Homologs in group_3006

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17470 FBDBKF_17470 78.8 Morganella morganii S1 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
EHELCC_17365 EHELCC_17365 78.8 Morganella morganii S2 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
NLDBIP_17830 NLDBIP_17830 78.8 Morganella morganii S4 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
LHKJJB_17750 LHKJJB_17750 78.8 Morganella morganii S3 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
HKOGLL_17760 HKOGLL_17760 78.8 Morganella morganii S5 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Distribution of the homologs in the orthogroup group_3006

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3006

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P32398 7.34e-05 45 57 0 35 4 yhgD Uncharacterized HTH-type transcriptional regulator YhgD Bacillus subtilis (strain 168)
P43506 0.000235 43 35 0 56 1 bm3R1 HTH-type transcriptional repressor Bm3R1 Priestia megaterium
Q8GLC6 0.001 42 26 0 67 3 icaR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR Staphylococcus epidermidis

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16645
Feature type CDS
Gene -
Product TetR/AcrR family transcriptional regulator
Location 152364 - 152990 (strand: 1)
Length 627 (nucleotides) / 208 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000006
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3006
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Protein Sequence

MATEPAAKTKGRGRPVVPEQELIAKIHKASLNLLLSQGYTATTMDAVAKEAGVSKKTLYRFVENREDLIEQIVRGWTDTFVPLFTRDTKDKTEFCQLLAEHLTVMSNKVLSAEAVGLFCLLSSEFPGREALLARYQTSGIERGRALLTEWLSRHRDFLPLPDPAQVSDLLLSMVIAEPLRQIALKLAPPAPDYPVGTRITAAIALLKQ

Flanking regions ( +/- flanking 50bp)

TAAATTAATATCGTCACTAAACGGGTATTTGTCAATTGAGGATCGCACGTATGGCTACAGAACCTGCCGCAAAAACAAAAGGCCGGGGACGTCCGGTTGTACCGGAACAGGAACTTATCGCAAAGATCCATAAAGCTTCGCTTAACCTGCTGTTATCACAGGGTTATACAGCCACCACGATGGATGCGGTTGCAAAAGAAGCAGGGGTATCAAAGAAAACGCTGTATCGTTTTGTTGAGAACAGAGAAGACCTGATTGAACAGATTGTCCGTGGCTGGACTGACACATTTGTGCCGCTGTTTACGCGGGATACAAAAGATAAAACAGAATTTTGTCAATTACTGGCGGAGCATCTGACTGTAATGAGCAACAAAGTTCTGAGTGCTGAGGCGGTTGGTCTGTTTTGCCTGCTGAGCAGTGAATTTCCCGGACGGGAGGCGCTGCTGGCACGATATCAGACGAGTGGCATTGAGCGCGGGCGCGCATTACTGACGGAATGGCTTTCCCGCCACCGGGATTTTTTACCGCTGCCGGACCCGGCACAGGTTAGTGACTTGCTGCTATCAATGGTGATTGCTGAGCCACTGCGTCAGATTGCCCTGAAACTGGCACCACCCGCACCGGATTACCCGGTTGGGACGCGCATTACCGCTGCAATTGCATTGCTGAAACAGTGACAGGTACCGGCGTTAAACCGGTACCTGGCGCAGGGCTTATTTCTGAATAA