Homologs in group_2176

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16050 FBDBKF_16050 74.7 Morganella morganii S1 ybaL YbaL family putative K(+) efflux transporter
EHELCC_18655 EHELCC_18655 74.7 Morganella morganii S2 ybaL YbaL family putative K(+) efflux transporter
NLDBIP_17485 NLDBIP_17485 74.7 Morganella morganii S4 ybaL YbaL family putative K(+) efflux transporter
LHKJJB_17175 LHKJJB_17175 74.7 Morganella morganii S3 ybaL YbaL family putative K(+) efflux transporter
HKOGLL_17220 HKOGLL_17220 74.7 Morganella morganii S5 ybaL YbaL family putative K(+) efflux transporter
F4V73_RS16220 F4V73_RS16220 73.4 Morganella psychrotolerans ybaL YbaL family putative K(+) efflux transporter

Distribution of the homologs in the orthogroup group_2176

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2176

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39830 0.0 763 71 3 559 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
P52071 3.37e-99 305 62 1 276 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
A8AQP0 4.19e-57 205 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5FJN1 1.89e-54 197 30 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
B5R2A8 2.03e-54 197 30 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
B4TKN2 1e-53 196 29 8 499 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
Q8ZLL3 1.56e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 1.56e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F8G9 1.56e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
B5BH03 1.66e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 1.66e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUV7 2.18e-53 195 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
Q8Z1Y7 2.36e-53 194 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
C0Q0D3 4.69e-53 194 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 4.69e-53 194 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
B1JIU4 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 5.89e-53 194 29 6 521 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
C6DG97 8.34e-53 193 30 7 519 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4TXF9 9.3e-53 193 29 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B5XN76 2.23e-52 192 30 9 499 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
A9MN27 2.44e-52 192 30 9 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7N1D2 4.6e-52 191 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
Q1R5T2 2.92e-51 189 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
Q8FCY0 2.92e-51 189 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 2.92e-51 189 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B7MCW6 2.92e-51 189 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
Q6CZU5 3.87e-51 189 29 8 519 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1IPB4 4.03e-51 188 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8X878 7.26e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
A6TEY9 7.72e-51 187 30 9 499 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3YWS1 7.88e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 7.88e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 7.88e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
A8A5F8 7.88e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 7.88e-51 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
B2VK47 8.89e-51 187 30 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7UK61 9.16e-51 187 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P45522 1.26e-50 187 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
B1X6K0 1.26e-50 187 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 1.26e-50 187 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
B2U3F5 1.7e-50 187 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M1Q2 1.96e-50 186 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
A7ZSM6 1.96e-50 186 30 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
A4WFE4 2.37e-50 186 28 8 498 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
B1LHF1 1.52e-49 184 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
B7NDV9 1.97e-49 184 29 9 501 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ME23 1.57e-48 181 29 7 496 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
Q31VU0 2.31e-48 181 30 10 503 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
P44933 4.07e-47 177 26 7 496 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZUN3 3.21e-46 175 33 3 358 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
A4W6F3 6.32e-46 174 29 11 507 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
A8ALQ4 9.62e-46 174 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LVT8 1.3e-45 173 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3Z5W2 1.84e-45 173 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
Q83SQ3 2.33e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
B1LFY1 2.4e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
P03819 2.45e-45 172 29 9 505 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 2.45e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 2.45e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 2.45e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
Q326I6 2.6e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 2.6e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 2.6e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 2.6e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 2.6e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B7L4H0 2.75e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 2.75e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8Z9K0 3.92e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
A9MYL9 4e-45 172 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B7MNQ4 4.04e-45 172 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7UI93 4.04e-45 172 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N7S2 4.63e-45 172 28 8 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1RGF1 4.96e-45 172 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 4.96e-45 172 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
B5BL23 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 6.41e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
B5F767 6.8e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
B5YZ83 7.72e-45 171 29 9 501 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 7.72e-45 171 29 9 501 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
B4TJ42 8.03e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
Q8ZRW2 9.12e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FLA1 9.12e-45 171 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B4TWT1 9.58e-45 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
Q0TLU2 1.11e-44 171 28 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0T8E8 1.34e-44 171 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
B7NHF1 1.43e-44 171 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q57TH4 2.79e-44 170 29 9 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
Q83PY0 1.46e-43 167 28 10 492 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
A9MQG6 2.69e-43 167 29 10 510 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5X0N6 5e-43 166 30 4 392 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
A7MIA0 7.65e-42 163 28 8 506 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
B5Y1Z8 2.85e-40 158 29 10 505 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
Q9ZTZ7 1.53e-39 158 30 9 507 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
Q0ZAH7 1.81e-39 156 28 11 510 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
Q8VYR9 2.5e-39 155 29 5 412 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
A6T4I3 3.31e-39 155 29 10 498 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
O65272 3.02e-38 154 31 8 455 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q9X756 5.34e-32 134 27 10 498 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
Q2W031 1.59e-26 115 29 6 372 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9M0Z3 1.38e-22 106 25 15 577 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
Q8BH01 4.9e-20 97 26 9 381 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
Q6UWJ1 5.34e-20 97 25 9 379 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
B3VQ24 2.68e-19 93 25 7 376 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q9KI10 8.08e-19 92 26 9 368 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
Q55190 9.84e-16 83 27 10 421 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O07536 2.6e-15 81 26 10 404 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
D3FSJ3 4.06e-14 77 25 11 396 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q58752 3.42e-10 65 28 4 160 4 MJ1357 Probable potassium channel protein 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57604 1.14e-09 63 33 1 101 4 MJ0138.1 Potassium channel protein 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q55736 2.86e-08 60 25 12 331 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9SUQ7 6.23e-07 56 29 12 288 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana
P26235 6.48e-07 55 28 3 163 1 napA Na(+)/H(+) antiporter Enterococcus hirae
Q9SIT5 2.58e-06 54 23 13 379 2 CHX15 Cation/H(+) antiporter 15 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10745
Feature type CDS
Gene ybaL
Product YbaL family putative K(+) efflux transporter
Location 2364104 - 2365864 (strand: 1)
Length 1761 (nucleotides) / 586 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2176
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4651 Inorganic ion transport and metabolism (P) P Predicted Kef-type K+ transport protein, K+/H+ antiporter domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K26735 K+:H+ antiporter - -

Protein Sequence

MPHSTPLITTIVGGLALAYILGMIAQRLKISPLVGYLAAGVLAGPFTPGFVADTSLAPELAEIGVILLMFGVGLHFSLKDLMAVKAIAIPGAIAQITVATLLGLGLSTFFGWGLFSGIVFGLCLSTASTVVLLRALEERGLIDSQRGQIAIGWLIVEDLAMVLALVLLPAIANMLESSDQTSISQLLINLGITIGKVVAFILIMMIVGRKLIPWILAKTAATGSRELFTLCVLALALGIAYAAVTLFDASFALGAFFAGMVLNESDLSHRAAQDTLPLRDAFAVLFFVSVGMLFDPMVLIEHPLGILATLAIIIIGKSLAALVLVRMFGHSRRTALTISASLAQIGEFAFILAGMGVALNVLEPDARNLVLAGALVSIMLNPVLFSLLDRYLAKTETKEEQEQLQQEEMEEEMPVPVDICGHAIIVGYGRAGSMLAEKLQPQAIPLVIIENSRNKFAELKEKGLNAVLGNAMTKESLALARVDCAKSLLLTIPNGYEAADIAETARKMNPDLNIIVRAHFDDIIVRANYDEEASFILEKGANHVIIDEDQTASAMAEMLIQEVEFGCAIDDTPEEGQQIIAPNAAQ

Flanking regions ( +/- flanking 50bp)

GTACCACTCGCCCCCCGATACATGTAGTTTAATAACAAGAAGGAGAATTGATGCCGCATTCAACCCCACTCATTACCACCATTGTTGGTGGCTTAGCACTTGCTTACATCTTAGGCATGATTGCTCAACGGCTAAAAATCTCACCTTTAGTAGGATATCTTGCTGCGGGTGTGCTCGCTGGCCCATTTACCCCCGGCTTCGTTGCTGATACCTCTTTGGCGCCTGAGCTTGCTGAAATCGGTGTTATCTTACTGATGTTTGGCGTAGGTTTACATTTTTCTTTAAAAGACCTAATGGCTGTAAAAGCTATCGCGATCCCCGGTGCCATAGCACAAATTACCGTTGCCACCTTATTAGGGTTAGGGTTATCCACTTTCTTTGGCTGGGGTCTATTTAGTGGCATTGTCTTTGGATTATGCCTTTCAACGGCAAGTACTGTGGTATTGCTACGCGCACTCGAAGAAAGAGGTTTAATTGATAGCCAGCGCGGTCAAATCGCTATTGGTTGGTTAATTGTCGAAGATCTCGCTATGGTATTAGCCTTAGTACTACTACCAGCTATTGCCAATATGCTTGAAAGTAGTGACCAAACAAGTATTTCACAGTTATTAATTAACTTAGGTATCACTATTGGTAAAGTAGTTGCCTTTATTTTAATTATGATGATTGTCGGTCGTAAGCTTATTCCGTGGATCTTAGCTAAAACGGCTGCCACTGGCTCTCGTGAGCTTTTTACCCTATGTGTGTTAGCACTAGCTTTAGGTATCGCTTACGCAGCAGTGACGCTATTTGATGCCTCTTTCGCATTAGGCGCTTTCTTTGCCGGTATGGTACTTAATGAGTCTGACCTCAGCCACCGAGCAGCACAAGATACTTTACCTCTACGTGATGCCTTCGCCGTTCTGTTCTTTGTCTCTGTCGGCATGCTATTTGATCCTATGGTATTAATTGAGCATCCTCTAGGCATTTTAGCCACACTTGCGATCATTATTATAGGTAAATCCTTAGCAGCCCTAGTGCTCGTTCGTATGTTTGGGCATTCACGCAGAACCGCATTAACCATTTCAGCCAGTCTTGCGCAAATTGGTGAATTTGCCTTTATTTTAGCTGGAATGGGGGTTGCACTAAATGTTTTAGAGCCAGATGCACGTAACTTGGTTCTTGCCGGCGCCTTAGTCTCTATTATGCTTAATCCTGTTCTCTTCTCTTTGTTAGACCGTTATCTAGCAAAAACAGAAACCAAAGAAGAGCAAGAGCAACTTCAACAAGAAGAGATGGAAGAAGAGATGCCTGTGCCTGTCGATATTTGTGGGCATGCCATTATCGTCGGTTATGGTCGTGCAGGTAGTATGCTAGCTGAAAAGCTACAACCACAAGCTATCCCATTGGTCATTATTGAAAATAGCCGTAATAAATTTGCTGAGTTAAAAGAAAAAGGCTTAAACGCCGTACTCGGTAATGCTATGACCAAAGAATCGCTGGCATTAGCGCGTGTTGATTGTGCTAAATCGCTACTACTAACTATTCCTAACGGTTATGAAGCAGCAGATATCGCAGAAACGGCAAGAAAAATGAACCCTGATCTCAATATTATCGTTCGTGCTCATTTTGACGATATTATTGTTCGTGCTAACTATGATGAAGAAGCTTCCTTTATTCTTGAGAAAGGGGCAAATCATGTGATAATCGATGAAGATCAGACCGCTTCAGCAATGGCTGAGATGCTAATACAAGAAGTCGAGTTCGGTTGCGCCATTGATGACACACCTGAAGAGGGTCAACAAATTATTGCGCCCAATGCAGCGCAATAATAGAGATTTATTTTTAAAATAAAGGATTAACAAACTAAAAAAGCAACACC