 3 224 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q28QL7 2.01e-48 165 42 2 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
P21410 2.14e-48 165 43 3 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q57293 2.23e-48 165 39 3 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q2J2E9 3.22e-48 165 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
Q93DX8 3.45e-48 162 46 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8ELR4 3.58e-48 165 44 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6D2F6 4.03e-48 164 46 2 201 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P77795 4.1e-48 164 42 3 219 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q6F0V4 4.25e-48 164 42 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
P16676 4.69e-48 164 41 4 231 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q042G7 4.87e-48 164 43 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8FFB3 5e-48 164 41 4 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBJ8 5.22e-48 164 41 4 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q7W9U5 6.38e-48 164 46 3 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8A883 7.48e-48 166 40 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q65S66 7.76e-48 164 38 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7WGW1 8.16e-48 164 46 3 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P40860 8.53e-48 164 43 2 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 8.79e-48 164 43 2 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8XZX8 9.19e-48 164 42 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q92VJ2 1.04e-47 164 42 3 221 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q2SU77 1.11e-47 164 41 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1M8R6 1.16e-47 163 41 2 200 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q74K65 1.17e-47 164 43 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A3PRY1 1.39e-47 163 41 3 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q0BIZ6 1.57e-47 163 41 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BRZ8 1.59e-47 163 41 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 1.59e-47 163 41 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q7MLB8 1.6e-47 163 40 3 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q8D954 1.6e-47 163 40 3 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q7UC29 1.65e-47 163 41 4 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q39KB9 1.69e-47 163 42 4 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q65QT6 2.33e-47 163 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7VZE5 2.48e-47 162 45 3 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O86751 2.69e-47 162 41 3 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5DZC6 2.72e-47 163 42 3 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q13TV1 2.77e-47 162 38 3 228 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q82WT5 2.83e-47 162 44 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3IX40 2.85e-47 162 41 3 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P37009 2.96e-47 162 40 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q9KRT4 3.13e-47 162 40 3 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5LX21 3.18e-47 162 40 3 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q668Q3 3.2e-47 162 41 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9PDN2 3.26e-47 162 43 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q1CJS9 3.45e-47 162 41 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 3.45e-47 162 41 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 3.45e-47 162 41 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9CM80 3.92e-47 162 40 3 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q8UBB7 4.01e-47 162 40 3 217 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P44531 4.54e-47 161 39 3 219 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O83658 6.73e-47 162 44 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
O51587 8.89e-47 161 37 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q7AH43 9.01e-47 161 40 4 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q04G50 9.53e-47 161 43 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q6LK87 1.01e-46 161 41 3 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q660M8 1.07e-46 160 37 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q13ER6 1.09e-46 161 39 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
Q98G42 1.11e-46 161 40 2 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q24XJ2 1.28e-46 160 40 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q01937 1.5e-46 160 40 3 213 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q4L5B3 1.72e-46 160 42 2 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q7CS28 1.76e-46 160 38 4 222 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98K23 1.8e-46 160 43 2 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0SML1 1.82e-46 160 37 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q8FB37 2.11e-46 160 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1WVI7 2.2e-46 160 42 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q3YUV0 2.3e-46 160 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 2.3e-46 160 41 3 217 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 2.3e-46 160 41 3 217 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 2.3e-46 160 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q7UBD0 2.37e-46 160 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q8FVT0 2.42e-46 160 41 2 201 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q49WM4 2.45e-46 160 41 2 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YKZ7 2.5e-46 160 41 2 201 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 2.5e-46 160 41 2 201 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q5FL41 2.91e-46 160 43 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q0SXQ1 3e-46 160 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
O32151 3.08e-46 160 39 3 220 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q92XW1 3.68e-46 159 43 2 208 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q8PC11 3.69e-46 159 41 2 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9L0Q1 4.2e-46 160 41 2 202 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
D4GP38 4.73e-46 160 42 3 202 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q664X5 5.09e-46 159 39 5 226 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 5.09e-46 159 39 5 226 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 5.09e-46 159 39 5 226 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 5.09e-46 159 39 5 226 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q89WG0 5.91e-46 159 38 3 219 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6NDQ0 6.06e-46 159 39 4 224 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P94360 7.13e-46 159 40 2 210 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q31VH5 7.74e-46 159 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q8F6Z1 7.91e-46 159 44 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 7.91e-46 159 44 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q3YW77 8.43e-46 159 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
P10907 8.7e-46 158 40 3 215 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q87DT9 9.05e-46 158 42 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q0TC10 9.48e-46 158 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q21CA3 9.93e-46 159 39 4 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q8Z1U0 1.03e-45 159 42 2 201 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q1R5H8 1.05e-45 158 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 1.05e-45 158 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
P19566 1.07e-45 159 42 2 201 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 1.07e-45 159 42 2 201 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q8FCQ2 1.24e-45 158 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA26 1.32e-45 158 41 3 217 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7N6Z2 1.46e-45 158 39 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2K4V4 1.49e-45 158 40 4 217 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5PKZ8 1.54e-45 158 42 2 201 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q98G43 1.61e-45 158 41 3 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7MFC4 1.77e-45 158 41 3 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 1.77e-45 158 41 3 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q07UI9 1.87e-45 158 38 3 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q66FU4 2.43e-45 157 42 2 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9A7X1 2.75e-45 157 45 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O31339 2.82e-45 157 43 3 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q04BG2 2.84e-45 157 41 2 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q2K1C8 2.99e-45 157 39 4 215 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8X6U5 3.27e-45 157 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q8Z245 3.3e-45 157 40 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
Q1GB17 3.62e-45 157 41 2 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P55453 3.8e-45 156 40 4 234 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8DZJ0 4.45e-45 157 38 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 4.45e-45 157 38 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 4.45e-45 157 38 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1MCN6 5.64e-45 157 40 2 206 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q97UY8 6.1e-45 156 40 2 214 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q87GB5 6.16e-45 157 40 3 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8PNN4 7.03e-45 155 42 2 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q9KL04 7.54e-45 156 41 3 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1CNC6 9.19e-45 156 41 2 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 9.19e-45 156 41 2 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 9.19e-45 156 41 2 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
P54933 9.36e-45 155 40 3 219 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q7A169 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.33e-44 155 43 2 200 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.33e-44 155 43 2 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q5JEB0 1.68e-44 154 41 2 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q79EE4 1.77e-44 155 40 2 209 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q668K6 1.89e-44 155 41 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
A1JIE0 2.01e-44 155 41 2 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q45460 2.08e-44 155 40 6 222 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q7N986 2.23e-44 155 38 3 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8D0W8 2.83e-44 155 41 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8U4K3 3.14e-44 154 39 2 211 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8ZLF4 3.19e-44 154 39 3 215 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9Z3R9 4.19e-44 154 39 4 222 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q57IS3 4.78e-44 154 39 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q2L0H5 5.46e-44 154 38 3 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
P55604 5.56e-44 154 39 4 224 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6G194 6.11e-44 153 37 2 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
O57896 6.28e-44 153 40 2 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q1M589 1.08e-43 153 38 4 220 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P97027 1.49e-43 150 41 4 217 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q5PJL1 1.54e-43 152 39 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1URR2 1.84e-43 152 37 2 201 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q8RQL7 1.89e-43 149 38 3 213 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P48243 2.06e-43 149 39 2 206 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7CN92 2.14e-43 153 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.14e-43 153 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q02SA6 2.17e-43 150 41 3 208 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7VYN2 2.2e-43 152 38 3 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WID6 2.2e-43 152 38 3 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q164Y5 2.31e-43 152 37 2 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9HX79 2.47e-43 149 40 3 208 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DUF7 2.67e-43 152 41 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q85A69 2.79e-43 152 40 2 201 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q81GU1 2.92e-43 152 43 3 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1GID1 3.16e-43 152 37 3 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
D4GP39 3.17e-43 152 38 3 221 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q6G5J0 3.26e-43 152 38 2 201 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P77481 3.47e-43 152 40 2 198 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q8FV85 3.6e-43 152 41 2 208 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 3.6e-43 152 41 2 208 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 3.6e-43 152 41 2 208 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 3.6e-43 152 41 2 208 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q8X8K4 3.82e-43 152 40 2 198 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q6CZ34 3.94e-43 152 39 3 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7VV72 4.25e-43 152 38 2 218 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 4.25e-43 152 38 2 218 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 4.25e-43 152 38 2 218 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1J6Q6 4.49e-43 152 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 4.49e-43 152 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 4.49e-43 152 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 4.49e-43 152 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7W6G5 5.67e-43 151 38 3 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5XCA4 7.31e-43 151 36 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 7.71e-43 151 36 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 7.71e-43 151 36 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 7.71e-43 151 36 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8FHR3 8.48e-43 151 40 2 198 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI47 8.48e-43 151 40 2 198 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5HQ70 8.68e-43 151 41 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34992 9.25e-43 151 40 6 222 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q1RC47 9.94e-43 150 40 2 198 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
P10091 1.07e-42 150 41 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q9KHT9 1.25e-42 151 37 5 222 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 1.25e-42 151 37 5 222 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q03JH1 1.5e-42 150 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LYN4 1.62e-42 150 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 1.63e-42 150 37 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A3CMQ7 1.69e-42 150 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
O34677 1.82e-42 147 37 4 221 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
P73265 3.48e-42 147 41 3 196 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8UII7 4.26e-42 149 40 2 195 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8CPN0 4.89e-42 149 40 2 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P45769 1.1e-41 145 37 3 224 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P45022 1.17e-41 145 38 4 220 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3JKX3 1.51e-41 145 40 4 221 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)
Q62AW4 1.51e-41 145 40 4 221 3 tauB Taurine import ATP-binding protein TauB Burkholderia mallei (strain ATCC 23344)
Q5YRD1 1.57e-41 147 38 4 231 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q00752 1.63e-41 148 37 2 203 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DPC2 1.84e-41 148 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.84e-41 148 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.84e-41 148 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q65M64 1.95e-41 144 40 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q63JZ3 1.95e-41 144 40 4 221 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain K96243)
Q6MU19 2e-41 147 37 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9V2C0 2.01e-41 147 38 2 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q6FFZ1 3.05e-41 144 40 3 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2SSS4 3.26e-41 146 37 3 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8E3S0 3.27e-41 147 36 2 222 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
P35116 4.59e-41 144 37 4 230 3 nocP Nopaline permease ATP-binding protein P Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DY54 4.63e-41 146 36 2 222 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 4.63e-41 146 36 2 222 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P9WQI3 5.18e-41 147 38 3 215 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 5.18e-41 147 38 3 215 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P54537 5.63e-41 143 38 4 213 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8ELQ6 5.69e-41 145 36 2 219 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8G5P8 5.92e-41 147 36 3 229 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
P27675 7.13e-41 142 38 2 203 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q0I354 9.2e-41 141 42 2 194 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
P18813 9.55e-41 144 40 3 201 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q1J8E4 1.05e-40 145 34 3 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
P38045 1.46e-40 150 41 4 218 1 nrtC Nitrate import ATP-binding protein NrtC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9CGD4 1.59e-40 146 37 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q2T751 1.92e-40 142 40 4 216 3 tauB Taurine import ATP-binding protein TauB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q02Z10 2.02e-40 146 37 3 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q8ZRM9 2.34e-40 144 37 2 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52815 2.43e-40 142 35 3 227 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q57T09 2.47e-40 144 37 2 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q1DDP4 2.71e-40 144 38 5 232 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q4FMG5 3.39e-40 141 38 4 215 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q92L31 3.9e-40 140 34 3 231 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
O30144 4.39e-40 140 40 3 203 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q2KVK2 4.47e-40 144 37 2 218 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q8NQU4 4.51e-40 141 36 5 235 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1JNE0 4.53e-40 144 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 4.53e-40 144 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XDS8 4.53e-40 144 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5PID0 4.66e-40 143 37 2 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z990 4.71e-40 143 37 3 227 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q48V78 4.83e-40 143 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 4.83e-40 143 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
P10346 5.81e-40 140 39 3 219 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P0CZ31 6.84e-40 143 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 6.84e-40 143 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q6LV32 7.8e-40 140 36 2 215 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q1QTX6 8.66e-40 143 39 3 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0AU85 9.81e-40 142 40 4 219 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q65M34 1.1e-39 142 36 2 221 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q93DA2 1.14e-39 142 33 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8P2K6 1.31e-39 142 34 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9A502 1.4e-39 142 41 2 198 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q52666 1.68e-39 140 37 3 213 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q55463 2.43e-39 140 35 3 217 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7N8V0 2.69e-39 138 39 2 204 3 thiQ Thiamine import ATP-binding protein ThiQ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1BT84 2.77e-39 139 37 3 219 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
A0KAV6 2.77e-39 139 37 3 219 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
Q3M5J9 4.55e-39 138 38 2 198 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q47RE8 4.64e-39 140 39 3 230 3 metN Methionine import ATP-binding protein MetN Thermobifida fusca (strain YX)
P55662 5.5e-39 138 34 5 236 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q38WL5 6.01e-39 140 36 2 230 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q6W2B1 6.04e-39 138 39 2 208 3 tauB Taurine import ATP-binding protein TauB Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q16BJ3 7.92e-39 138 40 4 195 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1JII9 1.03e-38 140 33 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q5M5Z2 1.07e-38 140 32 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5MZ54 1.49e-38 144 43 3 198 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 1.49e-38 144 43 3 198 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4FL37 1.59e-38 139 35 7 254 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q4JTG9 1.78e-38 140 35 3 224 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q5M1F6 2.15e-38 139 32 2 230 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q83F44 2.21e-38 139 36 3 222 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8U648 2.65e-38 136 41 6 207 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7VKP7 2.73e-38 139 36 2 198 3 modC Molybdenum import ATP-binding protein ModC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0BMC9 2.76e-38 139 37 2 216 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 2.76e-38 139 37 2 216 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q8DQH4 2.88e-38 135 35 4 208 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM82 2.88e-38 135 35 4 208 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2RWA3 3.13e-38 139 40 2 202 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P30750 3.2e-38 138 36 2 225 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q5PCG9 3.27e-38 138 38 3 202 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZR89 3.34e-38 138 38 3 202 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q74IV9 3.59e-38 138 35 4 226 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q3Z5F8 3.88e-38 138 36 2 225 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 3.88e-38 138 36 2 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 3.88e-38 138 36 2 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 3.88e-38 138 36 2 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q0TLD2 3.96e-38 138 36 2 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q325U1 4e-38 138 38 2 208 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q5NFU5 4.25e-38 138 37 2 216 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q63GR8 5.27e-38 138 35 2 218 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q5LVM5 5.49e-38 136 38 5 213 3 tauB Taurine import ATP-binding protein TauB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q57855 5.59e-38 136 34 2 212 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8U8D6 5.64e-38 136 41 5 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q14H97 5.66e-38 138 37 2 216 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
P73450 5.68e-38 142 41 3 202 3 nrtC Nitrate import ATP-binding protein NrtC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q39CJ6 6.66e-38 135 37 3 219 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q32JQ8 6.72e-38 137 36 2 225 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q8FYU9 6.8e-38 135 37 3 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 6.8e-38 135 37 3 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P37774 8.31e-38 135 38 4 212 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q5MZ53 9.07e-38 135 35 3 220 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 9.07e-38 135 35 3 220 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1WVG9 1.03e-37 137 34 6 244 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q0KDG3 1.04e-37 137 38 2 204 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_11325
Feature type CDS
Gene potA
Product ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component
Location 86777 - 87475 (strand: -1)
Length 699 (nucleotides) / 232 (amino acids)
In genomic island GI20

Contig

Accession ZDB_220
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_93
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3842 Amino acid transport and metabolism (E) E ABC-type Fe3+/spermidine/putrescine transport systems, ATPase component

Protein Sequence

MSDTTLVLDNVHVSYGSKHQRNHVLKGFSLHINAGEIGCLLGTSGCGKSTALRAIAGFERTEQGTIHVGGRCVAGEGLHLPPEQRNVGMVFQDYALFPHLTAAQNIAFGLRKQPKGYQQTRVQALLDLVELKELAGRYPHEMSGGQQQRIALARALATQPAVLLLDEPLSSLDPDSRKRLGLEVRDILREAGQTALLVTHSEDEAQLMADKINYLKNGRLIQNDEKTKIRNT

Flanking regions ( +/- flanking 50bp)

TATCTTCATCCGGGCCAAAACAACGATAATCAGAAGGGAGTCGTCATCAGGTGTCAGACACAACGTTAGTTCTTGATAATGTGCATGTCTCTTACGGGAGTAAACATCAACGTAATCATGTTCTGAAAGGCTTTTCTTTGCACATTAATGCAGGGGAGATCGGCTGTCTTCTCGGTACTTCCGGCTGCGGAAAAAGCACTGCATTACGTGCTATTGCAGGGTTTGAACGTACAGAGCAGGGAACCATCCATGTTGGTGGCCGCTGTGTTGCAGGAGAGGGCCTTCATCTTCCGCCGGAACAACGCAATGTGGGAATGGTATTTCAGGATTACGCGCTGTTCCCCCATTTAACCGCAGCGCAAAATATTGCTTTCGGTCTGAGAAAACAACCGAAAGGATATCAGCAAACACGAGTTCAAGCACTGCTGGATTTAGTAGAATTAAAAGAACTTGCCGGGCGTTATCCACATGAAATGTCTGGTGGGCAACAGCAACGTATTGCTTTAGCACGTGCATTGGCGACACAGCCGGCAGTATTGTTGTTAGATGAGCCTTTGTCGAGCTTAGATCCGGATAGCCGTAAACGTTTAGGGCTGGAAGTGAGAGATATTTTACGGGAAGCCGGGCAAACAGCACTGTTAGTGACTCACAGCGAAGATGAAGCACAATTGATGGCTGACAAAATTAACTACCTGAAAAATGGCAGATTAATTCAGAATGATGAGAAAACCAAAATCAGAAATACTTAAAATAAAAAATGAGATAAATAGTGCACGGGAAGTTGATACTACGATTTTAT