Homologs in group_2150

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15875 FBDBKF_15875 100.0 Morganella morganii S1 clpX ATP-dependent protease ATP-binding subunit ClpX
EHELCC_18475 EHELCC_18475 100.0 Morganella morganii S2 clpX ATP-dependent protease ATP-binding subunit ClpX
NLDBIP_17310 NLDBIP_17310 100.0 Morganella morganii S4 clpX ATP-dependent protease ATP-binding subunit ClpX
LHKJJB_17350 LHKJJB_17350 100.0 Morganella morganii S3 clpX ATP-dependent protease ATP-binding subunit ClpX
F4V73_RS16435 F4V73_RS16435 96.7 Morganella psychrotolerans clpX ATP-dependent protease ATP-binding subunit ClpX
PMI_RS00560 PMI_RS00560 89.8 Proteus mirabilis HI4320 clpX ATP-dependent protease ATP-binding subunit ClpX

Distribution of the homologs in the orthogroup group_2150

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2150

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N0L4 0.0 775 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EU54 0.0 774 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Proteus mirabilis (strain HI4320)
O33873 0.0 771 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia enterocolitica
A1JNN1 0.0 771 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JHS0 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TPE2 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis (strain Pestoides F)
Q1CL64 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZQ2 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC66 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis
B2K6V8 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4K9 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLC3 0.0 771 89 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66DT3 0.0 769 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Yersinia pseudotuberculosis serotype I (strain IP32953)
A8GAR0 0.0 769 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Serratia proteamaculans (strain 568)
Q8ZRC0 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TMC7 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella schwarzengrund (strain CVM19633)
B5BD82 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi A (strain AKU_12601)
C0Q7X4 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi C (strain RKS4594)
A9MWX5 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PFN5 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SWU2 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella newport (strain SL254)
B4T9E4 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella heidelberg (strain SL476)
B5R6V0 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FKV4 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella dublin (strain CT_02021853)
Q57SB4 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella choleraesuis (strain SC-B67)
B5EXI9 0.0 761 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella agona (strain SL483)
A7MFI7 0.0 761 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cronobacter sakazakii (strain ATCC BAA-894)
B5QTJ7 0.0 760 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella enteritidis PT4 (strain P125109)
A9MM22 0.0 760 88 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4W7A9 0.0 760 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Enterobacter sp. (strain 638)
Q8Z8V1 0.0 759 87 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salmonella typhi
A6T5I1 0.0 759 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LME1 0.0 757 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Y0U1 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Klebsiella pneumoniae (strain 342)
Q3Z4W5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella sonnei (strain Ss046)
P0A6H4 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella flexneri
Q0T7E5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella flexneri serotype 5b (strain 8401)
Q32JJ4 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella dysenteriae serotype 1 (strain Sd197)
B2U4P3 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RF97 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain UTI89 / UPEC)
B1LJJ5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain SMS-3-5 / SECEC)
B6HZP5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain SE11)
B7N8Z2 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6H1 0.0 756 88 3 427 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12)
B1J010 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6H2 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKK3 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8A7 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O1:K1 / APEC
A7ZX96 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O9:H4 (strain HS)
B1XFM6 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12 / DH10B)
C4ZTJ5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3T1 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O8 (strain IAI1)
B7MQF4 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O81 (strain ED1a)
B7NJ56 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3U5 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6H3 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O157:H7
B7L675 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli (strain 55989 / EAEC)
B7MD97 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJR1 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIJ6 0.0 756 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Escherichia coli O139:H28 (strain E24377A / ETEC)
A8AK15 0.0 755 88 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q325G3 0.0 753 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shigella boydii serotype 4 (strain Sb227)
C6DB56 0.0 748 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D826 0.0 745 87 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NV78 0.0 743 86 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sodalis glossinidius (strain morsitans)
B7VHZ9 0.0 709 82 2 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio atlanticus (strain LGP32)
Q7MMG6 0.0 709 81 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio vulnificus (strain YJ016)
Q8DG27 0.0 709 81 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio vulnificus (strain CMCP6)
A7MV82 0.0 707 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio campbellii (strain ATCC BAA-1116)
Q87R79 0.0 706 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LNM5 0.0 705 81 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain M66-2)
Q9KQS7 0.0 705 81 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6Z1 0.0 705 81 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C4LDB4 0.0 704 82 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5E6Q4 0.0 698 81 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FBZ9 0.0 697 81 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aliivibrio fischeri (strain MJ11)
A0KJU2 0.0 696 81 2 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KYL8 0.0 695 80 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain ANA-3)
Q0HTK8 0.0 694 80 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain MR-7)
Q0HHA2 0.0 694 80 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain MR-4)
A4SM43 0.0 693 81 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aeromonas salmonicida (strain A449)
Q07ZX9 0.0 692 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella frigidimarina (strain NCIMB 400)
Q15R47 0.0 692 81 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1S4X6 0.0 691 79 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EG18 0.0 690 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RL88 0.0 689 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sp. (strain W3-18-1)
A4Y5I3 0.0 689 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12LA2 0.0 689 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6WLQ2 0.0 688 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS185)
A9KWH8 0.0 687 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS195)
A3D306 0.0 687 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5E8 0.0 687 79 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella baltica (strain OS223)
A3QFX5 0.0 686 79 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KLT6 0.0 684 79 3 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella woodyi (strain ATCC 51908 / MS32)
Q6LNW1 0.0 683 80 2 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Photobacterium profundum (strain SS9)
A8FTI0 0.0 678 78 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella sediminis (strain HAW-EB3)
B0TLU8 0.0 677 79 2 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella halifaxensis (strain HAW-EB4)
A8H613 0.0 675 78 2 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q47XL9 0.0 675 77 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QXN9 0.0 665 77 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1LTK0 0.0 665 76 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Baumannia cicadellinicola subsp. Homalodisca coagulata
B8CRF6 0.0 659 78 3 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shewanella piezotolerans (strain WP3 / JCM 13877)
A1SUW8 0.0 649 75 2 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0VQ89 0.0 647 76 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1U1Q2 0.0 643 76 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q88KI9 0.0 638 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W634 0.0 637 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B2FQR3 0.0 637 75 2 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Stenotrophomonas maltophilia (strain K279a)
B1J693 0.0 637 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain W619)
B0KJG7 0.0 637 74 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas putida (strain GB-1)
B4SLN2 0.0 636 75 2 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Stenotrophomonas maltophilia (strain R551-3)
Q47FB7 0.0 635 75 3 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Dechloromonas aromatica (strain RCB)
Q5H433 0.0 633 75 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P6Y9 0.0 633 75 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A1WUM6 0.0 632 73 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halorhodospira halophila (strain DSM 244 / SL1)
Q3BWQ0 0.0 632 75 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNI4 0.0 632 75 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas axonopodis pv. citri (strain 306)
C3JYJ9 0.0 632 75 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas fluorescens (strain SBW25)
B2SMI2 0.0 631 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q4ZVM6 0.0 631 74 4 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas syringae pv. syringae (strain B728a)
Q87YR7 0.0 631 74 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3K9X0 0.0 631 74 3 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas fluorescens (strain Pf0-1)
Q2SK35 0.0 631 74 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Hahella chejuensis (strain KCTC 2396)
Q8PBY5 0.0 630 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RTF5 0.0 630 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain B100)
Q4URL5 0.0 630 74 3 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthomonas campestris pv. campestris (strain 8004)
Q0A6A8 0.0 630 74 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q48KY9 0.0 630 74 4 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XTZ6 0.0 629 74 4 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas mendocina (strain ymp)
Q3JAJ9 0.0 629 73 3 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q1QVW2 0.0 628 74 5 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q87E50 0.0 627 72 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8K4 0.0 627 72 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain M23)
Q9I2U0 0.0 627 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KU5 0.0 627 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VB75 0.0 627 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain LESB58)
A6V718 0.0 627 74 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudomonas aeruginosa (strain PA7)
B0U5N2 0.0 626 72 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain M12)
Q9PE40 0.0 625 72 4 430 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xylella fastidiosa (strain 9a5c)
B3PHK5 0.0 625 74 5 435 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cellvibrio japonicus (strain Ueda107)
B8GNT9 0.0 622 74 6 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1K782 0.0 619 73 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azoarcus sp. (strain BH72)
A1TM61 0.0 619 71 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paracidovorax citrulli (strain AAC00-1)
Q1LM63 0.0 618 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q21KA8 0.0 617 72 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2Y6J1 0.0 616 73 5 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A9IR50 0.0 616 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
P57981 0.0 615 72 1 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pasteurella multocida (strain Pm70)
Q472D2 0.0 615 71 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3SI99 0.0 613 73 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thiobacillus denitrificans (strain ATCC 25259)
P57548 0.0 613 68 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9Q3 0.0 613 68 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A4SXD7 0.0 612 71 5 439 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B3R4W2 0.0 612 71 5 432 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0KBK3 0.0 612 71 5 432 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9AJR1 0.0 612 73 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia multivorans (strain ATCC 17616 / 249)
Q5WVJ1 0.0 611 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Lens)
A5ID16 0.0 611 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Corby)
B2T404 0.0 611 73 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JGL6 0.0 611 73 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q5ZUE0 0.0 611 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q63V40 0.0 611 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain K96243)
A3NAI4 0.0 611 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain 668)
A3NWA5 0.0 611 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia pseudomallei (strain 1106a)
Q13Z14 0.0 610 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paraburkholderia xenovorans (strain LB400)
Q5X452 0.0 610 73 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Legionella pneumophila (strain Paris)
Q82Y56 0.0 610 72 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1Y6H2 0.0 610 70 3 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A4JF04 0.0 610 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1W5B7 0.0 610 71 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidovorax sp. (strain JS42)
B9MG15 0.0 610 71 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidovorax ebreus (strain TPSY)
Q5P160 0.0 610 72 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B2UFQ3 0.0 609 72 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ralstonia pickettii (strain 12J)
B8D805 0.0 609 68 2 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
Q21Y66 0.0 609 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8XYP6 0.0 609 72 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2SWQ5 0.0 609 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1BH84 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia orbicola (strain AU 1054)
B1JTU9 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia orbicola (strain MC0-3)
Q39FE9 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BEF7 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4EBM2 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K846 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia cenocepacia (strain HI2424)
B1YRZ4 0.0 608 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia ambifaria (strain MC40-6)
C5BTX7 0.0 608 72 4 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Teredinibacter turnerae (strain ATCC 39867 / T7901)
A2SFB6 0.0 608 69 3 423 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q65RF7 0.0 608 74 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1V4X0 0.0 607 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain SAVP1)
Q62JK8 0.0 607 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain ATCC 23344)
A2SBG4 0.0 607 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain NCTC 10229)
A3MKJ7 0.0 607 72 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Burkholderia mallei (strain NCTC 10247)
Q7W8X1 0.0 607 69 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK82 0.0 607 69 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B0UW19 0.0 605 72 3 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Histophilus somni (strain 2336)
Q60BE7 0.0 605 71 3 413 3 clpX2 ATP-dependent Clp protease ATP-binding subunit ClpX 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1XUS8 0.0 605 69 7 446 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q0I4F0 0.0 605 71 3 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Histophilus somni (strain 129Pt)
Q8K989 0.0 605 68 2 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7VXI6 0.0 605 69 3 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2L255 0.0 604 70 3 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bordetella avium (strain 197N)
Q1H1F9 0.0 603 74 4 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A9C1U9 0.0 603 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Delftia acidovorans (strain DSM 14801 / SPH-1)
C5CJT5 0.0 603 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Variovorax paradoxus (strain S110)
A6VW21 0.0 602 71 2 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Marinomonas sp. (strain MWYL1)
Q0AJI3 0.0 601 72 6 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A6VME2 0.0 600 74 2 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1VRH7 0.0 600 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polaromonas naphthalenivorans (strain CJ2)
Q12BY1 0.0 598 70 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q1GPH4 0.0 595 69 4 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5V3U4 0.0 593 68 4 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q11J59 0.0 593 71 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chelativorans sp. (strain BNC1)
A4G5X0 0.0 592 69 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Herminiimonas arsenicoxydans
Q60C67 0.0 592 70 4 423 3 clpX1 ATP-dependent Clp protease ATP-binding subunit ClpX 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5LUP9 0.0 592 69 3 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A6SY75 0.0 590 68 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Janthinobacterium sp. (strain Marseille)
A9W5F6 0.0 590 69 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum extorquens (strain PA1)
B7KNT1 0.0 590 69 5 426 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P44838 0.0 587 69 3 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1GGF7 0.0 586 69 4 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruegeria sp. (strain TM1040)
Q982V5 0.0 586 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B1Z9C8 0.0 586 70 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A7ILC7 0.0 585 71 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1LW29 0.0 585 70 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q2NDC1 0.0 585 70 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Erythrobacter litoralis (strain HTCC2594)
A8HYF4 0.0 584 71 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A6U7U8 0.0 582 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sinorhizobium medicae (strain WSM419)
B0UD19 0.0 582 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium sp. (strain 4-46)
Q5NNY7 0.0 582 68 5 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B8IN27 0.0 581 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
C3MA45 0.0 580 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q92QQ2 0.0 580 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium meliloti (strain 1021)
B2IGP2 0.0 580 70 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q165G0 0.0 580 69 6 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2W3I0 0.0 580 69 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8UFY5 0.0 580 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Agrobacterium fabrum (strain C58 / ATCC 33970)
Q83DJ1 0.0 579 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDF9 0.0 579 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J0V9 0.0 579 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain CbuG_Q212)
B6J8W3 0.0 579 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain CbuK_Q154)
Q89KG2 0.0 579 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1MIM6 0.0 578 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B3Q7P4 0.0 578 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain TIE-1)
Q6N5L4 0.0 578 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B5ZY09 0.0 578 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q2K9U6 0.0 578 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PVY5 0.0 578 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhizobium etli (strain CIAT 652)
Q7NUZ0 0.0 578 71 4 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0C0G0 0.0 577 69 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Hyphomonas neptunium (strain ATCC 15444)
A5EKA7 0.0 577 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A7HY53 0.0 577 68 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B8EIL3 0.0 577 71 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B6JGU8 0.0 577 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A9KDS7 0.0 576 69 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Coxiella burnetii (strain Dugway 5J108-111)
B6ISY6 0.0 576 67 4 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2G3T4 0.0 575 68 4 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4YVM3 0.0 575 71 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bradyrhizobium sp. (strain ORS 278)
B9JVD6 0.0 575 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q2IWZ3 0.0 575 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain HaA2)
A9HRV3 0.0 575 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q1QL77 0.0 574 71 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q215J1 0.0 574 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisB18)
Q07NN5 0.0 574 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisA53)
Q3SRD3 0.0 574 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q135W8 0.0 573 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodopseudomonas palustris (strain BisB5)
A6X117 0.0 572 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q74C83 0.0 570 68 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1B1H7 0.0 570 71 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Paracoccus denitrificans (strain Pd 1222)
Q0AQ06 0.0 570 69 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Maricaulis maris (strain MCS10)
Q8D347 0.0 570 65 2 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Wigglesworthia glossinidia brevipalpis
Q39UH3 0.0 569 67 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A9ISA8 0.0 568 68 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6FEP7 0.0 568 68 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A5VQN3 0.0 567 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q6G3Z2 0.0 567 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P70730 0.0 567 66 5 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Azospirillum brasilense
B5EQ29 0.0 567 71 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J791 0.0 567 71 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A0LDT3 0.0 566 67 2 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8YHC7 0.0 566 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJ80 0.0 566 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella melitensis biotype 2 (strain ATCC 23457)
Q9L7X5 0.0 566 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus biovar 1 (strain 9-941)
Q2YPX2 0.0 566 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus (strain 2308)
B2S5W0 0.0 565 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella abortus (strain S19)
Q6G177 0.0 565 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella quintana (strain Toulouse)
Q8G0I5 0.0 565 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella suis biovar 1 (strain 1330)
B0CGR0 0.0 565 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella suis (strain ATCC 23445 / NCTC 10510)
A5FX05 0.0 565 67 5 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidiphilium cryptum (strain JF-5)
B3E1Z3 0.0 564 67 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C6E2S9 0.0 564 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacter sp. (strain M21)
A8LJA7 0.0 564 69 6 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B5EI28 0.0 564 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A1USA8 0.0 564 68 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B9KJU8 0.0 562 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PKS0 0.0 562 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0V4T7 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AYE)
A3M1Y8 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VKU4 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain SDF)
B2I3C2 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain ACICU)
B7I5E4 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AB0057)
B7H092 0.0 562 67 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acinetobacter baumannii (strain AB307-0294)
A4WSH9 0.0 562 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A5GFA1 0.0 561 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geotalea uraniireducens (strain Rf4)
B9M0Y2 0.0 561 67 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A9M5C1 0.0 561 68 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A1AN84 0.0 560 65 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q2RU44 0.0 560 68 4 425 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0BSJ8 0.0 560 70 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B4RCN8 0.0 559 68 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Phenylobacterium zucineum (strain HLK1)
Q28NI8 0.0 559 67 4 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Jannaschia sp. (strain CCS1)
Q3J1G7 0.0 558 69 5 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6MH12 0.0 557 65 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B8GX14 0.0 553 68 4 416 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAU2 0.0 553 68 4 416 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9JYY3 0.0 552 69 3 407 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JTX8 0.0 551 69 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5FUR4 0.0 551 66 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gluconobacter oxydans (strain 621H)
A9M020 0.0 550 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup C (strain 053442)
A1KUJ4 0.0 550 68 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B0SZ62 0.0 550 68 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caulobacter sp. (strain K31)
B2A159 0.0 546 65 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q89AA0 0.0 545 62 3 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A5WC69 0.0 544 66 3 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter sp. (strain PRwf-1)
Q9X5N1 0.0 543 65 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Myxococcus xanthus
B8FA63 0.0 543 66 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfatibacillum aliphaticivorans
Q5F8W5 0.0 543 69 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A0Q2L0 0.0 540 65 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium novyi (strain NT)
Q0ST54 0.0 540 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain SM101 / Type A)
Q8XKK2 0.0 540 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain 13 / Type A)
Q0TQK3 0.0 540 63 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B8I8F6 0.0 540 63 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C0QHJ8 0.0 539 63 4 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q891J8 0.0 538 59 5 434 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium tetani (strain Massachusetts / E88)
B2UX12 0.0 538 62 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Alaska E43 / Type E3)
Q2RL30 0.0 536 63 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B2TPB8 0.0 535 62 5 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Eklund 17B / Type B)
Q3A3X6 0.0 535 65 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8ZXB8 0.0 534 65 4 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C1AVQ3 0.0 533 63 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus opacus (strain B4)
Q0SGZ3 0.0 533 63 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus jostii (strain RHA1)
B1L1D6 0.0 533 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Loch Maree / Type A3)
A7GIH1 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IND6 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Okra / Type B1)
C1FLA5 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Kyoto / Type A2)
A5I6W0 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KU76 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain 657 / Type Ba4)
A7FYI1 0.0 532 64 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium botulinum (strain ATCC 19397 / Type A)
Q67SJ9 0.0 531 64 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C1A1N6 0.0 531 63 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rhodococcus erythropolis (strain PR4 / NBRC 100887)
C0ZAG3 0.0 531 63 6 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A8MIS7 0.0 531 63 3 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkaliphilus oremlandii (strain OhILAs)
B0TFI7 0.0 530 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B5YI39 0.0 530 63 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A1SME0 0.0 530 62 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nocardioides sp. (strain ATCC BAA-499 / JS614)
B0KBA3 0.0 529 63 5 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K532 0.0 529 63 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Thermoanaerobacter sp. (strain X514)
B1MMV6 0.0 529 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q1B601 0.0 528 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain MCS)
A1UJ35 0.0 528 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain KMS)
A3Q2I1 0.0 528 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium sp. (strain JLS)
B8CY73 0.0 528 63 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A0R196 0.0 528 63 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q820F8 0.0 528 61 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q180E8 0.0 528 62 4 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridioides difficile (strain 630)
A1TCB3 0.0 527 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A6LT28 0.0 526 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A0PU31 0.0 526 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium ulcerans (strain Agy99)
Q9CBY6 0.0 526 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium leprae (strain TN)
B8ZRP1 0.0 526 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium leprae (strain Br4923)
B2HNG2 0.0 526 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium marinum (strain ATCC BAA-535 / M)
A4T2N8 0.0 525 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium gilvum (strain PYR-GCK)
Q6AK60 0.0 525 61 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B1VXA8 0.0 525 62 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q9F316 0.0 524 61 4 422 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5Z061 0.0 524 62 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nocardia farcinica (strain IFM 10152)
A7GTF1 0.0 524 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A4XAH9 0.0 524 61 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A5N2K7 0.0 523 61 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E684 0.0 523 61 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium kluyveri (strain NBRC 12016)
Q73XN1 0.0 523 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QDF5 0.0 523 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium avium (strain 104)
Q4FQB8 0.0 523 66 3 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P9WPB9 0.0 522 62 4 414 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U5F3 0.0 522 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P0A529 0.0 522 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8RC24 0.0 522 62 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8CXB8 0.0 521 63 6 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P9WPB8 0.0 521 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q817Q2 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HEA4 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain B4264)
B7IIY3 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain G9842)
A3DJ11 0.0 521 61 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6HD54 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q633X2 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ZK / E33L)
B9IZ47 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain Q1)
B7HQN2 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain AH187)
C1ETR8 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain 03BB102)
Q72ZV4 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JQ65 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus cereus (strain AH820)
Q81LB9 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis
C3L704 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9F7 0.0 521 62 5 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus anthracis (strain A0248)
Q7VRH0 0.0 520 59 2 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Blochmanniella floridana
C1AES4 0.0 520 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLF3 0.0 520 62 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Mycobacterium bovis (strain BCG / Pasteur 1173P2)
C3PI25 0.0 520 61 5 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q1Q8J1 0.0 519 66 5 419 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9K8F4 0.0 519 63 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7VP79 0.0 519 63 4 410 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A8M1K7 0.0 517 61 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Salinispora arenicola (strain CNS-205)
Q8Y7K9 0.0 517 63 4 411 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DHN7 0.0 517 63 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4a (strain HCC23)
Q720F3 0.0 517 63 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4b (strain F2365)
C1L2H6 0.0 517 63 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria monocytogenes serotype 4b (strain CLIP80459)
A4QGA7 0.0 517 61 4 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium glutamicum (strain R)
Q92C84 0.0 516 62 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A8FFV9 0.0 516 63 5 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus pumilus (strain SAFR-032)
B7GH25 0.0 516 62 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A6TM62 0.0 516 62 4 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Alkaliphilus metalliredigens (strain QYMF)
C5D5L4 0.0 515 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus sp. (strain WCH70)
Q8FN57 0.0 515 60 5 429 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q97FT7 0.0 515 61 4 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B9MQ33 0.0 515 60 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q5WEN9 0.0 514 62 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Shouchella clausii (strain KSM-K16)
A8F2I3 0.0 514 61 5 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia massiliae (strain Mtu5)
B7KBH7 0.0 514 61 5 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Gloeothece citriformis (strain PCC 7424)
B8HA33 0.0 514 63 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A0AI71 0.0 514 62 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
C4LJV6 0.0 514 62 5 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
A7Z7B2 0.0 514 62 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8NN26 0.0 513 61 4 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q65GJ4 0.0 513 63 5 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A0LSV2 0.0 513 63 4 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A4XHW1 1.14e-180 513 61 3 405 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A8GPK1 1.14e-180 513 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia akari (strain Hartford)
Q68W45 1.36e-180 513 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5KWJ9 2.04e-180 512 64 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus kaustophilus (strain HTA426)
B1YJW0 2.43e-180 512 62 4 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
C4K2L5 2.6e-180 512 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia peacockii (strain Rustic)
Q9ZCN1 2.63e-180 512 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia prowazekii (strain Madrid E)
C3PLG9 2.71e-180 512 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia africae (strain ESF-5)
Q92GQ4 3.13e-180 512 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GVR9 5.79e-180 511 62 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia bellii (strain OSU 85-389)
A4IRH2 7.18e-180 511 63 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Geobacillus thermodenitrificans (strain NG80-2)
O67356 1.02e-179 510 62 7 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Aquifex aeolicus (strain VF5)
C4L4J1 1.27e-179 510 61 4 414 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
P50866 1.34e-179 510 62 5 408 2 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Bacillus subtilis (strain 168)
B1WUD2 1.58e-179 510 59 5 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Crocosphaera subtropica (strain ATCC 51142 / BH68)
A8GTC4 1.7e-179 510 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia rickettsii (strain Sheila Smith)
B0BUW3 1.7e-179 510 62 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia rickettsii (strain Iowa)
B0JL96 2.34e-179 510 60 6 427 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A1VE84 2.94e-179 509 62 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitratidesulfovibrio vulgaris (strain DP4)
Q72CE7 2.94e-179 509 62 4 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B2GGB7 3.22e-179 509 60 4 415 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q88VE2 3.62e-179 509 61 4 406 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A8EZR2 4.75e-179 509 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia canadensis (strain McKiel)
Q1RJ84 5.5e-179 509 61 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia bellii (strain RML369-C)
Q55510 7.79e-179 509 59 5 438 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q24SJ9 1.9e-178 507 64 5 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfitobacterium hafniense (strain Y51)
B8FVI0 1.9e-178 507 64 5 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q5NH46 4.72e-178 506 59 3 411 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q8CNY5 4.86e-178 506 62 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNM9 4.86e-178 506 62 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0JXL2 7.95e-178 506 61 5 417 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Arthrobacter sp. (strain FB24)
Q4L715 2.24e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus haemolyticus (strain JCSC1435)
A8Z2J5 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain USA300 / TCH1516)
P63790 4.05e-177 504 61 3 402 1 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain N315)
P63789 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHK8 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Newman)
Q5HF98 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain COL)
A5ITJ9 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain JH9)
Q2FXQ7 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG62 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain USA300)
A6U2E2 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain JH1)
A7X396 4.05e-177 504 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q30Z80 5.76e-177 503 59 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5VJ94 9e-177 503 62 5 412 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Limosilactobacillus reuteri (strain DSM 20016)
Q6GG31 1.06e-176 503 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MRSA252)
Q6NFU7 1.16e-176 503 60 3 418 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B7JW74 2.04e-176 503 59 8 428 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8NW72 2.06e-176 502 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MW2)
Q6G8Q1 2.06e-176 502 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain MSSA476)
Q2YTB5 3.12e-176 501 61 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus aureus (strain bovine RF122 / ET3-1)
A6WDT9 3.34e-176 502 60 5 420 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q8GJP6 3.37e-176 501 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactococcus lactis subsp. cremoris (strain MG1363)
B1MXT8 3.88e-176 501 61 3 407 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leuconostoc citreum (strain KM20)
Q02Z22 3.93e-176 501 61 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactococcus lactis subsp. cremoris (strain SK11)
C5CAX2 4.51e-176 501 61 6 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q1MQ78 5.47e-176 501 59 6 424 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lawsonia intracellularis (strain PHE/MN1-00)
Q4UMY8 6.22e-176 501 63 4 404 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1HVE5 1.01e-175 500 62 4 403 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lysinibacillus sphaericus (strain C3-41)
C4Z1T5 1.34e-175 500 60 5 409 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q8YQX7 1.53e-175 501 58 6 441 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1XN45 2.43e-175 500 58 7 439 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A9WUW1 4.87e-175 499 61 6 421 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q6A7F1 5.4e-175 499 60 4 408 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q74JU4 5.72e-175 498 60 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q6AFZ6 5.89e-175 498 59 4 416 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Leifsonia xyli subsp. xyli (strain CTCB07)
Q3M727 8.3e-175 499 58 6 441 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q042T7 1.34e-174 497 60 4 413 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B9DNC0 1.67e-174 497 60 3 402 3 clpX ATP-dependent Clp protease ATP-binding subunit ClpX Staphylococcus carnosus (strain TM300)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17045
Feature type CDS
Gene clpX
Product ATP-dependent protease ATP-binding subunit ClpX
Location 12828 - 14108 (strand: 1)
Length 1281 (nucleotides) / 426 (amino acids)
In genomic island -

Contig

Accession ZDB_699
Length 56187 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2150
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06689 ClpX C4-type zinc finger
PF07724 AAA domain (Cdc48 subfamily)
PF10431 C-terminal, D2-small domain, of ClpB protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1219 Posttranslational modification, protein turnover, chaperones (O) O ATP-dependent protease Clp, ATPase subunit ClpX

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03544 ATP-dependent Clp protease ATP-binding subunit ClpX Cell cycle - Caulobacter -

Protein Sequence

MTDKRKDGSGKLLYCSFCGKSQHEVKKLIAGPSVYICDECVDLCNDIIREEIKDLIPARGSERSELPTPHEIRQHLDDYVIGQELAKKVLAVAVYNHYKRLRNGDKTADGVELGKSNILLIGPTGSGKTLLAETLARYLDVPFTMADATTLTEAGYVGEDVENIIQKLLQKCDYDVEKAQRGIVYIDEIDKISRKSDNPSITRDVSGEGVQQALLKLVEGTIAAVPPQGGRKHPQQEFLQVDTSKILFICGGAFAGLDKVVGQRLNTRSGIGFGAEVRGEKDKATEGELLSQVEPEDLIKFGLIPEFIGRLPVVATLGELSEDALIQILQEPKNALTKQYQALFSIEDVELEFRREALIAIAKKAMKRKTGARGLRSIVEAALLNTMYDLPSMENVEKVVIDENVITNQTEPMLIYRKPEAQVSGE

Flanking regions ( +/- flanking 50bp)

TTTTTGCGGCTCACAGGCGGTGAGCTGTACTGATTAAGTGAGGTTTACTGATGACAGACAAACGCAAAGACGGTTCAGGAAAGCTGCTGTACTGCTCTTTCTGCGGAAAAAGTCAGCATGAGGTTAAGAAACTGATTGCCGGCCCGTCAGTGTATATCTGTGATGAATGCGTTGATTTATGCAACGATATTATCCGTGAAGAAATTAAAGATCTGATCCCGGCCCGCGGCAGTGAGCGCAGTGAACTGCCGACGCCTCATGAAATTCGTCAGCACCTCGATGACTATGTCATTGGTCAGGAACTGGCTAAAAAAGTGCTGGCAGTCGCGGTATACAACCACTACAAACGTCTGCGCAACGGCGATAAAACCGCTGACGGTGTGGAACTGGGTAAAAGTAACATTCTGCTGATCGGCCCGACCGGCAGCGGTAAAACCCTGCTGGCTGAAACTCTGGCCCGCTACCTGGATGTGCCGTTCACCATGGCGGATGCCACCACACTGACCGAAGCCGGTTATGTGGGGGAGGATGTCGAAAACATCATTCAGAAGCTTTTACAGAAATGCGACTATGATGTGGAGAAAGCACAGCGCGGTATCGTCTATATTGATGAAATCGATAAAATCTCCCGTAAATCAGATAACCCGTCGATTACCCGTGATGTTTCCGGTGAAGGTGTTCAGCAGGCACTGCTGAAACTGGTTGAAGGGACTATCGCTGCTGTTCCGCCGCAGGGCGGGCGCAAACATCCGCAGCAGGAGTTTTTACAGGTTGATACCTCGAAAATTCTGTTTATCTGCGGCGGGGCGTTTGCCGGTCTGGATAAAGTGGTCGGCCAGCGTCTGAACACCCGTTCCGGTATCGGTTTCGGTGCGGAAGTGCGCGGCGAGAAAGACAAAGCGACAGAAGGCGAATTACTGTCTCAGGTCGAGCCGGAAGATCTGATCAAATTTGGTCTGATCCCGGAATTTATCGGCCGTCTGCCTGTCGTGGCAACCCTCGGTGAACTGAGTGAGGATGCGCTGATTCAGATCCTTCAGGAGCCGAAAAACGCACTGACAAAACAGTATCAGGCACTGTTCAGCATTGAAGATGTTGAACTCGAGTTCCGCCGTGAAGCACTGATTGCCATTGCGAAAAAAGCCATGAAGCGTAAAACCGGTGCCCGTGGTCTGCGTTCCATCGTTGAGGCTGCGTTGCTCAACACGATGTATGATTTACCGTCGATGGAAAATGTCGAAAAAGTGGTTATCGATGAAAACGTGATAACCAACCAGACCGAACCGATGCTGATTTACCGCAAACCGGAAGCTCAGGTTTCCGGCGAGTAACGGAAAGTTAGCGCAGTTGTTATCAATATTAACTAAATGAGGGAATTTTC