Homologs in group_3872
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| PMI_RS16445 | PMI_RS16445 | 52.3 | Proteus mirabilis HI4320 | - | type II toxin-antitoxin system YafQ family toxin |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| Q47149 | 1.71e-26 | 96 | 55 | 1 | 83 | 1 | yafQ | mRNA interferase toxin YafQ | Escherichia coli (strain K12) |
| A0A140NAP5 | 3.02e-26 | 95 | 55 | 1 | 83 | 1 | yafQ | mRNA interferase toxin YafQ | Escherichia coli (strain B / BL21-DE3) |
| P44041 | 2.62e-11 | 57 | 37 | 2 | 85 | 3 | yafQ | Putative toxin YafQ | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS19205 |
| Feature type | CDS |
| Gene | - |
| Product | type II toxin-antitoxin system YafQ family toxin |
| Location | 4595 - 4870 (strand: 1) |
| Length | 276 (nucleotides) / 91 (amino acids) |
| Accession | term accessions NZ_VXKB01000013 accessions NZ_VXKB01000000 Name: value, dtype: object |
|---|---|
| Length | 5246 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3872 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
| PF15738 | Bacterial toxin of type II toxin-antitoxin system, YafQ |
|---|
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG3041 | Translation, ribosomal structure and biogenesis (J) Defense mechanisms (V) |
JV | mRNA-degrading endonuclease YafQ (mRNA interferase), toxin component of the YafQ-DinJ toxin-antitoxin module |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K19157 | mRNA interferase YafQ [EC:3.1.-.-] | - | - |
MLIPVQSSAFKSDVKRQKKRGKDMGKLKKLIELLVNEDDVPPEYVDHPLSGNWRGYRDAHIEGDWLLIYKVDDDELRLARTGTHQDIFSHY
GGTCAGCGTTTTGATTCAGTTGATGCTCTTTTTGATGATTTGGGTATCTGATGCTTATTCCTGTACAGTCCAGTGCCTTTAAGTCGGATGTAAAGAGACAAAAAAAACGTGGTAAGGATATGGGTAAGTTAAAAAAGCTCATTGAGTTACTGGTTAATGAGGACGATGTACCACCGGAGTATGTTGATCATCCTTTGTCAGGAAACTGGCGGGGGTACCGTGATGCTCATATTGAAGGTGACTGGTTACTGATTTATAAGGTTGATGATGACGAGTTAAGGCTTGCCAGAACCGGTACGCATCAGGATATTTTTAGTCATTATTAACGTTCCTCTGAGAGCGTTTTTTGTTCTCAGGGGTAAACCGTTTCAAGCCA
