Homologs in group_2176

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16050 FBDBKF_16050 100.0 Morganella morganii S1 ybaL YbaL family putative K(+) efflux transporter
NLDBIP_17485 NLDBIP_17485 100.0 Morganella morganii S4 ybaL YbaL family putative K(+) efflux transporter
LHKJJB_17175 LHKJJB_17175 100.0 Morganella morganii S3 ybaL YbaL family putative K(+) efflux transporter
HKOGLL_17220 HKOGLL_17220 100.0 Morganella morganii S5 ybaL YbaL family putative K(+) efflux transporter
F4V73_RS16220 F4V73_RS16220 91.1 Morganella psychrotolerans ybaL YbaL family putative K(+) efflux transporter
PMI_RS10745 PMI_RS10745 74.7 Proteus mirabilis HI4320 ybaL YbaL family putative K(+) efflux transporter

Distribution of the homologs in the orthogroup group_2176

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2176

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39830 0.0 738 71 1 547 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
P52071 4.35e-94 293 61 1 274 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
P44933 4.61e-53 194 27 9 530 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1JIU4 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 1.95e-52 192 31 9 534 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
A8AQP0 6e-49 182 28 7 511 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q0D3 8.16e-49 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 8.16e-49 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
B5BH03 9.67e-49 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 9.67e-49 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZLL3 1.05e-48 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 1.05e-48 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F8G9 1.05e-48 182 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
B4TKN2 1.16e-48 182 29 9 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
Q8Z1Y7 1.92e-48 181 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
B4SUV7 2.39e-48 181 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
B5FJN1 3.92e-48 180 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
B5R2A8 4.83e-48 180 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
B4TXF9 5.5e-48 180 29 8 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B5XN76 9.91e-47 176 29 8 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
B2VK47 2.27e-46 176 29 7 512 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9MN27 2.61e-46 175 29 9 510 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7N1D2 6.66e-46 174 29 7 511 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
B1IPB4 1.21e-45 173 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5YZ83 1.29e-45 174 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 1.29e-45 174 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
Q83SQ3 1.53e-45 173 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
A6TEY9 1.75e-45 173 29 8 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1LFY1 1.79e-45 173 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
Q3Z5W2 1.92e-45 173 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
Q9ZUN3 2.29e-45 172 34 4 362 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
Q1R5T2 2.59e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
Q8FCY0 2.59e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 2.59e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B7MCW6 2.59e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7L4H0 3.22e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 3.22e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q326I6 3.29e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 3.29e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 3.29e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 3.29e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 3.29e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B1LHF1 3.31e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
Q8X878 3.43e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
Q3YWS1 3.52e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 3.52e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 3.52e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
A8A5F8 3.52e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 3.52e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
A4W6F3 3.78e-45 172 30 10 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
B7UK61 4.11e-45 172 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N7S2 4.16e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LVT8 4.68e-45 172 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7M1Q2 5.8e-45 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
A7ZSM6 5.8e-45 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
P45522 6.16e-45 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
B1X6K0 6.16e-45 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 6.16e-45 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
P03819 8.93e-45 171 29 10 533 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 8.93e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 8.93e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 8.93e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
Q0TLU2 9.75e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RGF1 9.94e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 9.94e-45 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
B2U3F5 1.07e-44 171 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7MNQ4 1.15e-44 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7UI93 1.15e-44 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0T8E8 1.26e-44 171 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
Q6CZU5 1.43e-44 171 29 6 533 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7NHF1 1.84e-44 170 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8FLA1 2.05e-44 170 29 10 533 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8ALQ4 2.13e-44 170 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WFE4 2.27e-44 170 28 9 495 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
C6DG97 2.38e-44 170 28 3 531 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7NDV9 2.74e-44 169 29 9 513 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8Z9K0 5.45e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
Q8ZRW2 5.72e-44 169 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BL23 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 7.44e-44 169 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
B5F767 1.04e-43 168 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
A9MYL9 1.22e-43 168 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TWT1 2.22e-43 167 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
B4TJ42 2.69e-43 167 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
Q57TH4 2.88e-43 167 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
A6T4I3 2.89e-43 167 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q31VU0 4.34e-43 166 29 10 515 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
A9MQG6 1.25e-42 165 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5Y1Z8 1.51e-42 165 30 11 513 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
A7ME23 1.56e-42 164 29 11 511 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
Q8VYR9 4.6e-42 163 32 6 416 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
A7MIA0 1.28e-40 159 30 9 512 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
B5X0N6 1.43e-40 159 32 3 359 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
Q0ZAH7 1.51e-38 154 26 7 530 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
Q83PY0 1.74e-37 149 27 11 504 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
Q9X756 4.32e-37 149 28 11 536 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
O65272 8.79e-36 147 30 7 452 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q9ZTZ7 2.99e-35 145 29 9 497 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
Q2W031 2.74e-31 130 29 4 368 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9M0Z3 2.67e-24 111 25 9 527 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
B3VQ24 1.59e-18 91 24 7 384 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q9KI10 2.74e-18 90 25 8 371 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
Q8BH01 5.96e-16 85 26 12 405 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
Q55190 8.42e-16 84 27 8 360 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6UWJ1 3.72e-15 82 25 10 399 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
D3FSJ3 2.58e-14 78 25 10 399 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
O07536 7.41e-13 74 25 7 352 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
P26235 5.25e-11 68 25 9 383 1 napA Na(+)/H(+) antiporter Enterococcus hirae
Q55736 2.83e-10 67 27 14 331 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q57604 1.98e-08 60 28 3 139 4 MJ0138.1 Potassium channel protein 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58752 1.12e-07 57 31 5 122 4 MJ1357 Probable potassium channel protein 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O31615 3.56e-07 57 24 16 417 3 cpaA Putative Na(+)/H(+) antiporter YjbQ Bacillus subtilis (strain 168)
P56509 0.000103 48 26 2 122 4 Mfer_0534 Uncharacterized protein Mfer_0534 Methanothermus fervidus (strain ATCC 43054 / DSM 2088 / JCM 10308 / V24 S)
Q9SUQ7 0.000163 48 25 16 420 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana
Q9SIT5 0.000269 47 19 10 377 2 CHX15 Cation/H(+) antiporter 15 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_18655
Feature type CDS
Gene ybaL
Product YbaL family putative K(+) efflux transporter
Location 21711 - 23507 (strand: -1)
Length 1797 (nucleotides) / 598 (amino acids)
In genomic island -

Contig

Accession ZDB_238
Length 26182 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2176
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4651 Inorganic ion transport and metabolism (P) P Predicted Kef-type K+ transport protein, K+/H+ antiporter domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K26735 K+:H+ antiporter - -

Protein Sequence

MHSTPLITTIVGGLVLAYLLGMLAQRLKISPLVGYLAAGVLAGPFTPGFVADTSLAPELAEIGVILLMFGVGLHFSLKDLLAVKNIAIPGAICQIAVATILGLGLSSLFGWGLFAGIVFGLSLSTASTVVLLRALEERQLIESQRGQIAIGWLIVEDLAMVLTLVLLPAAASIINNPEASASTSDLLISLSITIGKVVAFILIMIFIGRRVIPWLLARTAATGSRELFTLAVLVLALGIAYAAVALFDASFALGAFFAGMVLNESELSHRAAQDTLPLRDAFAVLFFVSVGMLFDPMVLINHPLGVLGVLAIIIIGKSAAALLLVRMFGHNRRTALTVAVSLAQIGEFAFILAGMGVTLEVLNRQANDLILAGAIVSIMLNPVLFTLLDRYLEKTETPEEQQEEETLEEITQVPVNICGHTIIVGYGRVGAMLADKLHNKGYPVVVVEDTRARFEELAERGFPSVMGNAVAQDVLELARADCASALLLTIPNGYEAGEIVAKARAMNAHMTIIVRAHYDDERTYIMERGANRVVIGEFEIARAMSTLLVENQTDHEFGCPVNINPAAETETEGRSLHDMLRKPEADAAPENQNPHPSA

Flanking regions ( +/- flanking 50bp)

TAGCTAACCCACATCCGTTCACACCACTAATCAAAAGGAGAATGAAAAAAGTGCATTCAACGCCTCTTATCACAACTATTGTTGGCGGTCTCGTTCTCGCTTATTTACTCGGTATGTTAGCGCAGCGGTTAAAGATTTCCCCGTTAGTGGGTTATCTGGCGGCGGGTGTGTTAGCAGGCCCTTTTACCCCGGGATTTGTTGCCGATACATCACTGGCACCGGAACTGGCGGAAATCGGGGTTATTCTGCTGATGTTCGGGGTCGGGCTCCATTTTTCACTGAAAGATTTGCTGGCGGTTAAAAACATCGCCATTCCGGGTGCTATCTGTCAGATAGCCGTCGCAACTATTTTAGGTCTCGGCCTTTCCAGTCTGTTCGGCTGGGGATTATTTGCCGGGATCGTATTTGGTCTGAGCTTATCCACCGCGAGTACCGTGGTGTTGCTGCGCGCCCTGGAAGAGCGGCAGCTGATAGAAAGCCAGCGCGGTCAGATAGCCATCGGCTGGCTGATTGTTGAAGACCTCGCCATGGTGTTAACCCTGGTGCTGTTACCGGCTGCCGCCTCTATCATTAATAACCCGGAGGCCAGTGCCAGCACATCAGATCTGCTGATAAGCCTGAGCATTACTATCGGTAAGGTCGTGGCATTCATCCTGATTATGATTTTTATCGGGCGCCGAGTGATCCCGTGGTTACTCGCCAGAACAGCCGCTACCGGCTCCCGCGAGCTGTTTACCCTGGCAGTGCTGGTGCTGGCGCTGGGTATTGCTTATGCCGCTGTCGCGCTGTTTGATGCCTCGTTTGCCCTCGGCGCGTTCTTTGCCGGTATGGTGCTCAATGAGTCAGAACTGAGCCACCGCGCCGCACAGGATACCCTGCCGCTGCGTGACGCCTTCGCGGTACTGTTCTTTGTCTCTGTCGGAATGCTGTTTGACCCGATGGTGCTGATTAACCATCCGCTGGGTGTGCTCGGTGTGCTGGCGATTATTATCATCGGTAAATCCGCCGCCGCCCTGCTGCTGGTGAGGATGTTCGGCCATAACCGGCGGACAGCCCTGACAGTCGCCGTCAGTCTCGCGCAAATCGGGGAATTCGCCTTTATCCTCGCGGGAATGGGGGTCACGCTGGAAGTCCTCAACCGCCAGGCTAATGACCTGATCCTGGCCGGTGCGATTGTCTCTATCATGCTCAACCCGGTGCTGTTCACGCTGCTGGACCGCTATCTGGAAAAAACCGAAACACCGGAAGAGCAGCAGGAAGAAGAAACGCTGGAAGAAATCACCCAGGTGCCGGTCAATATCTGCGGACATACTATTATTGTCGGTTATGGCCGCGTCGGTGCGATGCTGGCGGATAAACTGCATAATAAAGGGTATCCGGTTGTGGTGGTGGAAGATACCCGCGCCCGCTTTGAAGAGCTTGCCGAACGCGGCTTCCCTTCCGTGATGGGGAATGCGGTGGCACAGGATGTGCTGGAGCTTGCCCGTGCCGATTGCGCCAGTGCGCTGCTGCTGACCATTCCGAACGGCTATGAGGCCGGTGAGATTGTCGCCAAAGCCCGTGCCATGAACGCACATATGACGATTATTGTCCGCGCGCATTATGATGACGAGCGCACTTATATTATGGAGCGTGGCGCAAACCGTGTGGTGATTGGTGAGTTTGAAATTGCCCGTGCGATGAGCACACTGCTGGTGGAAAACCAGACTGATCATGAATTCGGCTGCCCGGTCAATATCAATCCGGCGGCGGAAACAGAGACGGAAGGCCGCTCACTGCATGACATGCTGCGCAAACCTGAAGCAGATGCCGCCCCGGAGAACCAGAATCCGCATCCGTCGGCATAATTTGTTTTAACCTGCTGAAATAACAAGCCCGGATTTTCCGGGCTTGTTAT