Homologs in group_1094

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06220 FBDBKF_06220 81.9 Morganella morganii S1 thiQ thiamine ABC transporter ATP-binding protein ThiQ
EHELCC_09265 EHELCC_09265 81.9 Morganella morganii S2 thiQ thiamine ABC transporter ATP-binding protein ThiQ
NLDBIP_09645 NLDBIP_09645 81.9 Morganella morganii S4 thiQ thiamine ABC transporter ATP-binding protein ThiQ
LHKJJB_08110 LHKJJB_08110 81.9 Morganella morganii S3 thiQ thiamine ABC transporter ATP-binding protein ThiQ
HKOGLL_07660 HKOGLL_07660 81.9 Morganella morganii S5 thiQ thiamine ABC transporter ATP-binding protein ThiQ
PMI_RS11495 PMI_RS11495 64.7 Proteus mirabilis HI4320 thiQ thiamine ABC transporter ATP-binding protein ThiQ

Distribution of the homologs in the orthogroup group_1094

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1094

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8V0 1.29e-112 325 68 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D0F3 4.84e-108 313 67 0 232 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q66EN1 1.62e-106 310 66 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2NVW9 3.92e-106 308 66 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Sodalis glossinidius (strain morsitans)
Q1CMQ3 1.09e-104 305 65 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 1.09e-104 305 65 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 1.09e-104 305 65 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q326G9 3.64e-102 298 62 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q32K28 2.79e-101 296 61 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q0T8D1 3.67e-101 296 61 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q8FL82 2.66e-100 293 61 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83MG3 5.78e-100 293 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q8XA06 6.03e-100 293 61 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q3Z5U5 9.15e-100 292 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q0TLS2 1.88e-99 291 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P31548 3.25e-99 291 60 0 230 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q1RGD0 5.81e-99 290 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q8ZRV2 1.41e-97 287 60 0 231 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PDF8 1.47e-97 287 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z9I6 1.81e-97 286 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q57TF5 6.29e-97 285 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q7MPC5 2.37e-79 241 56 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 2.37e-79 241 56 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q65SC9 5.68e-79 239 54 0 213 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44986 2.99e-76 232 54 0 209 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KP42 6.68e-76 232 55 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0I354 1.17e-75 230 54 1 206 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q4QLQ1 5.76e-75 229 54 0 209 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q6LV32 4.25e-74 228 50 1 223 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q5E882 7.36e-74 226 51 0 223 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9CNP9 8.6e-74 226 52 0 209 3 thiQ Thiamine import ATP-binding protein ThiQ Pasteurella multocida (strain Pm70)
Q11D92 2.64e-73 226 48 2 235 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
Q87SV4 3.69e-73 225 49 0 219 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8FYU9 9.24e-69 214 48 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 9.24e-69 214 48 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q98FA5 2.07e-67 211 46 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q57BC2 3.11e-67 210 47 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 3.11e-67 210 47 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q7VP69 2.35e-66 207 52 1 211 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q28VL7 4.4e-61 194 43 0 219 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q8UBY6 5.39e-60 191 44 0 214 3 thiQ Thiamine import ATP-binding protein ThiQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92L31 5.16e-58 186 45 1 206 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
Q1GCR8 1.85e-57 185 48 0 204 3 thiQ Thiamine import ATP-binding protein ThiQ Ruegeria sp. (strain TM1040)
Q3IY12 6.19e-51 168 45 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q65UE1 6.45e-44 154 38 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P14788 6.76e-44 153 41 0 205 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8DIA0 7.11e-44 153 41 2 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P9WQM1 1.16e-43 153 42 0 195 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.16e-43 153 42 0 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.16e-43 153 42 0 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7NIW1 2.18e-42 149 40 0 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q6NBT1 4.75e-42 149 39 2 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P45171 9.24e-42 148 37 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3MAR5 1.1e-41 148 41 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q0I3Y9 1.3e-41 148 38 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q5WBL0 1.35e-41 144 41 3 195 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q8Z0H0 1.44e-41 147 39 0 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q73XU8 2.03e-41 147 38 1 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8YM92 2.03e-41 147 41 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P40860 2.7e-41 147 39 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 4.08e-41 146 39 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P31134 4.7e-41 147 40 2 209 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q82TL6 4.84e-41 146 37 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1B8V9 4.95e-41 147 41 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 4.95e-41 147 41 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q5E586 5.47e-41 146 38 0 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4QK57 5.71e-41 146 37 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q110U3 5.72e-41 146 40 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q9CP06 9.91e-41 145 37 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q89UD2 1.01e-40 145 38 2 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6MCV4 1.51e-40 145 37 1 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q7NWX3 1.78e-40 145 42 2 202 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P74548 1.82e-40 144 41 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O85818 2.59e-40 144 37 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q9X196 5.39e-40 144 38 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2YAD6 5.76e-40 144 42 0 187 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0AGF4 6.9e-40 143 38 0 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1TAI4 8.54e-40 143 37 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q47T99 9.55e-40 143 40 1 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
A1TXH7 1.54e-39 142 40 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9K876 1.95e-39 142 37 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8A883 2.55e-39 144 38 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q2SJY7 2.87e-39 142 39 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q9HY19 3.03e-39 142 43 2 193 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R79 3.55e-39 141 43 2 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8E8K8 4.19e-39 141 38 1 199 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7NX01 5.11e-39 141 39 2 208 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q14Q07 5.7e-39 140 38 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q7N6Z2 6.09e-39 140 38 3 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5LBT4 6.57e-39 142 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64SQ6 6.99e-39 142 37 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q609Q1 7.12e-39 140 40 1 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6D4E2 8.38e-39 141 36 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FFB3 8.52e-39 140 40 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8D0W8 8.72e-39 140 37 2 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
P16676 8.98e-39 140 40 2 196 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q7VNG4 9.01e-39 140 35 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8XBJ8 1.02e-38 140 40 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q9TKX3 1.03e-38 140 38 0 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
P54933 1.05e-38 139 38 0 200 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q9A7X1 1.06e-38 139 39 1 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q668K6 1.73e-38 139 37 2 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8EBC3 1.89e-38 140 38 1 194 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q664X5 2.12e-38 139 38 2 205 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 2.12e-38 139 38 2 205 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 2.12e-38 139 38 2 205 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 2.12e-38 139 38 2 205 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
O31339 2.22e-38 139 37 3 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q98HF7 2.61e-38 139 40 0 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6D201 2.79e-38 138 38 1 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6LR20 2.81e-38 139 37 0 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
P0AAF9 3.51e-38 135 35 6 239 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 3.51e-38 135 35 6 239 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 3.51e-38 135 35 6 239 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 3.51e-38 135 35 6 239 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q7UC29 3.58e-38 139 40 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7N986 4.13e-38 139 39 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q81GU1 4.19e-38 138 37 3 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6FFZ1 4.55e-38 136 38 2 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q93DX8 5.42e-38 136 38 2 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
D4GP38 1e-37 138 39 3 189 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q1QE80 1.25e-37 138 36 4 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q63TY1 1.28e-37 137 36 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q9I6L0 1.4e-37 136 38 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q62K82 1.49e-37 137 36 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q9KS33 1.55e-37 137 37 0 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8UA73 1.6e-37 137 37 2 198 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5YZY9 1.6e-37 136 36 3 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q88AS5 1.62e-37 136 39 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q32EY4 1.65e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q87PH3 1.68e-37 137 38 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5X627 1.76e-37 137 34 2 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q1RD28 2.1e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 2.1e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 2.14e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 2.14e-37 137 38 2 204 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 2.14e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 2.14e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 2.14e-37 137 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q9KUI0 2.77e-37 137 36 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2K4V4 3.77e-37 136 36 0 195 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1GIE5 4.36e-37 136 38 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q5ZWE4 4.41e-37 136 34 2 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q7NQN5 4.43e-37 136 39 0 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P77795 4.67e-37 135 40 2 188 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q82WT5 5.63e-37 135 37 1 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6F9A8 5.95e-37 135 38 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q92WJ0 6.4e-37 135 38 3 213 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q2K8C8 6.75e-37 135 38 3 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P63354 6.77e-37 135 37 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 6.77e-37 135 37 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0T5R2 7.02e-37 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
A3DDF6 7.12e-37 135 37 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q30V33 7.64e-37 135 38 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q5WXF0 8.29e-37 135 34 2 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q9Z3R9 8.32e-37 135 38 4 204 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
P56344 9.7e-37 132 36 0 199 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q0TA26 1.02e-36 135 36 1 218 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q88CL2 1.02e-36 134 39 3 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3Z2Z3 1.09e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.09e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q9G4F5 1.1e-36 134 36 2 203 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q72FW5 1.14e-36 135 39 4 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8U6M1 1.33e-36 134 38 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q578K3 1.46e-36 134 39 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.46e-36 134 39 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8Z7H7 1.48e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8XZP8 1.5e-36 135 38 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5PMK1 1.73e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FVT0 1.77e-36 134 38 2 197 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 1.77e-36 134 38 2 197 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.77e-36 134 38 2 197 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
P40790 1.81e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.81e-36 135 38 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q0SXQ1 1.9e-36 134 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q8FB37 1.9e-36 134 36 1 218 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8RGC8 2e-36 134 36 0 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3YUV0 2.11e-36 134 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 2.11e-36 134 36 1 214 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 2.11e-36 134 36 1 214 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 2.11e-36 134 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q7UBD0 2.17e-36 134 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q38WL5 2.72e-36 133 38 7 241 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q7W9U5 4.54e-36 133 36 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q74K65 4.57e-36 133 34 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q3IX40 4.87e-36 133 38 2 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6F0V4 5.13e-36 133 40 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A1URR2 5.38e-36 132 34 1 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q7MKU3 7.08e-36 133 37 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 7.08e-36 133 37 2 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q4K681 7.41e-36 133 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7WGW1 7.77e-36 132 36 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q81GC1 8.59e-36 132 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0S0Z3 8.64e-36 132 39 5 216 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0SBZ1 9.91e-36 132 38 5 216 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q46ZU5 1.08e-35 130 40 3 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K998 1.11e-35 132 39 2 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P10346 1.12e-35 129 36 5 226 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q8FVV5 1.37e-35 132 39 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q97UY8 1.45e-35 132 35 4 219 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q92UV5 1.46e-35 132 37 0 201 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q0RYP7 1.91e-35 131 40 4 198 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q160M2 2.03e-35 131 38 0 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q7VZE5 2.05e-35 131 36 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q042G7 2.14e-35 131 34 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8PNN4 2.17e-35 131 36 2 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q9I6T2 2.19e-35 132 38 1 194 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7NRX5 2.22e-35 132 37 4 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2K6L3 2.3e-35 131 37 2 200 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1M8R6 2.33e-35 131 37 0 196 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8Z1U0 2.6e-35 131 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
O32151 2.67e-35 131 36 3 204 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q1MCN6 2.74e-35 131 35 0 195 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UH62 2.84e-35 131 38 1 196 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P19566 2.95e-35 131 36 1 214 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 2.95e-35 131 36 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
A3PRY1 3.02e-35 131 37 2 217 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q5FL41 3.17e-35 131 35 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5LT05 3.2e-35 131 37 0 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6G5J0 3.46e-35 130 34 1 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6HLQ9 3.93e-35 130 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9JZW0 3.95e-35 130 36 1 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q63E84 3.98e-35 130 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 3.98e-35 130 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 3.98e-35 130 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q21GS5 4.43e-35 130 38 3 202 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q03PF2 4.48e-35 131 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q9JUX4 5.7e-35 130 36 1 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q81TH8 5.82e-35 129 36 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
A1B9Q7 6.45e-35 130 39 3 208 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q4QP85 6.48e-35 130 37 1 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q8RQL7 6.48e-35 127 36 6 221 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0K9I2 6.6e-35 129 38 1 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q46ZM0 6.83e-35 130 37 0 196 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q98G43 7.84e-35 130 37 3 211 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q87GB5 8.26e-35 130 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1WVI7 8.49e-35 130 35 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q63TW1 8.69e-35 129 37 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q62K56 8.81e-35 129 37 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q6D2F6 8.87e-35 129 37 5 224 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8YCG3 1e-34 129 38 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5LX21 1.07e-34 129 34 3 218 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5PKZ8 1.11e-34 130 35 1 214 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8PC11 1.13e-34 129 38 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q5WKG4 1.16e-34 127 37 4 214 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q3JSR6 1.18e-34 129 37 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q2YKR8 1.2e-34 129 36 1 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q8FW07 1.3e-34 129 36 1 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 1.3e-34 129 36 1 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q3KBH4 1.38e-34 129 40 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q5DZC6 1.45e-34 129 36 0 195 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q52815 1.45e-34 127 36 3 206 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P44513 1.6e-34 129 36 2 209 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94360 1.61e-34 129 33 4 235 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q18AM3 1.65e-34 129 32 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q8ELR4 1.73e-34 129 33 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3KCC5 1.76e-34 129 36 4 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q8FV85 1.93e-34 129 40 1 198 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.93e-34 129 40 1 198 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.93e-34 129 40 1 198 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.93e-34 129 40 1 198 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q5YRD1 2.21e-34 128 39 1 203 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q8YCB1 2.24e-34 129 37 1 201 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0RAT5 2.35e-34 130 40 0 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8XZX8 2.56e-34 129 37 2 210 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8UBB7 2.69e-34 129 36 0 194 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q28QL7 2.72e-34 128 37 4 211 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q92VJ2 3.01e-34 129 38 3 201 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q6G194 3.47e-34 128 34 1 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
A0PY57 3.7e-34 128 34 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q9KL04 4.83e-34 128 36 0 195 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RI39 4.88e-34 128 35 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q60AI1 5.93e-34 128 38 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q830W6 6.11e-34 127 34 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q1GB17 6.16e-34 127 31 1 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7MFC4 6.18e-34 128 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 6.18e-34 128 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q9MUN1 6.58e-34 127 36 0 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
A0LUE6 6.85e-34 128 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q9PDN2 7.01e-34 127 36 2 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8D653 7.35e-34 127 37 1 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q65T42 8.01e-34 127 38 1 184 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0P9X7 8.69e-34 124 32 5 229 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VZQ5 8.98e-34 124 32 4 229 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q1LNM0 9.26e-34 125 41 3 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q88ZJ6 9.38e-34 127 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8Y8T6 9.85e-34 127 35 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q24XJ2 1.06e-33 127 36 0 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q722B1 1.06e-33 127 35 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q92DL6 1.06e-33 127 35 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AGP9 1.07e-33 127 35 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q87DT9 1.09e-33 127 37 2 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q04G50 1.12e-33 127 34 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q1AS06 1.14e-33 127 34 2 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8F6Z1 1.17e-33 127 35 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.17e-33 127 35 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8UII7 1.19e-33 127 33 1 215 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5HQ70 1.2e-33 127 36 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q57SD6 1.21e-33 127 35 1 213 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q164Y5 1.27e-33 127 33 1 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q4KB64 1.29e-33 127 34 3 207 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q03ZQ0 1.4e-33 127 37 3 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9KRT4 1.44e-33 127 33 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q608V9 1.45e-33 126 34 2 211 3 modC Molybdenum import ATP-binding protein ModC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q65QT6 1.5e-33 127 35 2 204 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8NY21 1.61e-33 126 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 1.61e-33 126 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q2SVN0 1.7e-33 126 37 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q92LU2 1.73e-33 126 35 5 219 3 modC Molybdenum import ATP-binding protein ModC Rhizobium meliloti (strain 1021)
Q5L222 1.78e-33 126 33 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5HIL5 1.81e-33 126 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 1.81e-33 126 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 1.81e-33 126 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q92WD6 1.96e-33 126 33 2 230 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q1LLP5 1.98e-33 126 37 2 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q85A69 2e-33 127 34 1 203 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q8D954 2.14e-33 126 33 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q8Z8W8 2.14e-33 126 35 1 213 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q98G42 2.16e-33 126 34 0 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7MLB8 2.2e-33 126 33 0 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q5PFQ7 2.25e-33 126 35 1 213 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8G5P8 2.32e-33 127 36 1 201 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
P96063 2.58e-33 126 35 1 213 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6CZ34 2.82e-33 125 38 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92XW1 2.93e-33 125 35 3 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
A1JIE0 2.99e-33 126 37 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P55662 3.34e-33 123 33 4 236 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4KC87 3.47e-33 125 36 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q57IS3 3.6e-33 125 39 3 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q6GJL2 3.82e-33 125 32 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q8ZLF4 3.88e-33 125 39 3 194 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z245 4.17e-33 125 39 3 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
P77481 4.25e-33 125 32 4 236 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q6LK87 4.26e-33 125 37 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q1MQ44 4.79e-33 125 38 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q04BG2 5.21e-33 125 31 1 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q31VH5 5.47e-33 125 38 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q8U8D6 5.65e-33 123 36 3 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P10907 5.65e-33 125 38 2 189 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q3YW77 5.77e-33 125 38 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q21XJ9 6.78e-33 123 39 3 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q1M589 6.83e-33 124 34 0 200 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7A7E3 8.39e-33 124 33 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 8.39e-33 124 33 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q03AH0 8.69e-33 124 34 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P55453 9.55e-33 124 33 2 218 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1B677 9.87e-33 124 34 2 225 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q7A169 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.04e-32 124 36 2 195 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.04e-32 124 36 2 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q5WCI1 1.05e-32 122 35 3 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
O30144 1.08e-32 121 35 3 217 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q13ZK7 1.2e-32 124 38 4 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q39KB9 1.22e-32 124 35 1 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8CPN0 1.24e-32 124 36 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q00752 1.26e-32 124 34 4 212 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8X8K4 1.26e-32 124 34 3 203 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q6LKD4 1.31e-32 124 37 3 199 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q57293 1.41e-32 124 35 0 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
P37732 1.41e-32 124 34 3 216 3 modC1 Molybdenum import ATP-binding protein ModC 1 Azotobacter vinelandii
Q1QTX6 1.44e-32 124 34 1 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q65S66 1.57e-32 124 34 0 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q3IM24 1.58e-32 122 35 6 236 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P37009 1.61e-32 124 36 2 199 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q5PJL1 1.63e-32 124 39 3 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8X6U5 1.86e-32 124 38 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q0TI47 1.92e-32 124 34 3 203 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3SJC6 1.92e-32 124 37 4 207 3 modC Molybdenum import ATP-binding protein ModC Thiobacillus denitrificans (strain ATCC 25259)
Q49WM4 1.95e-32 124 36 2 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8FHR3 2.04e-32 124 34 3 203 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I2N4 2.08e-32 124 33 3 213 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1GID1 2.08e-32 123 35 2 202 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q6NDQ0 2.08e-32 124 35 1 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8VNL9 2.18e-32 122 32 6 231 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q1R5H8 2.32e-32 123 37 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 2.32e-32 123 37 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q8FCQ2 2.5e-32 123 37 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TC10 2.6e-32 123 37 2 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RC47 2.76e-32 123 34 3 203 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q3M5J9 2.82e-32 120 38 2 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q07UI9 3.39e-32 123 36 3 210 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q0BIZ6 3.54e-32 123 35 1 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9L0Q1 3.7e-32 123 37 2 191 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0SRL2 3.91e-32 122 34 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q66FU4 4.02e-32 123 36 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
P45769 4.29e-32 120 36 5 216 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q97KS6 4.49e-32 122 33 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P21410 5.04e-32 122 36 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q1BRZ8 5.04e-32 122 34 1 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 5.04e-32 122 34 1 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q8U648 5.5e-32 120 38 3 194 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1CNC6 6.04e-32 122 36 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 6.04e-32 122 36 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 6.04e-32 122 36 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9V2C0 6.84e-32 122 33 3 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
P10091 8.03e-32 122 34 1 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q5FA19 8.15e-32 122 37 1 196 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P9WQI3 8.3e-32 122 37 2 197 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 8.3e-32 122 37 2 197 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2YVT7 8.78e-32 121 31 2 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8UCD5 9.14e-32 122 34 5 215 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q48J29 9.2e-32 122 34 3 215 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SU77 9.46e-32 122 36 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7AH43 9.96e-32 121 34 0 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q63Q62 9.97e-32 122 36 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
O57896 1.03e-31 121 33 3 224 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q52666 1.04e-31 119 35 4 215 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P45022 1.11e-31 119 37 4 202 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3JMW7 1.18e-31 121 36 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q89WG0 1.24e-31 121 34 1 210 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2SSS4 1.25e-31 121 33 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2K1C8 1.27e-31 121 32 1 211 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q98DT6 1.29e-31 119 39 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q13TV1 1.31e-31 121 36 0 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q0SK28 1.32e-31 119 37 4 208 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q2L0H5 1.39e-31 121 38 4 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q5XCA4 1.4e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A1SWH9 1.49e-31 121 31 3 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q03P57 1.53e-31 121 34 1 205 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7CN92 1.66e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 1.66e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
P0CZ35 1.69e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.69e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 1.69e-31 122 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8DZJ0 1.69e-31 122 34 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.69e-31 122 34 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.69e-31 122 34 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P55604 1.71e-31 121 35 5 202 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q38VW6 1.71e-31 121 33 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q56927 1.82e-31 121 35 7 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q81P94 1.94e-31 118 33 3 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
Q98KI3 1.94e-31 121 33 4 213 3 modC Molybdenum import ATP-binding protein ModC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q881C1 2.1e-31 121 33 3 217 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6MU19 2.18e-31 120 33 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q4ZSS5 2.25e-31 121 34 3 215 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. syringae (strain B728a)
Q62GB4 2.32e-31 120 36 3 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q6HHI7 2.47e-31 118 33 3 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q325N3 2.69e-31 118 34 5 209 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q1J6Q6 2.9e-31 121 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 2.9e-31 121 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 2.9e-31 121 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 2.9e-31 121 33 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8DUF7 3.12e-31 121 36 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P44531 3.29e-31 120 35 0 191 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08381 3.3e-31 120 35 3 209 3 modC Molybdenum import ATP-binding protein ModC Rhodobacter capsulatus
O86751 3.38e-31 120 38 0 188 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q98K23 4.07e-31 120 35 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P48243 4.12e-31 117 35 4 200 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q63A38 4.21e-31 117 31 4 228 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q5JEB0 4.43e-31 119 35 2 204 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1CDR0 4.93e-31 118 35 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 4.93e-31 118 35 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 4.93e-31 118 35 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q3Z542 4.98e-31 117 34 5 209 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 4.98e-31 117 34 5 209 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
A0RFA4 5.04e-31 117 33 3 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis (strain Al Hakam)
Q81C68 5.15e-31 117 35 3 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8X5I6 5.3e-31 117 34 5 209 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q7CS28 5.38e-31 120 31 1 218 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7VKP7 5.58e-31 119 34 6 221 3 modC Molybdenum import ATP-binding protein ModC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q47CB7 5.65e-31 120 35 4 218 3 modC Molybdenum import ATP-binding protein ModC Dechloromonas aromatica (strain RCB)
Q660M8 5.72e-31 119 33 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
D4GP39 5.9e-31 120 34 1 193 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
O51587 6.09e-31 119 33 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q0SML1 6.42e-31 119 33 2 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
O34677 6.45e-31 117 34 3 206 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q0I2Z4 7.61e-31 119 34 0 190 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q839D5 7.81e-31 117 32 6 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q65M64 7.85e-31 117 35 4 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8XIZ5 8.54e-31 119 33 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 8.54e-31 119 33 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XZQ4 8.69e-31 117 36 2 203 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2W1R8 9.74e-31 119 32 5 234 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q57213 9.82e-31 115 33 4 189 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88RL5 1.08e-30 119 34 3 229 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1RFH8 1.18e-30 116 34 5 209 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 1.18e-30 116 34 5 209 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q4K441 1.3e-30 117 35 3 203 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1M7A6 1.48e-30 116 38 4 193 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q4FMG5 1.55e-30 116 37 6 190 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q665B6 1.58e-30 117 34 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q885N4 1.59e-30 116 37 5 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P18813 1.63e-30 117 34 1 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q9YGA6 1.74e-30 119 36 4 209 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q1CJS9 1.89e-30 118 34 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 1.89e-30 118 34 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 1.89e-30 118 34 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 1.91e-30 118 34 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4ZZR8 2.08e-30 118 35 3 227 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q736E0 2.09e-30 115 33 3 200 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 10987 / NRS 248)
Q87UN4 2.1e-30 118 35 3 227 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0S6U9 2.13e-30 115 37 6 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhodococcus jostii (strain RHA1)
Q832Y6 2.21e-30 118 31 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q881U6 2.23e-30 115 34 5 225 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15695
Feature type CDS
Gene thiQ
Product thiamine ABC transporter ATP-binding protein ThiQ
Location 139939 - 140637 (strand: -1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1094
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3840 Coenzyme transport and metabolism (H) H ABC-type thiamine transport system, ATPase component ThiQ

Protein Sequence

MIQLNRVHYPYQQQTMEFDFTVDAGERVAILGPSGAGKSTLLSLVAGFQFAQSGTIRLNGGDHTRTPPAMRPVSMLFQENNLFAHLTAAQNIALGFHPGMKLNTKQKTELAHIAEQVSLTPLLSRLPSQLSGGQRQRVALVRCLVRSQPILLLDEPFSALDPALRNEMLALLETICETRQLTLLMVSHNPDDAARIASRAMVIDDGHIAYDGSTAALVSGEVPAAAILGIRK

Flanking regions ( +/- flanking 50bp)

CTGTGTTTCGGGCTATTCAGCCTGCTGGAACGCTTACCGGGAAAACGTTCATGATCCAGTTAAACAGGGTGCATTACCCGTATCAGCAACAAACGATGGAATTTGATTTTACTGTTGATGCCGGTGAAAGAGTGGCGATTCTCGGCCCCAGCGGCGCGGGTAAAAGTACGCTGTTATCACTGGTTGCCGGTTTTCAGTTTGCCCAAAGCGGGACTATCCGCCTCAACGGCGGCGATCACACCCGTACCCCGCCCGCAATGCGTCCGGTTTCCATGCTGTTTCAGGAAAATAATCTGTTTGCACACCTGACTGCCGCGCAGAATATCGCCCTGGGTTTTCATCCCGGTATGAAACTGAATACAAAACAGAAAACAGAGCTGGCACACATTGCAGAGCAGGTTTCCCTCACTCCGCTGCTCAGCCGCCTGCCCTCTCAATTGTCCGGCGGACAGCGCCAGCGCGTGGCACTCGTACGGTGTCTGGTGCGCTCACAACCCATACTCTTGTTGGATGAACCTTTTTCCGCACTAGACCCGGCACTGCGCAATGAAATGCTCGCACTGCTGGAGACTATTTGTGAAACCCGTCAGCTTACCCTGCTGATGGTGTCACACAATCCGGATGACGCAGCCCGCATCGCATCGCGCGCAATGGTTATCGATGACGGACACATTGCCTACGACGGCTCCACCGCTGCGCTGGTCAGCGGAGAGGTTCCGGCAGCGGCGATCCTCGGTATCAGAAAGTAGTCAGTTGCACACATAAATACTGTATATAATCACACCTCTCTGCTATAGTT