Homologs in group_2112

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15875 FBDBKF_15875 96.7 Morganella morganii S1 clpX ATP-dependent protease ATP-binding subunit ClpX
EHELCC_18475 EHELCC_18475 96.7 Morganella morganii S2 clpX ATP-dependent protease ATP-binding subunit ClpX
NLDBIP_17310 NLDBIP_17310 96.7 Morganella morganii S4 clpX ATP-dependent protease ATP-binding subunit ClpX
LHKJJB_17350 LHKJJB_17350 96.7 Morganella morganii S3 clpX ATP-dependent protease ATP-binding subunit ClpX
HKOGLL_17045 HKOGLL_17045 96.7 Morganella morganii S5 clpX ATP-dependent protease ATP-binding subunit ClpX
PMI_RS00560 PMI_RS00560 89.6 Proteus mirabilis HI4320 clpX ATP-dependent protease ATP-binding subunit ClpX

Distribution of the homologs in the orthogroup group_2112

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2112

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N0L4 0.0 774 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EU54 0.0 772 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Proteus mirabilis (strain HI4320)
O33873 0.0 766 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia enterocolitica
A1JNN1 0.0 766 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JHS0 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TPE2 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis (strain Pestoides F)
Q1CL64 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZQ2 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC66 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis
B2K6V8 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4K9 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLC3 0.0 764 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GAR0 0.0 763 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Serratia proteamaculans (strain 568)
Q66DT3 0.0 763 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZRC0 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TMC7 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella schwarzengrund (strain CVM19633)
B5BD82 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi A (strain AKU_12601)
C0Q7X4 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi C (strain RKS4594)
A9MWX5 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PFN5 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SWU2 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella newport (strain SL254)
B4T9E4 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella heidelberg (strain SL476)
B5R6V0 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FKV4 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella dublin (strain CT_02021853)
Q57SB4 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella choleraesuis (strain SC-B67)
B5EXI9 0.0 754 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella agona (strain SL483)
A7MFI7 0.0 754 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cronobacter sakazakii (strain ATCC BAA-894)
B5QTJ7 0.0 753 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella enteritidis PT4 (strain P125109)
Q8Z8V1 0.0 753 86 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella typhi
A9MM22 0.0 753 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3Z4W5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella sonnei (strain Ss046)
P0A6H4 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella flexneri
Q0T7E5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella flexneri serotype 5b (strain 8401)
Q32JJ4 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella dysenteriae serotype 1 (strain Sd197)
B2U4P3 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LME1 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RF97 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain UTI89 / UPEC)
B1LJJ5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain SMS-3-5 / SECEC)
B6HZP5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain SE11)
B7N8Z2 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6H1 0.0 751 87 3 427 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12)
B1J010 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6H2 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKK3 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8A7 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O1:K1 / APEC
A7ZX96 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O9:H4 (strain HS)
B1XFM6 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12 / DH10B)
C4ZTJ5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3T1 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O8 (strain IAI1)
B7MQF4 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O81 (strain ED1a)
B7NJ56 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3U5 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6H3 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O157:H7
B7L675 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain 55989 / EAEC)
B7MD97 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJR1 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIJ6 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O139:H28 (strain E24377A / ETEC)
A8AK15 0.0 751 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4W7A9 0.0 750 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Enterobacter sp. (strain 638)
A6T5I1 0.0 750 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q325G3 0.0 748 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella boydii serotype 4 (strain Sb227)
C6DB56 0.0 748 86 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5Y0U1 0.0 748 86 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Klebsiella pneumoniae (strain 342)
Q6D826 0.0 746 86 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NV78 0.0 741 86 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sodalis glossinidius (strain morsitans)
C4LDB4 0.0 703 82 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q7MMG6 0.0 701 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio vulnificus (strain YJ016)
Q8DG27 0.0 701 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio vulnificus (strain CMCP6)
C3LNM5 0.0 701 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain M66-2)
Q9KQS7 0.0 701 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z1 0.0 701 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VHZ9 0.0 700 81 2 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio atlanticus (strain LGP32)
Q87R79 0.0 699 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MV82 0.0 699 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio campbellii (strain ATCC BAA-1116)
A0KJU2 0.0 696 81 2 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q5E6Q4 0.0 695 80 1 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4SM43 0.0 695 81 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aeromonas salmonicida (strain A449)
B5FBZ9 0.0 694 80 1 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aliivibrio fischeri (strain MJ11)
Q8EG18 0.0 692 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RL88 0.0 691 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain W3-18-1)
A0KYL8 0.0 691 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain ANA-3)
A4Y5I3 0.0 691 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WLQ2 0.0 691 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS185)
Q07ZX9 0.0 690 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella frigidimarina (strain NCIMB 400)
Q0HTK8 0.0 689 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain MR-7)
Q0HHA2 0.0 689 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain MR-4)
A9KWH8 0.0 689 78 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS195)
A3D306 0.0 689 78 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5E8 0.0 689 78 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS223)
A3QFX5 0.0 687 79 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S4X6 0.0 687 78 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15R47 0.0 685 80 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q12LA2 0.0 684 78 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8FTI0 0.0 681 78 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sediminis (strain HAW-EB3)
B1KLT6 0.0 681 78 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella woodyi (strain ATCC 51908 / MS32)
Q6LNW1 0.0 679 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Photobacterium profundum (strain SS9)
B0TLU8 0.0 676 79 2 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella halifaxensis (strain HAW-EB4)
A8H613 0.0 674 78 2 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q47XL9 0.0 672 77 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QXN9 0.0 663 77 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1LTK0 0.0 660 75 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Baumannia cicadellinicola subsp. Homalodisca coagulata
B8CRF6 0.0 655 78 3 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0VQ89 0.0 644 76 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1U1Q2 0.0 641 75 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1SUW8 0.0 640 74 2 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q88KI9 0.0 634 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W634 0.0 634 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1J693 0.0 633 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain W619)
B0KJG7 0.0 633 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain GB-1)
B3PHK5 0.0 633 74 5 435 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cellvibrio japonicus (strain Ueda107)
A1WUM6 0.0 632 73 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halorhodospira halophila (strain DSM 244 / SL1)
Q1QVW2 0.0 632 74 4 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B4SLN2 0.0 632 74 2 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Stenotrophomonas maltophilia (strain R551-3)
Q5H433 0.0 632 74 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P6Y9 0.0 632 74 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2FQR3 0.0 632 74 2 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Stenotrophomonas maltophilia (strain K279a)
C3JYJ9 0.0 632 74 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas fluorescens (strain SBW25)
Q3BWQ0 0.0 631 74 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNI4 0.0 631 74 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas axonopodis pv. citri (strain 306)
Q4ZVM6 0.0 631 74 4 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas syringae pv. syringae (strain B728a)
B2SMI2 0.0 630 74 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q87YR7 0.0 630 74 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XTZ6 0.0 630 74 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas mendocina (strain ymp)
Q48KY9 0.0 630 73 4 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SK35 0.0 629 74 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Hahella chejuensis (strain KCTC 2396)
Q3K9X0 0.0 629 74 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas fluorescens (strain Pf0-1)
Q47FB7 0.0 629 74 3 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Dechloromonas aromatica (strain RCB)
Q8PBY5 0.0 627 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RTF5 0.0 627 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain B100)
Q4URL5 0.0 627 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain 8004)
Q9I2U0 0.0 626 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KU5 0.0 626 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VB75 0.0 626 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain LESB58)
A6V718 0.0 626 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain PA7)
Q0A6A8 0.0 626 73 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3JAJ9 0.0 625 72 3 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q87E50 0.0 623 71 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8K4 0.0 623 71 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain M23)
B0U5N2 0.0 621 71 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain M12)
Q9PE40 0.0 620 71 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain 9a5c)
B8GNT9 0.0 619 74 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q21KA8 0.0 619 72 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1K782 0.0 615 73 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azoarcus sp. (strain BH72)
Q1LM63 0.0 615 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q2Y6J1 0.0 613 72 5 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A4SXD7 0.0 613 71 6 439 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q3SI99 0.0 612 73 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thiobacillus denitrificans (strain ATCC 25259)
A2SFB6 0.0 612 70 5 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1TM61 0.0 611 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paracidovorax citrulli (strain AAC00-1)
Q472D2 0.0 611 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0KBK3 0.0 610 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P57981 0.0 609 71 1 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pasteurella multocida (strain Pm70)
B3R4W2 0.0 609 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C5BTX7 0.0 608 72 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Teredinibacter turnerae (strain ATCC 39867 / T7901)
B1Y6H2 0.0 608 70 4 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A9IR50 0.0 608 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B2UFQ3 0.0 607 71 6 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ralstonia pickettii (strain 12J)
Q5P160 0.0 607 72 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8XYP6 0.0 607 71 6 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5WVJ1 0.0 607 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Lens)
A5ID16 0.0 607 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Corby)
Q5X452 0.0 607 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Paris)
Q5ZUE0 0.0 606 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P57548 0.0 606 68 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9Q3 0.0 606 68 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q82Y56 0.0 606 72 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1W5B7 0.0 605 71 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidovorax sp. (strain JS42)
B9MG15 0.0 605 71 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidovorax ebreus (strain TPSY)
Q21Y66 0.0 605 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B2T404 0.0 604 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q60BE7 0.0 604 71 4 413 3 clpX2 ATP-dependent Clp protease ATP-binding subunit ClpX 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1XUS8 0.0 603 69 6 439 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q8K989 0.0 603 67 2 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A9AJR1 0.0 603 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia multivorans (strain ATCC 17616 / 249)
Q13Z14 0.0 603 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia xenovorans (strain LB400)
B8D805 0.0 603 67 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B2JGL6 0.0 602 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q65RF7 0.0 602 74 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q63V40 0.0 602 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain K96243)
A3NAI4 0.0 602 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain 668)
A3NWA5 0.0 602 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain 1106a)
A4JF04 0.0 602 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia vietnamiensis (strain G4 / LMG 22486)
B0UW19 0.0 601 71 3 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Histophilus somni (strain 2336)
Q2SWQ5 0.0 601 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0I4F0 0.0 600 71 3 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Histophilus somni (strain 129Pt)
Q1BH84 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia orbicola (strain AU 1054)
B1JTU9 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia orbicola (strain MC0-3)
Q39FE9 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BEF7 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4EBM2 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K846 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia cenocepacia (strain HI2424)
B1YRZ4 0.0 600 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia ambifaria (strain MC40-6)
Q1H1F9 0.0 599 73 3 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A9C1U9 0.0 599 70 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Delftia acidovorans (strain DSM 14801 / SPH-1)
A6VW21 0.0 598 70 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Marinomonas sp. (strain MWYL1)
A1V4X0 0.0 598 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain SAVP1)
Q62JK8 0.0 598 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain ATCC 23344)
A2SBG4 0.0 598 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain NCTC 10229)
A3MKJ7 0.0 598 71 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain NCTC 10247)
Q7W8X1 0.0 598 69 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK82 0.0 598 69 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
C5CJT5 0.0 598 69 5 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Variovorax paradoxus (strain S110)
Q0AJI3 0.0 597 71 6 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7VXI6 0.0 595 68 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q60C67 0.0 595 71 3 420 3 clpX1 ATP-dependent Clp protease ATP-binding subunit ClpX 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q12BY1 0.0 594 69 5 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q2L255 0.0 593 69 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella avium (strain 197N)
A4G5X0 0.0 591 68 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Herminiimonas arsenicoxydans
A6VME2 0.0 591 72 2 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1VRH7 0.0 590 69 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polaromonas naphthalenivorans (strain CJ2)
A5V3U4 0.0 589 68 4 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A6SY75 0.0 588 68 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Janthinobacterium sp. (strain Marseille)
Q11J59 0.0 588 70 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chelativorans sp. (strain BNC1)
Q1GPH4 0.0 587 68 4 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q5LUP9 0.0 586 69 3 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A9W5F6 0.0 585 69 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum extorquens (strain PA1)
B7KNT1 0.0 585 69 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P44838 0.0 585 68 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1Z9C8 0.0 582 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q83DJ1 0.0 582 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDF9 0.0 582 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J0V9 0.0 582 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain CbuG_Q212)
B6J8W3 0.0 582 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain CbuK_Q154)
A7ILC7 0.0 581 71 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1LW29 0.0 581 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q982V5 0.0 580 70 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2NDC1 0.0 580 69 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Erythrobacter litoralis (strain HTCC2594)
A9KDS7 0.0 579 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain Dugway 5J108-111)
A8HYF4 0.0 579 71 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B0UD19 0.0 578 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium sp. (strain 4-46)
B8IN27 0.0 578 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q2W3I0 0.0 577 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q5NNY7 0.0 575 67 5 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1GGF7 0.0 575 68 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruegeria sp. (strain TM1040)
Q89KG2 0.0 575 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B2IGP2 0.0 575 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A6U7U8 0.0 575 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sinorhizobium medicae (strain WSM419)
Q1MIM6 0.0 574 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q92QQ2 0.0 573 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium meliloti (strain 1021)
B5ZY09 0.0 573 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q2K9U6 0.0 573 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PVY5 0.0 573 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium etli (strain CIAT 652)
A9HRV3 0.0 573 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B3Q7P4 0.0 573 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain TIE-1)
Q6N5L4 0.0 573 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
C3MA45 0.0 573 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A5EKA7 0.0 573 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q7NUZ0 0.0 572 70 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0C0G0 0.0 572 68 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Hyphomonas neptunium (strain ATCC 15444)
B6JGU8 0.0 572 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B8EIL3 0.0 571 70 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q0AQ06 0.0 571 69 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Maricaulis maris (strain MCS10)
A7HY53 0.0 571 68 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4YVM3 0.0 571 70 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium sp. (strain ORS 278)
Q8UFY5 0.0 571 68 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2IWZ3 0.0 570 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain HaA2)
A6X117 0.0 570 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A1B1H7 0.0 570 71 6 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paracoccus denitrificans (strain Pd 1222)
Q165G0 0.0 569 68 6 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q215J1 0.0 569 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisB18)
Q07NN5 0.0 569 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisA53)
Q3SRD3 0.0 569 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q1QL77 0.0 569 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B9JVD6 0.0 569 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q135W8 0.0 569 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisB5)
B6ISY6 0.0 569 67 4 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2G3T4 0.0 568 67 4 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8D347 0.0 566 65 2 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Wigglesworthia glossinidia brevipalpis
Q6FEP7 0.0 565 67 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B5EQ29 0.0 565 71 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J791 0.0 565 71 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A0LDT3 0.0 564 66 2 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B9KJU8 0.0 564 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PKS0 0.0 564 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A5VQN3 0.0 563 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5FX05 0.0 563 67 5 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidiphilium cryptum (strain JF-5)
A4WSH9 0.0 563 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q8YHC7 0.0 563 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJ80 0.0 563 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella melitensis biotype 2 (strain ATCC 23457)
Q9L7X5 0.0 563 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus biovar 1 (strain 9-941)
Q2YPX2 0.0 563 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus (strain 2308)
B0V4T7 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AYE)
A3M1Y8 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VKU4 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain SDF)
B2I3C2 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain ACICU)
B7I5E4 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AB0057)
B7H092 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AB307-0294)
B2S5W0 0.0 562 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus (strain S19)
A9ISA8 0.0 562 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella tribocorum (strain CIP 105476 / IBS 506)
A1USA8 0.0 561 68 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q74C83 0.0 561 67 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8G0I5 0.0 561 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella suis biovar 1 (strain 1330)
B0CGR0 0.0 561 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella suis (strain ATCC 23445 / NCTC 10510)
Q6G3Z2 0.0 561 68 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P70730 0.0 560 65 5 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azospirillum brasilense
Q0BSJ8 0.0 560 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
C6E2S9 0.0 560 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter sp. (strain M21)
Q39UH3 0.0 560 67 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B5EI28 0.0 560 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q3J1G7 0.0 560 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6G177 0.0 559 67 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella quintana (strain Toulouse)
B3E1Z3 0.0 559 66 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B4RCN8 0.0 557 68 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Phenylobacterium zucineum (strain HLK1)
A9M5C1 0.0 557 67 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2RU44 0.0 556 67 4 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B9M0Y2 0.0 556 67 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q28NI8 0.0 556 67 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Jannaschia sp. (strain CCS1)
A5GFA1 0.0 555 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geotalea uraniireducens (strain Rf4)
Q6MH12 0.0 555 65 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A8LJA7 0.0 554 68 6 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A1AN84 0.0 553 65 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5FUR4 0.0 548 65 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gluconobacter oxydans (strain 621H)
B8GX14 0.0 548 68 4 416 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAU2 0.0 548 68 4 416 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9JTX8 0.0 546 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYY3 0.0 546 68 3 407 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9X5N1 0.0 545 65 6 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Myxococcus xanthus
A9M020 0.0 545 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup C (strain 053442)
B0SZ62 0.0 545 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter sp. (strain K31)
A5WC69 0.0 544 66 3 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter sp. (strain PRwf-1)
A1KUJ4 0.0 544 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B2A159 0.0 543 64 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2UX12 0.0 543 63 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Alaska E43 / Type E3)
B2TPB8 0.0 540 63 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Eklund 17B / Type B)
Q89AA0 0.0 540 62 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q0ST54 0.0 538 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain SM101 / Type A)
B8FA63 0.0 538 65 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfatibacillum aliphaticivorans
Q8XKK2 0.0 538 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain 13 / Type A)
Q0TQK3 0.0 538 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3A3X6 0.0 538 64 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A0Q2L0 0.0 538 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium novyi (strain NT)
Q5F8W5 0.0 536 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q2RL30 0.0 536 63 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C1AVQ3 0.0 536 63 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus opacus (strain B4)
Q0SGZ3 0.0 536 63 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus jostii (strain RHA1)
C0QHJ8 0.0 535 63 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
C1A1N6 0.0 534 63 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q891J8 0.0 534 62 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium tetani (strain Massachusetts / E88)
A8ZXB8 0.0 534 64 4 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B8I8F6 0.0 533 63 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A7GIH1 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IND6 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Okra / Type B1)
C1FLA5 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Kyoto / Type A2)
A5I6W0 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KU76 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain 657 / Type Ba4)
A7FYI1 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain ATCC 19397 / Type A)
B1L1D6 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Loch Maree / Type A3)
A8MIS7 0.0 532 63 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkaliphilus oremlandii (strain OhILAs)
Q1B601 0.0 532 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain MCS)
A1UJ35 0.0 532 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain KMS)
A3Q2I1 0.0 532 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain JLS)
A0R196 0.0 531 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1SME0 0.0 530 62 4 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nocardioides sp. (strain ATCC BAA-499 / JS614)
B1MMV6 0.0 530 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B5YI39 0.0 530 62 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B0K532 0.0 530 63 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermoanaerobacter sp. (strain X514)
A1TCB3 0.0 530 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A4T2N8 0.0 530 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium gilvum (strain PYR-GCK)
B0TFI7 0.0 530 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B0KBA3 0.0 529 63 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A0PU31 0.0 529 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium ulcerans (strain Agy99)
B2HNG2 0.0 528 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium marinum (strain ATCC BAA-535 / M)
C0ZAG3 0.0 528 63 5 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q9CBY6 0.0 528 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium leprae (strain TN)
B8ZRP1 0.0 528 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium leprae (strain Br4923)
B8CY73 0.0 527 63 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A5N2K7 0.0 527 61 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E684 0.0 527 61 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium kluyveri (strain NBRC 12016)
Q5Z061 0.0 527 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nocardia farcinica (strain IFM 10152)
Q67SJ9 0.0 525 64 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P9WPB9 0.0 525 63 4 414 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U5F3 0.0 525 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q73XN1 0.0 525 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0A529 0.0 525 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0QDF5 0.0 525 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium avium (strain 104)
Q7VP79 0.0 525 63 3 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6LT28 0.0 525 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q820F8 0.0 525 60 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P9WPB8 0.0 524 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8RC24 0.0 524 62 5 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C1AES4 0.0 523 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLF3 0.0 523 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A4XAH9 0.0 523 61 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B1VXA8 0.0 522 61 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q4FQB8 0.0 522 66 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q180E8 0.0 522 61 4 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridioides difficile (strain 630)
Q9F316 0.0 521 60 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1Q8J1 0.0 520 65 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
C3PI25 0.0 520 60 5 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
A3DJ11 0.0 520 62 5 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6AK60 0.0 520 61 6 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q97FT7 0.0 518 61 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6TM62 0.0 517 62 4 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkaliphilus metalliredigens (strain QYMF)
C4LJV6 0.0 516 62 5 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
A8M1K7 0.0 516 60 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salinispora arenicola (strain CNS-205)
Q8CXB8 0.0 516 61 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B9MQ33 0.0 516 60 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q7VRH0 0.0 516 58 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Blochmanniella floridana
B8HA33 0.0 515 63 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A4XHW1 0.0 515 61 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q9K8F4 0.0 514 63 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4QGA7 0.0 514 60 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium glutamicum (strain R)
B2GGB7 0.0 513 61 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
C5D5L4 1.03e-180 513 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus sp. (strain WCH70)
Q8FN57 1.51e-180 513 59 4 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B7KBH7 1.83e-180 513 60 5 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gloeothece citriformis (strain PCC 7424)
A8F2I3 3.13e-180 512 61 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia massiliae (strain Mtu5)
A7GTF1 4.23e-180 511 60 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q68W45 6.65e-180 511 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5KWJ9 8.19e-180 510 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus kaustophilus (strain HTA426)
A8GPK1 8.27e-180 511 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia akari (strain Hartford)
Q9ZCN1 8.83e-180 511 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia prowazekii (strain Madrid E)
A8FFV9 1.08e-179 510 62 5 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus pumilus (strain SAFR-032)
A8GVR9 1.26e-179 510 62 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia bellii (strain OSU 85-389)
Q24SJ9 1.34e-179 510 64 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfitobacterium hafniense (strain Y51)
B8FVI0 1.34e-179 510 64 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C4K2L5 1.54e-179 510 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia peacockii (strain Rustic)
B1WUD2 2.08e-179 510 59 5 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q92GQ4 2.14e-179 509 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8NN26 2.22e-179 509 60 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q817Q2 2.43e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HEA4 2.43e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain B4264)
B7IIY3 2.43e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain G9842)
C3PLG9 2.47e-179 509 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia africae (strain ESF-5)
Q6HD54 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q633X2 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ZK / E33L)
B9IZ47 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain Q1)
B7HQN2 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain AH187)
C1ETR8 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain 03BB102)
Q72ZV4 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JQ65 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain AH820)
Q81LB9 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis
C3L704 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9F7 3.02e-179 509 60 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis (strain A0248)
A4IRH2 3.04e-179 509 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus thermodenitrificans (strain NG80-2)
A0LSV2 3.26e-179 509 62 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A0JXL2 3.61e-179 509 61 6 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Arthrobacter sp. (strain FB24)
A1VE84 3.78e-179 509 62 3 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitratidesulfovibrio vulgaris (strain DP4)
Q72CE7 3.78e-179 509 62 3 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1RJ84 5.32e-179 509 62 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia bellii (strain RML369-C)
A8GTC4 8.85e-179 508 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia rickettsii (strain Sheila Smith)
B0BUW3 8.85e-179 508 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia rickettsii (strain Iowa)
Q5WEN9 1.07e-178 508 61 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shouchella clausii (strain KSM-K16)
Q55510 1.08e-178 508 59 5 438 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0AI71 1.29e-178 507 62 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y7K9 1.68e-178 507 61 4 411 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DHN7 1.68e-178 507 61 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4a (strain HCC23)
Q720F3 1.68e-178 507 61 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4b (strain F2365)
C1L2H6 1.68e-178 507 61 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4b (strain CLIP80459)
Q65GJ4 2.42e-178 507 62 5 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7GH25 2.94e-178 506 61 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Anoxybacillus flavithermus (strain DSM 21510 / WK1)
O67356 3.01e-178 506 62 7 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aquifex aeolicus (strain VF5)
A7Z7B2 3.43e-178 506 61 5 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q92C84 4.3e-178 506 61 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6NFU7 5.09e-178 506 60 4 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B0JL96 5.74e-178 507 60 7 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B7JW74 5.79e-178 507 60 8 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rippkaea orientalis (strain PCC 8801 / RF-1)
P50866 1.2e-177 505 61 5 408 2 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus subtilis (strain 168)
A8EZR2 1.71e-177 505 60 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia canadensis (strain McKiel)
A6WDT9 1.89e-177 505 60 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q88VE2 2.35e-177 504 61 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A5VJ94 1.81e-176 502 62 6 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Limosilactobacillus reuteri (strain DSM 20016)
Q8CNY5 2.13e-176 502 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNM9 2.13e-176 502 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1YJW0 3.38e-176 501 61 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A9WUW1 7.86e-176 501 61 7 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B1HVE5 1.11e-175 500 62 5 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lysinibacillus sphaericus (strain C3-41)
C5CAX2 1.31e-175 500 61 6 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
C4Z1T5 1.55e-175 499 60 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
C4L4J1 1.73e-175 499 60 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q30Z80 2.24e-175 499 58 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q042T7 5.19e-175 498 59 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8NW72 6.37e-175 498 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MW2)
Q6G8Q1 6.37e-175 498 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MSSA476)
Q1MQ78 6.68e-175 498 59 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lawsonia intracellularis (strain PHE/MN1-00)
Q4L715 1.12e-174 498 60 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus haemolyticus (strain JCSC1435)
Q6GG31 1.16e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MRSA252)
A8Z2J5 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain USA300 / TCH1516)
P63790 1.38e-174 497 61 4 404 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain N315)
P63789 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHK8 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Newman)
Q5HF98 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain COL)
A5ITJ9 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain JH9)
Q2FXQ7 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG62 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain USA300)
A6U2E2 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain JH1)
A7X396 1.38e-174 497 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Mu3 / ATCC 700698)
B1MXT8 1.65e-174 497 61 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leuconostoc citreum (strain KM20)
Q74JU4 1.8e-174 497 59 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2JDQ7 2.38e-174 497 60 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q5NH46 3.12e-174 496 59 2 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q4UMY8 3.58e-174 496 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0RPH1 4.48e-174 496 60 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q2YTB5 4.6e-174 496 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8YQX7 6.46e-174 496 57 6 441 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6AFZ6 9.98e-174 495 58 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leifsonia xyli subsp. xyli (strain CTCB07)
A8L1X0 1.2e-173 495 59 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Parafrankia sp. (strain EAN1pec)
Q8GJP6 1.51e-173 494 60 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactococcus lactis subsp. cremoris (strain MG1363)
Q6A7F1 1.53e-173 495 59 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q02Z22 1.82e-173 494 60 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactococcus lactis subsp. cremoris (strain SK11)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16435
Feature type CDS
Gene clpX
Product ATP-dependent protease ATP-binding subunit ClpX
Location 104962 - 106242 (strand: -1)
Length 1281 (nucleotides) / 426 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2112
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06689 ClpX C4-type zinc finger
PF07724 AAA domain (Cdc48 subfamily)
PF10431 C-terminal, D2-small domain, of ClpB protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1219 Posttranslational modification, protein turnover, chaperones (O) O ATP-dependent protease Clp, ATPase subunit ClpX

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03544 ATP-dependent Clp protease ATP-binding subunit ClpX Cell cycle - Caulobacter -

Protein Sequence

MTDKRKDGSGKLLYCSFCGKSQHEVKKLIAGPSVYICDECVDLCNDIIREEIKDLIPAQRGDRNELPTPHEIRQHLDDYVIGQELAKKVLAVAVYNHYKRLRNGDKTAEGVELGKSNILLIGPTGSGKTLLAETLARYLDVPFTMADATTLTEAGYVGEDVENIIQKLLQKCDYDVEKAQRGIVYIDEIDKISRKSDNPSITRDVSGEGVQQALLKLVEGTIAAVPPQGGRKHPQQEFLQVDTSKILFICGGAFAGLDKVVGQRLNTRSGIGFGAEVRGDKDKATEGELLAQVEPGDLIKFGLIPEFIGRLPVVATLGELNEDALIQILQEPKNALTKQYQALFNIEGVELEFRREALTAIAEKAMKRKTGARGLRSIVEAALLNTMYDLPSMENVEKVVIDENVITNQTEPMLIYRKPEAQVSGE

Flanking regions ( +/- flanking 50bp)

TTTTTGCGGCTCACCAATGATGAGCTGTACTGATTAAGTGAGGTTTACTGATGACAGACAAACGCAAAGACGGTTCAGGAAAGCTGCTGTACTGCTCTTTCTGCGGGAAAAGTCAGCATGAGGTTAAGAAACTGATTGCCGGCCCGTCAGTGTATATCTGTGACGAATGCGTTGATTTATGCAATGACATTATTCGTGAAGAAATTAAAGACCTGATCCCGGCACAGCGCGGTGATCGCAATGAATTGCCGACACCGCATGAAATTCGTCAGCACCTTGATGACTATGTTATCGGTCAGGAACTGGCGAAAAAAGTGCTGGCGGTTGCGGTATACAATCACTACAAACGTTTACGCAACGGCGATAAAACAGCCGAAGGCGTAGAGCTGGGTAAAAGTAATATTCTGCTTATCGGACCAACCGGCAGCGGTAAAACATTACTGGCAGAAACCCTGGCGCGTTACCTGGATGTTCCGTTTACCATGGCGGACGCCACCACACTGACCGAAGCCGGTTATGTGGGCGAAGATGTTGAAAATATCATTCAGAAGCTTTTACAGAAATGCGACTATGATGTAGAGAAAGCACAGCGCGGTATCGTGTATATTGATGAAATTGATAAGATTTCCCGTAAATCTGATAACCCGTCAATTACCCGTGATGTGTCCGGCGAAGGTGTTCAGCAGGCTCTGCTGAAACTGGTCGAAGGAACTATCGCGGCAGTACCACCGCAGGGCGGACGTAAGCATCCGCAGCAGGAGTTTTTACAGGTTGATACCTCGAAAATTCTGTTCATCTGTGGCGGGGCATTTGCCGGTCTTGATAAAGTAGTGGGACAGCGTCTGAACACCCGTTCAGGTATCGGTTTCGGTGCTGAAGTGCGTGGTGATAAAGATAAAGCAACTGAAGGCGAATTACTGGCACAAGTGGAGCCGGGCGATCTGATTAAATTTGGTCTGATCCCTGAATTCATTGGTCGTCTGCCGGTAGTGGCAACACTCGGTGAGCTGAATGAAGACGCATTGATCCAGATTTTACAGGAACCAAAAAACGCGTTAACGAAACAGTATCAGGCACTTTTTAATATTGAAGGTGTCGAACTGGAGTTCCGCCGCGAAGCCCTGACTGCCATCGCGGAAAAAGCGATGAAACGTAAAACAGGCGCCCGTGGTCTGCGTTCTATCGTTGAAGCGGCATTACTGAATACGATGTACGATTTGCCGTCAATGGAAAACGTTGAAAAAGTTGTTATCGATGAAAATGTGATCACGAATCAAACAGAACCTATGCTGATTTACCGTAAACCTGAAGCACAGGTTTCCGGCGAGTAACGAAAAGTTAGCGGATTTGTTATCAATATTATAAAAATGAGGGGATTTTC