Homologs in group_2139

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16050 FBDBKF_16050 91.1 Morganella morganii S1 ybaL YbaL family putative K(+) efflux transporter
EHELCC_18655 EHELCC_18655 91.1 Morganella morganii S2 ybaL YbaL family putative K(+) efflux transporter
NLDBIP_17485 NLDBIP_17485 91.1 Morganella morganii S4 ybaL YbaL family putative K(+) efflux transporter
LHKJJB_17175 LHKJJB_17175 91.1 Morganella morganii S3 ybaL YbaL family putative K(+) efflux transporter
HKOGLL_17220 HKOGLL_17220 91.1 Morganella morganii S5 ybaL YbaL family putative K(+) efflux transporter
PMI_RS10745 PMI_RS10745 73.4 Proteus mirabilis HI4320 ybaL YbaL family putative K(+) efflux transporter

Distribution of the homologs in the orthogroup group_2139

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2139

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39830 0.0 732 70 1 547 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
P52071 3.12e-94 293 61 1 274 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
P44933 5.51e-54 197 26 11 591 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1JIU4 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 1.02e-49 185 30 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
A8AQP0 1.07e-48 182 28 7 511 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q0D3 4.85e-47 177 29 7 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 4.85e-47 177 29 7 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
C6DG97 5.04e-47 177 29 4 529 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8ZLL3 5.35e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 5.35e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F8G9 5.35e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
B5BH03 6.21e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 6.21e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z1Y7 8.19e-47 177 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
B4TKN2 1.3e-46 176 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
B4SUV7 1.54e-46 176 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
B5FJN1 2.15e-46 176 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
B4TXF9 2.22e-46 176 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B5R2A8 2.24e-46 176 28 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
Q6CZU5 2.37e-46 176 28 4 529 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VK47 6.3e-46 174 30 8 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4W6F3 1.32e-45 174 30 10 514 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
Q9ZUN3 2.44e-45 172 34 3 359 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
B5XN76 4.55e-45 172 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
B7N1D2 1.43e-44 171 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
A9MN27 3.43e-44 169 29 6 509 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1IPB4 3.56e-44 169 29 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LVT8 4.35e-44 169 29 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P45522 6.1e-44 169 29 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
B1X6K0 6.1e-44 169 29 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 6.1e-44 169 29 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R5T2 6.86e-44 169 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
Q8FCY0 6.86e-44 169 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 6.86e-44 169 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B7MCW6 6.86e-44 169 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8X878 7e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
A6TEY9 7.71e-44 168 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3YWS1 8.42e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 8.42e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 8.42e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
A8A5F8 8.42e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 8.42e-44 168 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
B1LHF1 1.01e-43 168 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
B7UK61 1.03e-43 168 28 8 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A8ALQ4 1.89e-43 167 29 9 518 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2U3F5 2.39e-43 167 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M1Q2 2.51e-43 167 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
A7ZSM6 2.51e-43 167 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NDV9 3.86e-43 166 28 6 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3Z5W2 4.2e-43 167 28 10 535 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
Q8ZRW2 5.31e-43 166 30 11 519 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q83SQ3 5.46e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
Q8Z9K0 5.9e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
B5YZ83 6.02e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 6.02e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
B1LFY1 7.24e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
Q326I6 7.9e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 7.9e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 7.9e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 7.9e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 7.9e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B5F767 8.21e-43 166 29 9 518 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
B5BL23 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 8.54e-43 166 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
B7L4H0 8.54e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 8.54e-43 166 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MYL9 9.14e-43 166 30 11 519 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B7N7S2 1.4e-42 165 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0T8E8 1.56e-42 165 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
A6T4I3 1.69e-42 165 30 11 517 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TJ42 2e-42 165 30 11 519 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
P03819 2.32e-42 164 28 9 534 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 2.32e-42 164 28 9 534 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 2.32e-42 164 28 9 534 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 2.32e-42 164 28 9 534 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
B4TWT1 2.46e-42 164 30 11 519 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
Q57TH4 2.79e-42 164 28 8 516 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
Q0TLU2 2.87e-42 164 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MNQ4 4.1e-42 164 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7NHF1 4.1e-42 164 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UI93 4.1e-42 164 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1RGF1 6.34e-42 163 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 6.34e-42 163 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
A9MQG6 6.53e-42 163 29 10 517 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q31VU0 8.14e-42 163 28 7 514 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
A7ME23 9.11e-42 162 28 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
Q8FLA1 1.11e-41 162 28 10 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4WFE4 1.55e-41 162 27 7 506 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
B5Y1Z8 4.3e-41 161 30 13 518 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
A7MIA0 4.42e-41 161 28 9 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
Q8VYR9 4.64e-41 160 32 6 416 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
Q0ZAH7 2.55e-40 159 27 9 543 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
B5X0N6 4.67e-40 157 31 3 359 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
Q9X756 3.84e-37 149 28 10 514 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
Q83PY0 8.94e-37 147 27 8 503 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
O65272 1.25e-33 140 30 8 434 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q9ZTZ7 3.22e-32 136 30 6 433 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
Q2W031 4.84e-30 126 29 5 369 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9M0Z3 3.18e-26 117 25 10 604 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
Q9KI10 6.75e-17 86 25 8 369 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
B3VQ24 1.94e-16 85 24 9 383 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q55190 5.23e-15 81 26 11 426 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8BH01 5.58e-15 82 25 11 385 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
Q6UWJ1 1.27e-14 80 25 12 387 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
O07536 2.94e-13 75 27 10 358 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
D3FSJ3 4.72e-13 74 25 11 402 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q57604 1.46e-10 66 30 3 139 4 MJ0138.1 Potassium channel protein 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P26235 3.96e-10 65 24 11 390 1 napA Na(+)/H(+) antiporter Enterococcus hirae
Q58752 5.48e-09 62 33 5 122 4 MJ1357 Probable potassium channel protein 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q55736 4.34e-08 60 26 18 420 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31615 4.91e-07 56 23 13 416 3 cpaA Putative Na(+)/H(+) antiporter YjbQ Bacillus subtilis (strain 168)
P56509 4.67e-06 53 28 2 122 4 Mfer_0534 Uncharacterized protein Mfer_0534 Methanothermus fervidus (strain ATCC 43054 / DSM 2088 / JCM 10308 / V24 S)
Q9SIT5 5.12e-06 53 21 10 376 2 CHX15 Cation/H(+) antiporter 15 Arabidopsis thaliana
Q9SUQ7 5.61e-05 50 26 12 341 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16220
Feature type CDS
Gene ybaL
Product YbaL family putative K(+) efflux transporter
Location 54423 - 56243 (strand: 1)
Length 1821 (nucleotides) / 606 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2139
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4651 Inorganic ion transport and metabolism (P) P Predicted Kef-type K+ transport protein, K+/H+ antiporter domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03455 K+:H+ antiporter - -

Protein Sequence

MHSTPLITTIVGGLVLAYLFGMLAQRLKISPLVGYLAAGVLAGPFTPGFVADASLAPELAEIGIILLMFGVGLHFSLKDLLAVKNIAIPGAICQIAVATILGLGLASLFDWGLFTGIVFGLSLSTASTVVLLRALEERQLIDSQRGQIAIGWLIVEDLAMVLTLVLLPAAASIINNPEASASSSELLLSLAVTIGKVVAFILIMIFIGRRAIPWLLARTAATGSRELFTLAVLVLALGIAYAAVTLFEASFALGAFFAGMVLNESELSHRAAQDTLPLRDAFAVLFFVSVGMLFDPMVLINHPLGILGVLAIIIVGKSAAAMLLVRLFGHNRRTALTVAVSLAQIGEFAFILAGMGVVLEVLNRQANDLILAGAIVSIMLNPILFTLLDRYLEKTETPQEQQEEETLDEVTQVPVNICGHTIIVGYGRVGSMLAEKLHNKGYPVVVIEDTRARFEELAERGFASVMGNAVSPDVLELARVDCARSLLLTIPNGYEAGEIVAKARALNDHMTIIVRAHYDDERTYIMERGANRVVIGEFEIARAMSSLLVEDQTDHEFGCPVVVNPVTEKRQEEEEEGRSLHEMLRKAPEVTPEPKTPADSTPQPSA

Flanking regions ( +/- flanking 50bp)

ATAATATATCCACATTTATTCACATTGCGAATCAAAAGGAGAATGAAAAAGTGCACTCAACGCCTCTCATTACAACAATTGTTGGTGGTCTCGTTCTCGCTTATTTATTTGGTATGTTAGCTCAGCGGTTAAAAATTTCGCCGTTAGTGGGTTATCTGGCAGCGGGTGTGCTGGCCGGACCTTTTACACCGGGATTTGTTGCCGATGCGTCTCTGGCCCCGGAACTTGCTGAGATTGGTATTATTTTGCTGATGTTCGGCGTCGGGCTTCATTTTTCCCTCAAAGATCTGCTGGCGGTTAAAAATATCGCAATCCCCGGCGCAATTTGTCAGATAGCGGTAGCCACTATTCTGGGGCTGGGTCTTGCCAGTCTGTTTGACTGGGGGCTGTTTACCGGTATTGTCTTTGGTCTGAGCTTATCTACCGCAAGTACGGTTGTGCTGCTGCGAGCCCTGGAAGAGCGGCAGCTTATTGACAGTCAGCGCGGTCAGATAGCTATCGGCTGGCTGATTGTGGAAGACCTGGCGATGGTGCTGACCCTGGTCCTGTTACCGGCGGCAGCGTCCATCATCAATAATCCGGAAGCCAGCGCCAGCAGTTCTGAGTTGCTGCTGAGCCTCGCCGTGACCATCGGTAAAGTGGTCGCCTTCATTCTGATTATGATTTTCATCGGTCGCCGTGCTATTCCCTGGTTACTCGCCAGAACCGCCGCAACCGGTTCCCGTGAGCTGTTCACGCTGGCGGTACTGGTACTGGCGCTGGGGATAGCCTACGCGGCCGTTACACTCTTTGAGGCCTCATTTGCTCTGGGCGCGTTCTTCGCCGGTATGGTGCTCAACGAGTCGGAACTGAGCCACCGCGCCGCACAGGATACCCTGCCGCTGCGTGATGCATTCGCCGTTCTGTTCTTTGTCTCCGTCGGGATGCTGTTTGACCCGATGGTACTGATTAATCATCCGCTGGGTATTTTAGGTGTTCTGGCGATCATTATTGTCGGTAAGTCAGCGGCGGCAATGCTGCTTGTGCGATTGTTCGGACATAACCGGCGAACCGCGCTGACAGTTGCGGTGAGTCTGGCACAAATCGGTGAGTTTGCCTTTATCCTGGCCGGAATGGGCGTGGTGCTGGAAGTCCTCAACCGCCAGGCCAATGACCTGATTTTAGCCGGGGCGATAGTCTCGATTATGCTCAATCCGATTTTATTCACCCTGCTTGACCGTTACCTTGAAAAAACGGAAACACCGCAAGAACAACAGGAAGAAGAAACACTGGATGAAGTGACCCAGGTTCCGGTCAATATCTGCGGTCATACTATCATTGTCGGTTATGGCCGGGTCGGTTCAATGCTGGCAGAAAAACTGCACAATAAAGGCTATCCGGTTGTTGTAATTGAAGATACCCGCGCCCGCTTTGAAGAACTGGCAGAACGCGGTTTTGCGTCCGTGATGGGCAATGCGGTTTCACCTGATGTGCTGGAACTGGCGCGTGTGGATTGCGCACGCTCACTGCTGCTGACCATTCCGAATGGCTATGAGGCCGGTGAGATTGTGGCAAAAGCCCGCGCCCTGAACGATCATATGACGATTATTGTCCGTGCGCATTATGACGATGAACGCACGTATATTATGGAGCGCGGCGCAAACCGTGTGGTTATCGGTGAGTTTGAAATTGCCCGTGCAATGAGCAGTCTGCTGGTTGAAGACCAGACAGATCATGAGTTCGGCTGCCCTGTGGTGGTTAATCCGGTGACGGAAAAACGTCAGGAAGAAGAAGAGGAAGGCCGTTCACTGCATGAAATGCTGCGCAAAGCGCCGGAAGTGACGCCGGAACCGAAAACACCGGCGGACAGCACGCCGCAGCCATCTGCATAAATAAGACAGACACTACCAGCCCGGCACAGTCCGGGCTTTTTTATCTTTCC