Homologs in group_2261

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17405 FBDBKF_17405 97.3 Morganella morganii S1 tgt tRNA guanosine(34) transglycosylase Tgt
EHELCC_17300 EHELCC_17300 97.3 Morganella morganii S2 tgt tRNA guanosine(34) transglycosylase Tgt
NLDBIP_17895 NLDBIP_17895 97.3 Morganella morganii S4 tgt tRNA guanosine(34) transglycosylase Tgt
LHKJJB_17815 LHKJJB_17815 97.3 Morganella morganii S3 tgt tRNA guanosine(34) transglycosylase Tgt
HKOGLL_17825 HKOGLL_17825 97.3 Morganella morganii S5 tgt tRNA guanosine(34) transglycosylase Tgt
PMI_RS00365 PMI_RS00365 90.1 Proteus mirabilis HI4320 tgt tRNA guanosine(34) transglycosylase Tgt

Distribution of the homologs in the orthogroup group_2261

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2261

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DB26 0.0 729 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GAM5 0.0 729 91 0 374 3 tgt Queuine tRNA-ribosyltransferase Serratia proteamaculans (strain 568)
Q6D855 0.0 728 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JIE9 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DW5 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPH6 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CLA2 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R351 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC33 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis
B2K6S6 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4H4 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLF5 0.0 723 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JNT0 0.0 721 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7MB01 0.0 718 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4W779 0.0 718 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Enterobacter sp. (strain 638)
B4EU13 0.0 717 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Proteus mirabilis (strain HI4320)
Q8Z8Y0 0.0 717 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhi
Q8ZRD8 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TZI0 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MX29 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SWP7 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella newport (strain SL254)
B4T8P5 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella heidelberg (strain SL476)
B5EWT9 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella agona (strain SL483)
B5R6Q7 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTF4 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FKR0 0.0 716 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella dublin (strain CT_02021853)
B5BDC8 0.0 715 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PFT6 0.0 715 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8AK48 0.0 715 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q7S9 0.0 714 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi C (strain RKS4594)
Q57SF8 0.0 714 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella choleraesuis (strain SC-B67)
B2VHQ1 0.0 712 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BCF7 0.0 712 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Edwardsiella ictaluri (strain 93-146)
A9MM57 0.0 711 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6T5D8 0.0 711 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y0Y6 0.0 711 89 0 374 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae (strain 342)
Q2NVA4 0.0 706 90 0 372 3 tgt Queuine tRNA-ribosyltransferase Sodalis glossinidius (strain morsitans)
Q3Z503 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella sonnei (strain Ss046)
Q32JG0 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q325J5 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U4K7 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LMI1 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RFD5 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LJF4 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZK6 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SE11)
B7N8V8 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A847 0.0 706 88 0 374 1 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12)
B1J043 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A848 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKN5 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A876 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O1:K1 / APEC
A7ZX57 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O9:H4 (strain HS)
B1XEZ4 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZTG3 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3P5 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O8 (strain IAI1)
B7MPG7 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O81 (strain ED1a)
B7NJ96 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2W2 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A849 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7
B7L639 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MD64 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJM9 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIF8 0.0 706 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q54177 0.0 705 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri
Q0T7I3 0.0 705 88 0 374 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri serotype 5b (strain 8401)
C4L7L3 0.0 690 86 0 373 3 tgt Queuine tRNA-ribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KJ20 0.0 678 84 0 373 3 tgt Queuine tRNA-ribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SP26 0.0 676 83 0 373 3 tgt Queuine tRNA-ribosyltransferase Aeromonas salmonicida (strain A449)
B8F3W0 0.0 671 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
B7VJR8 0.0 668 82 0 372 3 tgt Queuine tRNA-ribosyltransferase Vibrio atlanticus (strain LGP32)
Q6LU69 0.0 668 84 0 373 3 tgt Queuine tRNA-ribosyltransferase Photobacterium profundum (strain SS9)
P57831 0.0 664 83 1 378 3 tgt Queuine tRNA-ribosyltransferase Pasteurella multocida (strain Pm70)
A5F3H2 0.0 661 82 0 373 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LSZ4 0.0 660 82 0 373 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTY9 0.0 660 82 0 373 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44594 0.0 657 82 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UG47 0.0 656 82 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittGG)
A5UAP3 0.0 656 82 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittEE)
B3GXF8 0.0 655 82 1 378 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N087 0.0 655 82 1 378 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4QNU3 0.0 654 82 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain 86-028NP)
Q7MNH1 0.0 654 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain YJ016)
Q8DEY0 0.0 654 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain CMCP6)
B0BP03 0.0 654 81 1 378 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3QFF5 0.0 653 81 0 373 3 tgt Queuine tRNA-ribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B5F9Y3 0.0 653 81 0 373 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain MJ11)
Q5E3D2 0.0 653 81 0 373 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7VLQ4 0.0 652 82 1 376 3 tgt Queuine tRNA-ribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0HWQ9 0.0 650 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-7)
Q0HKF7 0.0 650 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-4)
A0KV50 0.0 650 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain ANA-3)
B6EK65 0.0 650 81 0 373 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio salmonicida (strain LFI1238)
Q8ECM3 0.0 649 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87S36 0.0 648 80 0 373 3 tgt Queuine tRNA-ribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q07ZM2 0.0 648 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
A1S7P2 0.0 648 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A7MT83 0.0 646 79 0 373 3 tgt Queuine tRNA-ribosyltransferase Vibrio campbellii (strain ATCC BAA-1116)
A1RI67 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain W3-18-1)
A4Y8C2 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A8H2K8 0.0 646 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8CLC5 0.0 646 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A9KUN0 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS195)
A6WQ52 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS185)
A3D6B1 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDJ7 0.0 646 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS223)
A8FXC6 0.0 644 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella sediminis (strain HAW-EB3)
B0TND4 0.0 644 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
Q12PD9 0.0 641 80 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0I4R8 0.0 640 79 1 374 3 tgt Queuine tRNA-ribosyltransferase Histophilus somni (strain 129Pt)
A1SWU0 0.0 637 79 0 374 3 tgt Queuine tRNA-ribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6VN75 0.0 634 79 1 376 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65S94 0.0 627 78 1 376 3 tgt Queuine tRNA-ribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C4K8M3 0.0 617 76 0 369 3 tgt Queuine tRNA-ribosyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q15WI4 0.0 595 75 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1LSP0 0.0 594 74 0 364 3 tgt Queuine tRNA-ribosyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q5QVL2 0.0 578 71 1 372 3 tgt Queuine tRNA-ribosyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9HXH9 0.0 575 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RX7 0.0 575 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVU4 0.0 575 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain LESB58)
Q3ILB8 0.0 574 72 1 373 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q31FZ5 0.0 567 71 1 372 3 tgt Queuine tRNA-ribosyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
C1DE76 0.0 565 70 1 373 3 tgt Queuine tRNA-ribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q887B0 0.0 561 69 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88PL7 0.0 559 69 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1QTM9 0.0 558 69 1 374 3 tgt Queuine tRNA-ribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q21KW1 0.0 555 68 1 374 3 tgt Queuine tRNA-ribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1TZN7 0.0 551 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q493H3 0.0 544 65 0 367 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q6FEJ4 0.0 542 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0VRA8 0.0 539 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain SDF)
B0V625 0.0 538 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AYE)
A3M8S3 0.0 538 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HYN7 0.0 538 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ACICU)
B7I976 0.0 538 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GWL4 0.0 538 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB307-0294)
B8GTQ4 0.0 538 66 1 372 3 tgt Queuine tRNA-ribosyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B0TYY3 0.0 535 68 1 363 3 tgt Queuine tRNA-ribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2SHD4 0.0 527 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IYF8 0.0 526 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFU8 0.0 526 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q6X1 0.0 526 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. novicida (strain U112)
Q14HA0 0.0 526 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BMC7 0.0 526 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Y7 0.0 526 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7NBL6 0.0 526 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5CW46 0.0 525 66 0 366 3 tgt Queuine tRNA-ribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A5WGS6 0.0 523 64 2 380 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter sp. (strain PRwf-1)
Q4FRI6 0.0 523 65 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QA23 0.0 520 64 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B8D738 0.0 520 62 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8T4 0.0 519 62 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57233 0.0 518 62 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q0AG55 0.0 517 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q5P720 0.0 514 67 0 361 3 tgt Queuine tRNA-ribosyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q82VF0 0.0 513 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q47AX3 0.0 513 67 0 361 3 tgt Queuine tRNA-ribosyltransferase Dechloromonas aromatica (strain RCB)
Q1H403 0.0 512 68 1 363 3 tgt Queuine tRNA-ribosyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8KA09 0.0 511 62 1 366 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1LJ59 0.0 509 66 1 368 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7VQB1 1.19e-179 506 62 1 362 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella floridana
C1DDA7 6.63e-179 504 65 0 364 3 tgt Queuine tRNA-ribosyltransferase Laribacter hongkongensis (strain HLHK9)
Q2Y6A3 7.41e-179 504 64 0 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6SUU4 1.71e-178 503 64 1 367 3 tgt Queuine tRNA-ribosyltransferase Janthinobacterium sp. (strain Marseille)
A4G1Z3 1.82e-178 503 65 1 367 3 tgt Queuine tRNA-ribosyltransferase Herminiimonas arsenicoxydans
B0RRR1 1.31e-177 501 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
B3R6J4 2.42e-177 500 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q8P868 3.33e-177 500 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVX2 3.33e-177 500 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q46XG4 4.51e-177 499 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3BS37 1.79e-176 498 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PJL7 1.81e-176 498 63 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
A1K3W9 1.82e-176 498 64 0 361 3 tgt Queuine tRNA-ribosyltransferase Azoarcus sp. (strain BH72)
B2FN00 8.18e-176 496 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain K279a)
B4SSS1 1.24e-175 496 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q0K733 5.55e-175 494 64 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5GZY3 1.72e-174 493 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SIN8 1.72e-174 493 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2X0 1.72e-174 493 62 1 373 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5EW66 1.55e-173 490 62 2 363 3 tgt Queuine tRNA-ribosyltransferase Dichelobacter nodosus (strain VCS1703A)
Q3SH61 1.18e-172 488 63 1 362 3 tgt Queuine tRNA-ribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B2UC75 5.27e-172 487 65 2 363 3 tgt Queuine tRNA-ribosyltransferase Ralstonia pickettii (strain 12J)
Q7NYC7 6.21e-172 486 62 0 369 3 tgt Queuine tRNA-ribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B5EK08 1.2e-171 486 63 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4R9 1.2e-171 486 63 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q8XVW4 1.09e-170 484 65 2 363 3 tgt Queuine tRNA-ribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A2SM97 2.31e-166 473 60 1 366 3 tgt Queuine tRNA-ribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9PGS5 3.91e-166 472 61 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain 9a5c)
Q9JVA4 1.68e-164 468 59 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B1XWG6 3.54e-164 468 59 3 384 3 tgt Queuine tRNA-ribosyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q87EW6 4.37e-164 467 61 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6T4 4.37e-164 467 61 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M23)
B0U1P6 7.03e-164 466 61 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M12)
Q12GB2 1.14e-163 466 59 3 389 3 tgt Queuine tRNA-ribosyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1KSY1 1.18e-163 465 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B4RJY2 1.34e-163 465 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F9U5 1.8e-163 465 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1VJ15 2.09e-163 465 61 1 355 3 tgt Queuine tRNA-ribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
A9M374 2.82e-163 464 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q9K096 7.8e-163 463 59 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1WCK2 7.45e-161 459 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax sp. (strain JS42)
B9MGI1 1.64e-160 458 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax ebreus (strain TPSY)
A9BRD7 2.1e-157 450 57 3 381 3 tgt Queuine tRNA-ribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1TVN0 4.18e-157 449 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Paracidovorax citrulli (strain AAC00-1)
A1WFH2 2.65e-155 445 57 3 381 3 tgt Queuine tRNA-ribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
B0K0M1 2.64e-154 442 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter sp. (strain X514)
Q65GP9 7.54e-154 441 58 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O32053 1.65e-153 440 57 1 359 3 tgt Queuine tRNA-ribosyltransferase Bacillus subtilis (strain 168)
B0K959 4.14e-153 439 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A0AIX9 3.25e-152 437 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P28720 7.98e-152 436 57 1 366 1 tgt Queuine tRNA-ribosyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q92BI4 8.32e-152 436 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DHL8 2.11e-151 435 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
A7Z766 6.1e-151 434 57 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8Y700 8.34e-151 433 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZE0 8.34e-151 433 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVH7 8.34e-151 433 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8RAM9 8.93e-151 433 56 2 366 3 tgt Queuine tRNA-ribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B5YHX4 1.6e-150 432 54 0 361 3 tgt Queuine tRNA-ribosyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B8FQV2 2.22e-150 432 58 1 356 3 tgt Queuine tRNA-ribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B1HVA1 8.57e-150 431 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Lysinibacillus sphaericus (strain C3-41)
A8FFQ9 1.82e-149 430 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Bacillus pumilus (strain SAFR-032)
B9E716 6.3e-149 428 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Macrococcus caseolyticus (strain JCSC5402)
A4J541 1.62e-148 427 58 2 353 3 tgt Queuine tRNA-ribosyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q9KDI5 1.92e-148 427 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P66906 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MW2)
A8Z2G7 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T0 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GG65 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MRSA252)
P66905 3.7e-148 426 57 1 355 1 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain N315)
P66904 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI1 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Newman)
Q5HFC4 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain COL)
A5ITG3 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH9)
Q2FXT6 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG88 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300)
A6U2A7 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH1)
A7X354 3.7e-148 426 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A4IRA9 3.74e-148 426 56 1 359 3 tgt Queuine tRNA-ribosyltransferase Geobacillus thermodenitrificans (strain NG80-2)
B7GFN1 5.78e-148 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B8CXG0 6.38e-148 426 56 1 356 3 tgt Queuine tRNA-ribosyltransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A3DE13 6.6e-148 426 55 3 370 3 tgt Queuine tRNA-ribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2YT91 1.61e-147 425 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5WHR2 3.77e-147 424 56 1 357 3 tgt Queuine tRNA-ribosyltransferase Shouchella clausii (strain KSM-K16)
Q5KWR4 3.92e-147 424 56 1 359 3 tgt Queuine tRNA-ribosyltransferase Geobacillus kaustophilus (strain HTA426)
Q8CXC4 4.71e-147 424 54 2 368 3 tgt Queuine tRNA-ribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A5D3G6 1.35e-146 422 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8I6M0 3.18e-146 421 54 2 368 3 tgt Queuine tRNA-ribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B9DNG7 6.27e-146 421 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus carnosus (strain TM300)
Q4L6Y4 6.76e-146 421 56 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q817W6 9.37e-146 420 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE51 9.37e-146 420 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain B4264)
B7IIS9 9.37e-146 420 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain G9842)
A9VIP3 2.56e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus mycoides (strain KBAB4)
Q6HDA9 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634C7 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ZK / E33L)
B7HQH6 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH187)
C1ESW1 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain 03BB102)
Q730B4 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JQ03 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH820)
Q81LH2 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis
A0RJ24 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis (strain Al Hakam)
C3L6U6 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9A4 3.25e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain A0248)
B9IYZ1 3.59e-145 419 53 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain Q1)
Q8CML7 6.13e-145 418 56 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNR2 6.13e-145 418 56 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A7GT99 1.37e-144 417 55 1 359 3 tgt Queuine tRNA-ribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q837E7 4.11e-144 416 54 3 370 3 tgt Queuine tRNA-ribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q67Q92 2.27e-143 415 55 3 369 3 tgt Queuine tRNA-ribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C0QKY2 8.86e-143 412 54 0 359 3 tgt Queuine tRNA-ribosyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A3PJT9 1.46e-142 412 57 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J2H4 1.65e-142 412 57 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A8F2K6 1.66e-142 411 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia massiliae (strain Mtu5)
Q2G639 5.9e-142 410 56 1 363 3 tgt Queuine tRNA-ribosyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B2A5K8 7.61e-142 410 54 2 365 3 tgt Queuine tRNA-ribosyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A8GTF4 6.3e-141 407 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Sheila Smith)
B0BUZ2 6.3e-141 407 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Iowa)
A8GUA5 8.65e-141 407 57 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain OSU 85-389)
Q03ER2 1.68e-140 407 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A8GPN2 3.14e-140 405 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia akari (strain Hartford)
C4K0T2 3.86e-140 405 58 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia peacockii (strain Rustic)
Q8RDN0 4.69e-140 405 53 2 364 3 tgt Queuine tRNA-ribosyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q92GM6 5.18e-140 405 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PLJ4 5.18e-140 405 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia africae (strain ESF-5)
Q68W26 7.11e-140 405 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5LQ80 9.16e-140 405 55 1 361 3 tgt Queuine tRNA-ribosyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1GR26 2.91e-139 404 55 1 365 3 tgt Queuine tRNA-ribosyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2RHU3 3.23e-139 404 55 2 356 3 tgt Queuine tRNA-ribosyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
O67331 3.92e-139 404 51 5 380 3 tgt Queuine tRNA-ribosyltransferase Aquifex aeolicus (strain VF5)
Q1GIL3 4.22e-139 403 54 2 372 3 tgt Queuine tRNA-ribosyltransferase Ruegeria sp. (strain TM1040)
Q1RH25 9.73e-139 402 57 3 344 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain RML369-C)
C4XSI9 2.96e-138 401 53 0 358 3 tgt Queuine tRNA-ribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A8LRQ1 3.32e-138 401 58 1 353 3 tgt Queuine tRNA-ribosyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q4UN16 7.12e-138 400 55 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q30XF7 7.96e-138 400 51 0 360 3 tgt Queuine tRNA-ribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q9ZCK8 1.37e-136 396 57 1 343 3 tgt Queuine tRNA-ribosyltransferase Rickettsia prowazekii (strain Madrid E)
A0LFR2 3.64e-136 396 54 1 351 3 tgt Queuine tRNA-ribosyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A3CK60 4.57e-136 396 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus sanguinis (strain SK36)
Q28PC5 4.6e-136 395 55 1 361 3 tgt Queuine tRNA-ribosyltransferase Jannaschia sp. (strain CCS1)
B1I4K8 8.25e-136 395 54 1 364 3 tgt Queuine tRNA-ribosyltransferase Desulforudis audaxviator (strain MP104C)
P0DF87 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VG9 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RCC9 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JIT0 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNN4 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDS0 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P66910 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DF86 2.02e-135 394 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A8AUL3 2.35e-135 394 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B9DVZ9 2.86e-135 394 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B5XJL3 4.05e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1J8P1 4.05e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5XE18 4.82e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A4VW51 7.63e-135 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 05ZYH33)
A4W2F8 7.63e-135 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 98HAH33)
Q9A1L6 9.49e-135 392 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M1
Q9A7Y1 2.79e-134 391 53 2 363 3 tgt Queuine tRNA-ribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B1I9B4 5.99e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
C1CTW4 6.75e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CAA6 6.75e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain 70585)
C1CGY8 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain JJA)
P66908 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IMN3 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain CGSP14)
P66907 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZPB8 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E2X9 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q04IB3 8.04e-134 390 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q03IQ5 8.49e-134 390 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A8EZT7 9.45e-134 389 53 1 353 3 tgt Queuine tRNA-ribosyltransferase Rickettsia canadensis (strain McKiel)
Q8E1F9 2.19e-133 389 50 3 372 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E6X6 2.19e-133 389 50 3 372 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3K2Y7 2.19e-133 389 50 3 372 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5M2K9 3.11e-133 389 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
C1CN05 3.83e-133 388 52 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain P1031)
Q032U4 3.83e-133 388 52 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
A2RHN5 4.82e-133 388 52 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q5LY05 4.92e-133 388 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
C0MAH5 5.79e-133 388 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. equi (strain 4047)
Q8DVZ3 7.28e-133 387 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q88V05 9.15e-133 387 50 1 355 3 tgt Queuine tRNA-ribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q38YP9 1.03e-132 387 50 2 357 3 tgt Queuine tRNA-ribosyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
C0MEV8 1.07e-132 387 51 1 355 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
Q92PY4 1.64e-132 387 53 1 359 3 tgt Queuine tRNA-ribosyltransferase Rhizobium meliloti (strain 1021)
Q9CJ54 3.04e-132 386 52 2 360 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q1MPU5 5.78e-132 385 49 0 350 3 tgt Queuine tRNA-ribosyltransferase Lawsonia intracellularis (strain PHE/MN1-00)
Q72E53 1.33e-131 384 51 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A5N204 1.87e-131 384 49 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5Q6 1.87e-131 384 49 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain NBRC 12016)
Q0SRN5 2.07e-131 384 49 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain SM101 / Type A)
Q0TP15 2.07e-131 384 49 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A9HBJ2 2.92e-131 384 55 1 354 3 tgt Queuine tRNA-ribosyltransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q8XJ16 2.97e-131 384 49 2 367 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain 13 / Type A)
Q8UES8 3.29e-131 383 54 1 358 3 tgt Queuine tRNA-ribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A1VFP3 3.87e-131 383 51 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
B5YFK5 8.6e-131 383 52 3 367 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q0BVG4 1.08e-130 382 53 2 361 3 tgt Queuine tRNA-ribosyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B8E2N5 4.87e-130 381 51 3 367 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q98M57 8.49e-130 380 53 1 362 3 tgt Queuine tRNA-ribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8YHB2 4.13e-129 378 53 1 358 3 tgt Queuine tRNA-ribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1IVF1 4.24e-129 378 50 1 359 3 tgt Queuine tRNA-ribosyltransferase Koribacter versatilis (strain Ellin345)
A9AW42 4.81e-129 378 50 2 366 3 tgt Queuine tRNA-ribosyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q9RRB5 7.13e-129 378 49 1 364 3 tgt Queuine tRNA-ribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8G0K1 9.05e-129 377 53 1 358 3 tgt Queuine tRNA-ribosyltransferase Brucella suis biovar 1 (strain 1330)
C4Z563 1.05e-128 377 49 4 370 3 tgt Queuine tRNA-ribosyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q72H19 1.45e-127 374 50 2 372 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SLI7 1.8e-127 374 50 2 372 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B8HX02 2.51e-126 371 49 2 360 3 tgt Queuine tRNA-ribosyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q97GT3 1.6e-125 369 48 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B9K8N7 5.5e-125 367 50 3 360 3 tgt Queuine tRNA-ribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q892A0 1.38e-124 366 47 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium tetani (strain Massachusetts / E88)
A7GHT6 1.64e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IMF1 1.64e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Okra / Type B1)
A5IM22 1.78e-124 366 49 3 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1P7 1.78e-124 366 49 3 363 1 tgt Queuine tRNA-ribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5I6E9 2.18e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY17 2.18e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B1L0B0 2.51e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
C1FKF9 2.51e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
C3KTD0 2.51e-124 366 49 2 356 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
B1LB70 2.82e-124 365 49 3 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga sp. (strain RQ2)
Q7UWK9 1.26e-123 364 52 2 356 3 tgt Queuine tRNA-ribosyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C0R0X6 8.46e-123 362 47 1 347 3 tgt Queuine tRNA-ribosyltransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B9L8E1 3.77e-122 360 47 2 369 3 tgt Queuine tRNA-ribosyltransferase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A6LMW2 6.25e-122 359 48 1 360 3 tgt Queuine tRNA-ribosyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q7M8N8 8.63e-122 359 48 3 373 3 tgt Queuine tRNA-ribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B7IDU1 2.17e-121 358 48 1 360 3 tgt Queuine tRNA-ribosyltransferase Thermosipho africanus (strain TCF52B)
O08314 2.73e-121 358 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q17YB5 3.95e-121 357 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter acinonychis (strain Sheeba)
Q8GAA6 5.39e-121 357 46 1 366 3 tgt Queuine tRNA-ribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZMF4 1.58e-120 356 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
B2USB2 2.07e-120 355 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain Shi470)
A9KHU4 2.08e-120 356 47 4 374 3 tgt Queuine tRNA-ribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B5ZA47 2.33e-120 355 45 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain G27)
Q1CUM2 2.87e-120 355 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain HPAG1)
B6JKL0 3.34e-120 355 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain P12)
A5FSU3 1.26e-119 354 47 2 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q30S46 2.18e-119 353 46 2 372 3 tgt Queuine tRNA-ribosyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A7I2I6 2.35e-119 353 45 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q3ZAE2 2.87e-119 353 48 1 353 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A8ZRX7 4.94e-119 352 48 2 346 3 tgt Queuine tRNA-ribosyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q8YVT9 4.74e-118 350 48 3 354 3 tgt Queuine tRNA-ribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3ZWC1 5.03e-118 350 47 2 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain CBDB1)
Q8CWM7 5.29e-118 350 48 2 358 3 tgt Queuine tRNA-ribosyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q029K6 5.78e-118 350 50 2 347 3 tgt Queuine tRNA-ribosyltransferase Solibacter usitatus (strain Ellin6076)
B3DYE4 1.09e-117 349 46 3 371 3 tgt Queuine tRNA-ribosyltransferase Methylacidiphilum infernorum (isolate V4)
A6Q3Y5 1.35e-117 348 46 3 371 3 tgt Queuine tRNA-ribosyltransferase Nitratiruptor sp. (strain SB155-2)
Q0IDF3 1.59e-117 348 47 4 366 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9311)
Q7NMG4 2.38e-117 348 46 5 381 3 tgt Queuine tRNA-ribosyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A6Q906 4e-117 347 46 3 373 3 tgt Queuine tRNA-ribosyltransferase Sulfurovum sp. (strain NBC37-1)
A8ERD1 2e-116 345 44 2 373 3 tgt Queuine tRNA-ribosyltransferase Aliarcobacter butzleri (strain RM4018)
A7GYD5 6.49e-113 337 45 5 382 3 tgt Queuine tRNA-ribosyltransferase Campylobacter curvus (strain 525.92)
A0RPL5 1.11e-111 333 43 2 372 3 tgt Queuine tRNA-ribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
A7ZD89 1.51e-111 333 43 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter concisus (strain 13826)
A5USV3 4.06e-111 333 43 6 396 3 tgt Queuine tRNA-ribosyltransferase Roseiflexus sp. (strain RS-1)
A9BDP3 9.47e-111 331 46 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9211)
A2BUQ2 1.24e-110 331 45 1 344 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9515)
Q7TUG0 2.78e-110 330 45 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VHX2 2.99e-110 330 45 3 377 3 tgt Queuine tRNA-ribosyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A8G2T1 4.11e-110 329 44 1 345 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9215)
Q31CR1 1.48e-109 328 45 1 344 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9312)
A9FI06 2.67e-109 328 49 2 351 3 tgt Queuine tRNA-ribosyltransferase Sorangium cellulosum (strain So ce56)
A3PAZ2 3.07e-109 327 45 2 350 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9301)
A2BP70 4.12e-109 327 44 2 354 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain AS9601)
B9KFT3 2.32e-108 325 42 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q3AN18 1.52e-107 323 46 3 353 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9605)
Q7TUM6 3.26e-107 322 45 2 351 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9313)
Q73QK5 1.95e-106 320 43 1 361 3 tgt Queuine tRNA-ribosyltransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A2CCL1 2.13e-106 320 45 3 351 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9303)
Q7VDR5 1.48e-105 318 45 2 356 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9PNT0 1.56e-105 318 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q55983 5.79e-105 316 42 2 365 3 tgt Queuine tRNA-ribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CXS3 6.05e-105 316 40 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72TL3 6.05e-105 316 40 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q5HUF2 7.44e-105 316 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni (strain RM1221)
Q04Z48 9.76e-105 316 41 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04UC6 9.76e-105 316 41 0 358 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A1VZZ8 1.19e-104 315 42 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q3B088 1.19e-104 315 44 3 354 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9902)
B0SKS9 5.32e-104 314 42 2 352 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCA8 5.32e-104 314 42 2 352 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A7H331 1.77e-103 312 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FM59 2.18e-103 312 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9VPY8 1.73e-102 312 44 3 371 2 Tgt Queuine tRNA-ribosyltransferase catalytic subunit Drosophila melanogaster
O28787 1.85e-101 308 39 4 402 3 tgt Putative queuine tRNA-ribosyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7TTX7 2.34e-99 302 45 3 351 3 tgt Queuine tRNA-ribosyltransferase Parasynechococcus marenigrum (strain WH8102)
B5RN03 1.02e-97 298 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia duttonii (strain Ly)
Q4QR99 2.16e-97 298 41 1 365 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Rattus norvegicus
Q9JMA2 2.77e-97 298 41 1 365 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Mus musculus
B5RQE7 1.27e-96 295 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia recurrentis (strain A1)
Q9BXR0 2.36e-96 295 42 2 364 1 QTRT1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Homo sapiens
B2S1F3 4.58e-96 294 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia hermsii (strain HS1 / DAH)
A1R0N4 5.62e-96 293 40 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia turicatae (strain 91E135)
Q23623 1.18e-95 293 42 3 362 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis elegans
Q28HC6 5.53e-95 291 42 3 362 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus tropicalis
Q4QQY7 2.26e-94 290 41 2 355 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus laevis
A8X0P0 1.83e-93 288 42 3 362 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis briggsae
Q65ZW4 6.95e-93 285 39 2 355 3 tgt Queuine tRNA-ribosyltransferase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q7SYK1 1.48e-89 278 41 3 358 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Danio rerio
O94460 3.19e-87 272 39 3 369 3 SPAC1687.19c Queuine tRNA-ribosyltransferase catalytic subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6MD31 1.33e-85 267 39 5 373 3 tgt Queuine tRNA-ribosyltransferase Protochlamydia amoebophila (strain UWE25)
O51749 7.21e-85 265 37 2 355 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B7J0Q4 1.38e-84 264 37 2 355 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ZS7)
O84196 7.28e-76 242 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBH3 7.28e-76 242 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9U3 7.28e-76 242 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q822U8 1.3e-75 241 35 4 363 3 tgt Queuine tRNA-ribosyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q3KMG9 1.94e-75 241 35 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q254U7 2.38e-74 238 34 4 363 3 tgt Queuine tRNA-ribosyltransferase Chlamydia felis (strain Fe/C-56)
Q5L5T1 5.06e-74 237 34 4 368 3 tgt Queuine tRNA-ribosyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q9PKK0 3.36e-73 235 34 7 377 3 tgt Queuine tRNA-ribosyltransferase Chlamydia muridarum (strain MoPn / Nigg)
Q9Z8W5 5.5e-72 232 35 5 370 3 tgt Queuine tRNA-ribosyltransferase Chlamydia pneumoniae
Q46DI6 2.29e-32 130 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8PXW5 1.83e-31 127 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8THU2 2.54e-31 127 27 8 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O26278 3.53e-30 125 27 9 366 3 tgtA tRNA-guanine(15) transglycosylase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A6UVD8 1.54e-29 123 26 6 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q5JHC0 9.15e-29 120 26 8 360 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B6YUR8 3.34e-27 116 26 9 360 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus onnurineus (strain NA1)
Q9UZN0 3.96e-27 115 26 8 360 3 tgtA tRNA-guanine(15) transglycosylase Pyrococcus abyssi (strain GE5 / Orsay)
Q6LZL5 8.33e-27 115 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
O58843 1.03e-26 114 26 8 360 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6VJR4 2.02e-26 114 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q2NGY4 2.37e-26 114 26 9 358 3 tgtA tRNA-guanine(15) transglycosylase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B7Q5K1 2.42e-26 112 31 2 193 3 ISCW021855 Queuine tRNA-ribosyltransferase accessory subunit 2 Ixodes scapularis
Q9YAC2 2.49e-26 113 28 11 362 3 tgtA tRNA-guanine(15) transglycosylase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8TH08 4.04e-26 113 24 7 360 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A9A6B5 1.78e-25 111 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q8ZYH2 3.23e-25 110 26 8 359 3 tgtA tRNA-guanine(15) transglycosylase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A4FYL8 4.42e-25 110 25 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q57878 7.27e-25 109 25 5 364 1 tgtA tRNA-guanine(15) transglycosylase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q28DX0 7.87e-25 107 25 5 288 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus tropicalis
Q6DF96 1.31e-24 107 26 5 290 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus laevis
A5UNI4 4.35e-24 107 26 7 367 3 tgtA tRNA-guanine(15) transglycosylase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
O29667 8.07e-24 105 26 11 357 3 tgtA tRNA-guanine(15) transglycosylase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6USA4 9.5e-22 100 23 6 363 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q8TYV3 1.24e-21 99 27 11 371 3 tgtA tRNA-guanine(15) transglycosylase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q3IR98 4.29e-21 98 26 11 365 3 tgtA tRNA-guanine(15) transglycosylase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B4PEV9 5.37e-21 97 35 3 158 3 GE21237 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila yakuba
B3NCH1 5.53e-21 97 35 3 158 3 GG14034 Queuine tRNA-ribosyltransferase accessory subunit 2 Drosophila erecta
Q5ZM96 7.71e-21 96 28 7 255 2 QTRT2 Queuine tRNA-ribosyltransferase accessory subunit 2 Gallus gallus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16580
Feature type CDS
Gene tgt
Product tRNA guanosine(34) transglycosylase Tgt
Location 135363 - 136487 (strand: -1)
Length 1125 (nucleotides) / 374 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2261
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01702 Queuine tRNA-ribosyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0343 Translation, ribosomal structure and biogenesis (J) J Queuine/archaeosine tRNA-ribosyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00773 queuine tRNA-ribosyltransferase [EC:2.4.2.29] - -

Protein Sequence

MKYELQTTDGRARRGRLIFDRGVVETPAFMPVGTYGTVKGMTPEEVKETGAQILLGNTFHLWLRPGQEVMKLHGDLHDFMQWKGPILTDSGGFQVFSLGATRKIKEEGVHFRNPINGEKIFLSPEKSMEIQYDLGSDIVMIFDECTPYPADWDYAKQSMEMSLRWAQRSRQRFDELENPNALFGIIQGSVYEDLRDVSVKGLVEIGFDGYAVGGLAVGEPKEDMHRILEHVCPQIPEDKPRYLMGVGKPEDLVEGVRRGIDMFDCVMPTRNARNGHLFVTDGVVKIRNARYKSDVSTLDAECDCYTCRNYTRAYLHHLDRCNEILGARLNTIHNLRYYQRLMAGIRQAIEEGRLEAFAAEFYQRIGKPVPPLSA

Flanking regions ( +/- flanking 50bp)

CTGCCGAAAATTACACACCATCAGACTGTTTTTCTGATGCCGGAGGTTTTGTGAAATATGAACTGCAAACGACAGACGGCCGTGCGCGCCGTGGTCGCTTAATTTTTGATCGTGGCGTTGTTGAAACGCCGGCGTTTATGCCGGTGGGTACATACGGCACAGTGAAAGGGATGACACCGGAAGAAGTAAAAGAAACCGGTGCGCAAATTTTATTAGGTAATACTTTCCACCTGTGGCTGCGTCCCGGTCAGGAAGTTATGAAACTGCACGGCGATCTTCATGACTTTATGCAGTGGAAAGGTCCGATTCTGACTGACTCCGGCGGTTTCCAGGTCTTCAGCCTGGGTGCGACGCGTAAAATTAAAGAAGAAGGCGTTCATTTCCGTAATCCGATCAACGGGGAAAAAATCTTCTTAAGTCCTGAGAAATCGATGGAAATTCAGTACGATCTCGGGTCTGATATCGTGATGATTTTCGATGAGTGCACACCGTACCCGGCTGATTGGGATTATGCGAAGCAATCCATGGAAATGTCTCTGCGCTGGGCACAACGCAGCCGTCAGCGCTTTGATGAACTGGAAAATCCGAATGCATTGTTTGGTATTATCCAGGGCAGCGTTTACGAAGATTTACGTGATGTCTCCGTGAAAGGGCTGGTGGAAATCGGTTTTGATGGGTACGCTGTCGGCGGTCTGGCTGTCGGCGAGCCGAAAGAAGATATGCACCGTATTCTTGAGCACGTCTGTCCGCAGATACCGGAAGACAAACCACGCTACTTAATGGGCGTGGGTAAGCCGGAAGATCTGGTTGAAGGCGTGCGCCGTGGTATAGATATGTTTGATTGCGTGATGCCGACCCGTAACGCCCGTAACGGACATTTGTTTGTGACGGACGGTGTGGTTAAAATCCGTAATGCCAGGTATAAATCTGATGTATCCACGCTGGATGCAGAATGTGATTGTTATACCTGCCGCAATTATACGCGTGCTTACCTGCATCATTTGGATCGTTGTAATGAAATCCTTGGCGCACGCTTAAATACCATTCATAATCTACGCTACTATCAGCGTTTGATGGCGGGTATCAGACAGGCTATCGAAGAGGGTCGTCTGGAAGCATTTGCCGCTGAATTTTACCAGCGGATCGGGAAACCCGTTCCGCCGTTAAGTGCGTGATTTCCCCGAAACGGGATCACCTGACGATGCATAACATAGGCGATGTATCG