Homologs in group_2896

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12350 FBDBKF_12350 77.2 Morganella morganii S1 - CTP--phosphocholine cytidylyltransferase
EHELCC_13955 EHELCC_13955 77.2 Morganella morganii S2 - CTP--phosphocholine cytidylyltransferase
NLDBIP_15050 NLDBIP_15050 77.2 Morganella morganii S4 - CTP--phosphocholine cytidylyltransferase
LHKJJB_15560 LHKJJB_15560 77.2 Morganella morganii S3 - CTP--phosphocholine cytidylyltransferase
HKOGLL_14680 HKOGLL_14680 77.2 Morganella morganii S5 - CTP--phosphocholine cytidylyltransferase

Distribution of the homologs in the orthogroup group_2896

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2896

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P14183 5.5e-76 232 52 1 223 3 licC Choline-phosphate cytidylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DPI6 4e-40 140 36 3 227 1 licC Choline-phosphate cytidylyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B9CM12 6.19e-30 114 33 6 222 1 pntC 2-aminoethylphosphonate cytidylyltransferase Lancefieldella rimae (strain ATCC 49626 / DSM 7090 / CCUG 31168 / NBRC 15546 / VPI D140H-11A)
Q73MU2 6.86e-12 67 35 2 105 1 pntC Bifunctional 2-aminoethylphosphonate cytidylyltransferase/aminotransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q0P8J8 7.49e-08 55 33 2 116 1 Cj1416c CTP:phosphoglutamine cytidylyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q05852 2.54e-06 50 39 3 93 1 gtaB UTP--glucose-1-phosphate uridylyltransferase Bacillus subtilis (strain 168)
P0DG73 4.23e-06 50 50 0 53 3 hasC2 UTP--glucose-1-phosphate uridylyltransferase 2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P67070 4.23e-06 50 50 0 53 3 hasC2 UTP--glucose-1-phosphate uridylyltransferase 2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DG72 4.23e-06 50 50 0 53 3 hasC2 UTP--glucose-1-phosphate uridylyltransferase 2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67068 4.23e-06 50 50 0 53 3 hasC2 UTP--glucose-1-phosphate uridylyltransferase 2 Streptococcus pyogenes serotype M1
Q5XE04 4.23e-06 50 50 0 53 3 hasC1 UTP--glucose-1-phosphate uridylyltransferase 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0C0I8 6.29e-06 49 49 0 53 3 hasC UTP--glucose-1-phosphate uridylyltransferase Streptococcus pyogenes
Q8NKW9 6.29e-06 49 49 0 53 3 hasC1 UTP--glucose-1-phosphate uridylyltransferase 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9A7 6.4e-06 49 49 0 53 3 hasC2 UTP--glucose-1-phosphate uridylyltransferase 2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DG71 6.4e-06 49 49 0 53 3 hasC1 UTP--glucose-1-phosphate uridylyltransferase 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG70 6.4e-06 49 49 0 53 3 hasC1 UTP--glucose-1-phosphate uridylyltransferase 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0C0I9 6.96e-06 49 49 0 53 3 hasC1 UTP--glucose-1-phosphate uridylyltransferase 1 Streptococcus pyogenes serotype M1
Q54800 2.17e-05 48 47 0 53 3 cap3C UTP--glucose-1-phosphate uridylyltransferase Streptococcus pneumoniae
Q4A122 2.3e-05 47 38 2 86 3 gtaB1 UTP--glucose-1-phosphate uridylyltransferase 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GDU6 2.67e-05 47 48 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain MRSA252)
P58313 2.79e-05 47 45 0 53 3 cap4C UTP--glucose-1-phosphate uridylyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P39629 2.89e-05 47 40 1 65 1 rmlA Glucose-1-phosphate thymidylyltransferase Bacillus subtilis (strain 168)
A5PJI7 3.11e-05 47 24 5 161 2 EIF2B3 Translation initiation factor eIF2B subunit gamma Bos taurus
D4GU70 3.27e-05 47 24 7 194 3 agl11 Low-salt glycan biosynthesis nucleotidyltransferase Agl11 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q2YW63 3.7e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3J9 3.8e-05 47 46 0 54 1 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain N315)
Q99RD4 3.8e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HD54 3.8e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain COL)
Q2G1T6 3.8e-05 47 46 0 54 1 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FE05 3.8e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain USA300)
Q8NUU9 3.87e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain MW2)
Q6G6H5 3.87e-05 47 46 0 54 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus aureus (strain MSSA476)
Q8CR67 4.49e-05 47 47 0 53 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLD1 4.49e-05 47 47 0 53 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O31822 4.75e-05 47 44 0 54 1 yngB UTP--glucose-1-phosphate uridylyltransferase YngB Bacillus subtilis (strain 168)
P70541 5.15e-05 47 25 6 161 2 Eif2b3 Translation initiation factor eIF2B subunit gamma Rattus norvegicus
Q49VP4 5.18e-05 47 47 0 53 3 gtaB2 UTP--glucose-1-phosphate uridylyltransferase 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0ZQ41 6.05e-05 47 33 3 110 1 frbH CMP-5'-(3-aminopropyl)phosphonate synthase Streptomyces rubellomurinus (strain ATCC 31215)
Q4L8Y7 6.63e-05 46 47 0 53 3 gtaB UTP--glucose-1-phosphate uridylyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q975F9 6.81e-05 46 42 1 66 1 STK_04520 Bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
O67379 7.07e-05 46 36 2 86 1 spsI Bifunctional IPC transferase and DIPP synthase Aquifex aeolicus (strain VF5)
Q9KGJ6 0.000114 46 25 8 237 3 glmU Bifunctional protein GlmU Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O29976 0.000128 46 32 5 101 1 AF_0263 Bifunctional IPC transferase and DIPP synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q88QT2 0.00013 45 29 3 108 1 murU N-acetylmuramate alpha-1-phosphate uridylyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0P8J1 0.00025 44 38 0 55 1 hddC D-glycero-alpha-D-manno-heptose 1-phosphate guanylyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P74285 0.000349 44 37 0 61 1 cugP UTP--glucose-1-phosphate uridylyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P32501 0.000504 44 26 2 105 1 GCD6 Translation initiation factor eIF2B subunit epsilon Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9NR50 0.000542 44 24 5 158 1 EIF2B3 Translation initiation factor eIF2B subunit gamma Homo sapiens
P87163 0.000757 43 33 1 63 3 GCD6 Translation initiation factor eIF2B subunit epsilon Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4R6T3 0.000795 43 24 5 158 2 EIF2B3 Translation initiation factor eIF2B subunit gamma Macaca fascicularis

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17180
Feature type CDS
Gene -
Product NTP transferase domain-containing protein
Location 68291 - 68989 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2896
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF12804 MobA-like NTP transferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4750 Cell wall/membrane/envelope biogenesis (M)
Lipid transport and metabolism (I)		 MI CTP:phosphocholine cytidylyltransferase LicC

Protein Sequence

MNAIILAAGLGSRFGDITKTTHKALLPIGGIPNIERTIQYLLEFGINEIVIVTGHLAHQFKYLEEKYSCTLIHNEHYEKYNNIYSFCKITNYLSDTIVIDADVVLLKNIFIKSDSSLYYTVKRTTPESEWIPILNEKGFIDRIEIKEPTAPSLLGVSYWKKSESTKILDALSQFNDDVSLNNAKLYWDNIPMSIIKELNMKTHEVSSYFAGEMDNIDNYNDISKLALTIKAL

Flanking regions ( +/- flanking 50bp)

ATCGCAGGTGCATTAATTACGAATCTACAATCAAAGGAAGTTTTAGTAAAATGAATGCAATAATTTTAGCTGCGGGTCTTGGTTCTCGCTTTGGTGATATAACAAAAACAACGCATAAAGCCTTATTACCTATTGGCGGAATACCAAATATTGAAAGAACAATTCAATACTTATTAGAATTTGGTATTAATGAGATTGTCATTGTCACAGGTCACCTTGCTCATCAATTCAAGTACCTGGAAGAAAAATACAGTTGCACTCTGATACACAATGAGCACTACGAAAAATACAACAACATATACTCATTTTGTAAGATAACTAATTATCTTAGCGATACAATCGTCATTGATGCCGATGTTGTACTTCTCAAGAATATATTTATTAAAAGTGACTCAAGCCTCTATTATACAGTCAAACGGACAACACCAGAAAGTGAGTGGATCCCAATCTTAAATGAAAAAGGGTTCATTGACAGAATAGAAATCAAAGAGCCAACTGCACCATCATTGCTCGGTGTTTCATACTGGAAAAAATCAGAATCGACAAAAATATTAGATGCCCTATCTCAGTTTAATGATGATGTTAGTTTAAATAATGCCAAACTCTATTGGGATAACATCCCCATGTCCATAATAAAAGAATTAAATATGAAAACTCATGAGGTTTCATCTTATTTCGCCGGAGAAATGGATAATATAGATAATTATAATGATATTAGTAAGCTTGCATTAACAATAAAAGCATTATGATAAAAAAAATACTAAACCATTCATTAGTAAAAAATGCTACTTCATTAGGC