Homologs in group_2271

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17460 FBDBKF_17460 93.4 Morganella morganii S1 rdgC recombination-associated protein RdgC
EHELCC_17355 EHELCC_17355 93.4 Morganella morganii S2 rdgC recombination-associated protein RdgC
NLDBIP_17840 NLDBIP_17840 93.4 Morganella morganii S4 rdgC recombination-associated protein RdgC
LHKJJB_17760 LHKJJB_17760 93.4 Morganella morganii S3 rdgC recombination-associated protein RdgC
HKOGLL_17770 HKOGLL_17770 93.4 Morganella morganii S5 rdgC recombination-associated protein RdgC
PMI_RS00210 PMI_RS00210 72.4 Proteus mirabilis HI4320 rdgC recombination-associated protein RdgC

Distribution of the homologs in the orthogroup group_2271

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2271

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N0G0 0.0 508 81 0 302 3 rdgC Recombination-associated protein RdgC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JNV0 1.12e-176 493 78 0 302 3 rdgC Recombination-associated protein RdgC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GAJ1 2.12e-176 492 77 0 302 3 rdgC Recombination-associated protein RdgC Serratia proteamaculans (strain 568)
B1JIG5 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TPJ2 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pestis (strain Pestoides F)
Q1CLB8 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZC18 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pestis
B2K6R1 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4F5 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLH3 5.14e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9R2W1 6.26e-176 491 79 0 302 3 rdgC Recombination-associated protein RdgC Yersinia pestis bv. Antiqua (strain Angola)
B2VIS2 4.43e-171 478 76 0 302 3 rdgC Recombination-associated protein RdgC Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6T5B7 1.06e-166 468 75 0 302 3 rdgC Recombination-associated protein RdgC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y109 1.06e-166 468 75 0 302 3 rdgC Recombination-associated protein RdgC Klebsiella pneumoniae (strain 342)
P65973 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65974 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella typhi
B4TZG5 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella schwarzengrund (strain CVM19633)
A9MX46 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T8N1 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella heidelberg (strain SL476)
B5R5Y3 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FKP7 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella dublin (strain CT_02021853)
B5EWS4 3.02e-165 464 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella agona (strain SL483)
B4SWN2 5.27e-165 463 74 0 302 3 rdgC Recombination-associated protein RdgC Salmonella newport (strain SL254)
B7LMJ3 9.53e-165 462 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LIS7 2.95e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain SMS-3-5 / SECEC)
Q8FKD5 2.95e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MPF4 2.95e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O81 (strain ED1a)
Q32JE7 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Shigella dysenteriae serotype 1 (strain Sd197)
Q325K5 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Shigella boydii serotype 4 (strain Sb227)
B2U3Z6 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZJ3 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain SE11)
B7N8U5 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P36767 3.15e-164 461 73 0 302 1 rdgC Recombination-associated protein RdgC Escherichia coli (strain K12)
B1J055 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TKP7 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZX42 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O9:H4 (strain HS)
B1XEY2 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain K12 / DH10B)
C4ZTF1 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3N2 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O8 (strain IAI1)
B7NJA9 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L548 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli (strain 55989 / EAEC)
B7MD52 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJL7 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIE2 3.15e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O139:H28 (strain E24377A / ETEC)
B5Z2U5 4.56e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XEA1 4.56e-164 461 73 0 302 3 rdgC Recombination-associated protein RdgC Escherichia coli O157:H7
B4F2X9 6.46e-164 460 72 0 301 3 rdgC Recombination-associated protein RdgC Proteus mirabilis (strain HI4320)
Q83M63 7.15e-164 460 73 0 302 3 rdgC Recombination-associated protein RdgC Shigella flexneri
A4W767 3.21e-163 459 73 0 302 3 rdgC Recombination-associated protein RdgC Enterobacter sp. (strain 638)
Q3Z515 3.62e-163 458 73 0 302 3 rdgC Recombination-associated protein RdgC Shigella sonnei (strain Ss046)
C5BHP0 4e-159 448 72 0 299 3 rdgC Recombination-associated protein RdgC Edwardsiella ictaluri (strain 93-146)
Q2NVB3 8.72e-154 435 65 0 302 3 rdgC Recombination-associated protein RdgC Sodalis glossinidius (strain morsitans)
Q87S56 6.03e-125 362 58 0 298 3 rdgC Recombination-associated protein RdgC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MT92 7.26e-125 362 59 0 298 3 rdgC Recombination-associated protein RdgC Vibrio campbellii (strain ATCC BAA-1116)
C4K8J6 1.32e-124 361 55 0 301 3 rdgC Recombination-associated protein RdgC Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B7VJP8 8.18e-122 354 58 0 298 3 rdgC Recombination-associated protein RdgC Vibrio atlanticus (strain LGP32)
A1SWV9 3.25e-119 347 55 0 299 3 rdgC Recombination-associated protein RdgC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8DEV7 1.41e-118 345 58 0 298 3 rdgC Recombination-associated protein RdgC Vibrio vulnificus (strain CMCP6)
Q7MNJ5 7.83e-118 343 58 0 298 3 rdgC Recombination-associated protein RdgC Vibrio vulnificus (strain YJ016)
A0KMP9 4.21e-117 342 56 0 299 3 rdgC Recombination-associated protein RdgC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q65RK3 1.51e-116 340 55 2 301 3 rdgC Recombination-associated protein RdgC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VQG4 1.61e-116 340 54 2 301 3 rdgC Recombination-associated protein RdgC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C3LSX1 7.45e-116 338 54 0 298 3 rdgC Recombination-associated protein RdgC Vibrio cholerae serotype O1 (strain M66-2)
Q9KU12 7.45e-116 338 54 0 298 3 rdgC Recombination-associated protein RdgC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C4L7Q5 5.99e-114 334 55 0 299 3 rdgC Recombination-associated protein RdgC Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P57810 2.37e-112 330 52 2 302 3 rdgC Recombination-associated protein RdgC Pasteurella multocida (strain Pm70)
P44628 5.45e-108 318 53 3 303 1 rdgC Recombination-associated protein RdgC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGC4 5.45e-108 318 53 3 303 3 rdgC Recombination-associated protein RdgC Haemophilus influenzae (strain PittGG)
A8H6V1 4.33e-105 311 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TPG2 1.52e-104 310 51 0 298 3 rdgC Recombination-associated protein RdgC Shewanella halifaxensis (strain HAW-EB4)
Q8EGP3 1.99e-103 307 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KZ89 2.24e-102 304 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella sp. (strain ANA-3)
A8FYI7 3.66e-102 304 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella sediminis (strain HAW-EB3)
A3MYN3 8.67e-102 303 50 2 302 3 rdgC Recombination-associated protein RdgC Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q0HSZ1 1.02e-101 303 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella sp. (strain MR-7)
Q0HGN5 1.02e-101 303 50 0 298 3 rdgC Recombination-associated protein RdgC Shewanella sp. (strain MR-4)
A3QGL9 1.48e-100 300 49 0 298 3 rdgC Recombination-associated protein RdgC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1RLT1 3.03e-100 299 49 0 298 3 rdgC Recombination-associated protein RdgC Shewanella sp. (strain W3-18-1)
A4Y4Y9 4.79e-100 298 49 0 298 3 rdgC Recombination-associated protein RdgC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0BS66 2.57e-99 296 51 2 302 3 rdgC Recombination-associated protein RdgC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8CKL7 5.33e-99 296 48 0 298 3 rdgC Recombination-associated protein RdgC Shewanella piezotolerans (strain WP3 / JCM 13877)
A3D2D1 1.48e-98 295 48 0 298 3 rdgC Recombination-associated protein RdgC Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAS7 1.48e-98 295 48 0 298 3 rdgC Recombination-associated protein RdgC Shewanella baltica (strain OS223)
A9KTN4 8.31e-98 293 48 0 298 3 rdgC Recombination-associated protein RdgC Shewanella baltica (strain OS195)
A6WL23 1.26e-97 292 48 0 298 3 rdgC Recombination-associated protein RdgC Shewanella baltica (strain OS185)
Q12KQ6 3.38e-96 289 48 0 297 3 rdgC Recombination-associated protein RdgC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q07ZF4 1.19e-95 287 48 0 297 3 rdgC Recombination-associated protein RdgC Shewanella frigidimarina (strain NCIMB 400)
B3H003 2.53e-95 286 50 2 302 3 rdgC Recombination-associated protein RdgC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q1IDH6 2.42e-86 264 44 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas entomophila (strain L48)
Q88M72 2.61e-86 263 44 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KTR8 8e-86 262 44 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas putida (strain GB-1)
Q9HYX7 1.4e-84 259 45 1 300 1 rdgC Recombination-associated protein RdgC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3KFP5 1.87e-84 259 43 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas fluorescens (strain Pf0-1)
Q486R8 2.45e-84 258 43 0 289 3 rdgC Recombination-associated protein RdgC Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q02Q95 2.77e-84 258 45 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7J4 2.77e-84 258 45 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas aeruginosa (strain LESB58)
C3K7N8 4.42e-84 258 43 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas fluorescens (strain SBW25)
A6V2F6 5.2e-84 258 45 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas aeruginosa (strain PA7)
Q48LA4 2.99e-83 256 44 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87YA4 3.88e-83 255 43 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21NJ1 6.55e-83 255 39 1 298 3 rdgC Recombination-associated protein RdgC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q4ZW36 6.76e-82 252 43 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas syringae pv. syringae (strain B728a)
Q4K8D9 1.63e-80 249 42 1 300 3 rdgC Recombination-associated protein RdgC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3II43 7.08e-80 247 41 0 297 3 rdgC Recombination-associated protein RdgC Pseudoalteromonas translucida (strain TAC 125)
Q15X11 1.15e-79 246 40 2 285 3 rdgC Recombination-associated protein RdgC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1WYS1 2.27e-68 218 39 1 299 3 rdgC Recombination-associated protein RdgC Halorhodospira halophila (strain DSM 244 / SL1)
A4G416 2.84e-66 212 37 2 299 3 rdgC Recombination-associated protein RdgC Herminiimonas arsenicoxydans
A6SX69 8.95e-66 211 37 2 302 3 rdgC Recombination-associated protein RdgC Janthinobacterium sp. (strain Marseille)
Q478Z5 2.61e-65 210 37 3 302 3 rdgC Recombination-associated protein RdgC Dechloromonas aromatica (strain RCB)
B2JRS8 2.8e-63 204 36 2 299 3 rdgC Recombination-associated protein RdgC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q46X89 3.61e-63 204 36 2 299 3 rdgC Recombination-associated protein RdgC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7W7A7 7.49e-62 201 34 2 299 3 rdgC Recombination-associated protein RdgC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VVS6 8.99e-62 201 34 2 299 3 rdgC Recombination-associated protein RdgC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WKP4 8.99e-62 201 34 2 299 3 rdgC Recombination-associated protein RdgC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B4EK21 4.81e-61 199 37 2 299 3 rdgC Recombination-associated protein RdgC Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q0K6V7 3.48e-60 196 37 2 299 3 rdgC Recombination-associated protein RdgC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8Y1S1 1.01e-59 196 35 2 299 3 rdgC Recombination-associated protein RdgC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B3R6L9 1.63e-59 195 37 2 299 3 rdgC Recombination-associated protein RdgC Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B1K4Q5 5.27e-59 194 36 2 298 3 rdgC Recombination-associated protein RdgC Burkholderia orbicola (strain MC0-3)
B1YWR8 1.47e-57 190 35 2 299 3 rdgC Recombination-associated protein RdgC Burkholderia ambifaria (strain MC40-6)
B4SRP4 3.3e-56 186 35 3 292 3 rdgC Recombination-associated protein RdgC Stenotrophomonas maltophilia (strain R551-3)
C1D4B9 1.41e-55 185 36 5 302 3 rdgC Recombination-associated protein RdgC Laribacter hongkongensis (strain HLHK9)
Q8P3H3 3.64e-52 176 34 2 297 3 rdgC Recombination-associated protein RdgC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RYY7 3.64e-52 176 34 2 297 3 rdgC Recombination-associated protein RdgC Xanthomonas campestris pv. campestris (strain B100)
Q4UNZ6 3.64e-52 176 34 2 297 3 rdgC Recombination-associated protein RdgC Xanthomonas campestris pv. campestris (strain 8004)
Q8PEW7 4.8e-51 173 33 2 290 3 rdgC Recombination-associated protein RdgC Xanthomonas axonopodis pv. citri (strain 306)
Q5GUF4 1.58e-50 172 33 2 290 3 rdgC Recombination-associated protein RdgC Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SIG8 1.58e-50 172 33 2 290 3 rdgC Recombination-associated protein RdgC Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NXR4 1.63e-50 172 33 2 290 3 rdgC Recombination-associated protein RdgC Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4RKD1 3.91e-49 168 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria gonorrhoeae (strain NCCP11945)
O87408 3.91e-49 168 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KT92 4.45e-49 168 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JZY2 4.45e-49 168 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M3Z9 4.45e-49 168 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria meningitidis serogroup C (strain 053442)
Q87B84 7.55e-49 167 33 3 292 3 rdgC Recombination-associated protein RdgC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7H2 7.55e-49 167 33 3 292 3 rdgC Recombination-associated protein RdgC Xylella fastidiosa (strain M23)
Q9JV02 8.28e-49 167 34 4 299 3 rdgC Recombination-associated protein RdgC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9PFT9 1.13e-48 167 33 3 292 3 rdgC Recombination-associated protein RdgC Xylella fastidiosa (strain 9a5c)
B0U454 1.16e-48 167 33 3 292 3 rdgC Recombination-associated protein RdgC Xylella fastidiosa (strain M12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16635
Feature type CDS
Gene rdgC
Product recombination-associated protein RdgC
Location 150602 - 151510 (strand: 1)
Length 909 (nucleotides) / 302 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2271
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04381 Putative exonuclease, RdgC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2974 Replication, recombination and repair (L) L DNA recombination-dependent growth factor RdgC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03554 recombination associated protein RdgC - -

Protein Sequence

MWFKNILVYRLSSPFPLSADELEKQLEHSAFTPCGSQDMMKTGWVSPMGSRSEALTHSAGKQILICTRKEEKMLPSTVIKQELQAKIERLEHEQHRKLKKTEKDSLKDEVVHALLPRAFSRFSQTTIWIDTERDLIIVDAASAKRAEDNLALLRKALGSLPVIPLTTKDPIELTLTEWVRSGDLPTGFVLMDEAELKAILEDGGVIRCKKQDLVSDEIATCIEAGKCVTKLALDWEERIQFLISDDGSIKRLKFSDDLKDKNEDIDREDFAQRFDADFILMTGELSALISNTIDALGGEAER

Flanking regions ( +/- flanking 50bp)

ATGCTATCGTCACCGCGCAATGACTCCGCGCCATAAAACAGGACTGTCAGATGTGGTTTAAAAATATACTGGTTTACCGCCTTAGCTCCCCGTTCCCGCTGTCTGCTGATGAACTGGAAAAGCAGCTGGAGCACTCGGCTTTCACACCATGCGGCAGTCAGGACATGATGAAAACCGGCTGGGTATCGCCGATGGGCTCCCGGAGTGAAGCGCTGACTCATTCTGCCGGTAAACAGATCCTTATCTGTACCCGTAAAGAAGAGAAAATGCTGCCATCTACTGTGATCAAGCAGGAATTACAGGCAAAAATCGAAAGACTGGAGCATGAGCAGCACCGGAAACTGAAAAAAACCGAAAAAGACTCCCTGAAAGATGAAGTGGTTCACGCCTTACTGCCACGCGCATTCAGCCGTTTCAGTCAGACCACTATCTGGATTGACACAGAGCGCGACCTTATTATTGTCGATGCCGCCAGCGCCAAACGGGCGGAAGATAACCTGGCACTGCTGCGTAAAGCACTGGGATCGTTGCCTGTAATCCCGTTGACCACTAAAGATCCGATTGAACTGACCTTAACCGAATGGGTGCGCTCAGGGGATTTACCAACCGGTTTTGTGCTGATGGATGAAGCTGAGCTGAAAGCTATTCTGGAAGATGGCGGCGTAATCCGCTGTAAAAAACAGGATTTGGTTTCAGATGAAATCGCCACCTGTATCGAGGCCGGTAAATGTGTGACCAAGCTGGCACTTGACTGGGAAGAGCGGATACAATTCCTTATCTCTGATGACGGCTCCATTAAGCGCCTGAAATTCAGTGACGATCTGAAAGATAAAAACGAAGATATCGATCGCGAAGATTTCGCCCAGCGTTTTGATGCTGATTTTATCCTGATGACCGGCGAACTGAGTGCCCTTATCAGCAATACCATTGATGCGCTCGGCGGCGAAGCCGAACGCTGATTTGACTGAAACGGGAGCCCCGCTTGTGGCGCTCCCGCTGTTTTTTGTTA