Homologs in group_1134

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06470 FBDBKF_06470 93.6 Morganella morganii S1 nhaA Na+/H+ antiporter NhaA
EHELCC_09515 EHELCC_09515 93.6 Morganella morganii S2 nhaA Na+/H+ antiporter NhaA
NLDBIP_09895 NLDBIP_09895 93.6 Morganella morganii S4 nhaA Na+/H+ antiporter NhaA
LHKJJB_07860 LHKJJB_07860 93.6 Morganella morganii S3 nhaA Na+/H+ antiporter NhaA
HKOGLL_07410 HKOGLL_07410 93.6 Morganella morganii S5 nhaA Na+/H+ antiporter NhaA
PMI_RS00055 PMI_RS00055 74.9 Proteus mirabilis HI4320 nhaA Na+/H+ antiporter NhaA

Distribution of the homologs in the orthogroup group_1134

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1134

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2T1 0.0 574 74 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Proteus mirabilis (strain HI4320)
Q7N8X6 0.0 557 74 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJD7 0.0 540 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FME1 0.0 523 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JL02 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ES8 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3M2 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TQF7 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis (strain Pestoides F)
Q1CMV5 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG77 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis
Q1C0J7 0.0 522 72 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Antiqua)
A9R013 0.0 521 72 1 386 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Angola)
A8G9L0 0.0 518 72 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Serratia proteamaculans (strain 568)
A0KG33 3.88e-171 486 62 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SIW8 4.03e-170 483 62 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas salmonicida (strain A449)
Q7MLJ3 5.51e-158 452 60 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio vulnificus (strain YJ016)
Q8D8Y2 5.51e-158 452 60 1 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Vibrio vulnificus (strain CMCP6)
Q56725 3.03e-157 450 61 1 388 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LMV3 1.18e-156 449 60 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain M66-2)
O85187 1.18e-156 449 60 1 388 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F7R1 1.18e-156 449 60 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MYD3 1.75e-156 449 59 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio campbellii (strain ATCC BAA-1116)
A6T4F6 2.14e-156 449 61 2 380 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q56580 5.35e-156 447 60 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio alginolyticus
B2VH05 2.21e-154 443 60 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6LUL9 3.06e-154 443 63 3 390 3 nhaA Na(+)/H(+) antiporter NhaA Photobacterium profundum (strain SS9)
B6EHQ0 4.56e-153 440 59 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio salmonicida (strain LFI1238)
Q07YY4 9.59e-152 437 56 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella frigidimarina (strain NCIMB 400)
A8ALU0 1.07e-151 436 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C5B7L9 4.92e-151 435 59 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Edwardsiella ictaluri (strain 93-146)
Q8EH93 6.29e-151 434 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1S3W9 6.31e-151 435 57 1 391 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0BTX5 9.19e-151 434 57 2 380 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B5FCI6 1.38e-150 433 58 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain MJ11)
Q5E6G4 1.38e-150 433 58 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain ATCC 700601 / ES114)
B3H317 1.93e-150 434 57 2 380 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N3N9 2.68e-149 431 58 3 381 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q1RGI2 3.45e-149 430 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain UTI89 / UPEC)
Q8FLC1 3.45e-149 430 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLW9 3.45e-149 430 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A771 3.45e-149 430 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O1:K1 / APEC
A1RMD9 4.25e-149 430 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain W3-18-1)
A4Y4J2 6.53e-149 429 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L5M4 1.64e-148 428 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS195)
A3D1U4 1.7e-148 428 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS155 / ATCC BAA-1091)
A0KZP4 2.63e-148 428 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain ANA-3)
A6WKP5 2.93e-148 428 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS185)
B8EBR4 2.93e-148 428 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS223)
A9MR50 2.51e-147 425 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z9N5 8.72e-147 424 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhi
Q5PDL4 8.72e-147 424 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7MIL1 1.8e-146 423 59 2 384 3 nhaA Na(+)/H(+) antiporter NhaA Cronobacter sakazakii (strain ATCC BAA-894)
Q8ZRZ3 4.39e-146 422 60 2 382 1 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYF8 4.39e-146 422 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57TM1 4.39e-146 422 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella choleraesuis (strain SC-B67)
A3QBR5 7.69e-146 422 57 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HG86 5.01e-145 419 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-4)
Q0HSH9 8.64e-145 419 57 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-7)
Q65RK2 9.39e-145 419 56 3 383 3 nhaA Na(+)/H(+) antiporter NhaA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8H1B5 1.15e-143 416 57 1 391 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A4W6D7 1.49e-143 416 60 2 380 3 nhaA Na(+)/H(+) antiporter NhaA Enterobacter sp. (strain 638)
Q9CKD8 5.26e-143 414 59 2 375 3 nhaA Na(+)/H(+) antiporter NhaA Pasteurella multocida (strain Pm70)
Q6D0B9 7.37e-143 414 60 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DF08 1.41e-142 414 59 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P44581 2.75e-142 413 55 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QNW1 3.58e-142 413 54 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain 86-028NP)
A5UG30 3.62e-142 413 54 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittGG)
Q3Z5Z4 7.15e-142 412 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella sonnei (strain Ss046)
Q326K4 7.15e-142 412 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella boydii serotype 4 (strain Sb227)
A7ZVW6 7.15e-142 412 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O9:H4 (strain HS)
Q8XA63 7.15e-142 412 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O157:H7
A7ZHA6 7.15e-142 412 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O139:H28 (strain E24377A / ETEC)
A5UAR0 1.14e-141 411 54 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittEE)
Q83SR3 8.06e-141 409 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri
Q32KA0 1.07e-140 409 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella dysenteriae serotype 1 (strain Sd197)
B8F7T0 1.21e-140 409 56 3 381 3 nhaA Na(+)/H(+) antiporter NhaA Glaesserella parasuis serovar 5 (strain SH0165)
P13738 1.53e-140 408 60 2 374 1 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain K12)
Q0T8H4 2.73e-140 407 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri serotype 5b (strain 8401)
Q3A4S1 4.09e-140 407 56 2 388 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8FSC4 5.11e-140 407 56 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sediminis (strain HAW-EB3)
Q0I3A2 8.47e-139 404 56 3 393 3 nhaA Na(+)/H(+) antiporter NhaA Histophilus somni (strain 129Pt)
A6Q6G8 1.24e-136 398 53 2 381 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurovum sp. (strain NBC37-1)
Q7VN39 3.52e-133 390 56 2 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0KUA6 3.63e-133 389 55 0 377 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas putida (strain GB-1)
C4LD18 7.3e-132 386 53 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A6VQU5 1.19e-129 380 55 2 380 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0L9Y5 1.36e-129 380 51 3 396 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A5VZL9 2.01e-128 378 54 1 389 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88NS2 7.17e-128 376 53 1 389 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4KH68 7.99e-128 376 52 0 377 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q15N42 2.47e-126 372 51 2 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A6Q0Z0 2.96e-126 372 53 3 383 3 nhaA Na(+)/H(+) antiporter NhaA Nitratiruptor sp. (strain SB155-2)
Q21FL0 5.54e-126 371 50 1 373 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3KGX9 3.51e-125 369 52 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain Pf0-1)
Q21VA4 4.61e-125 369 53 2 379 3 nhaA Na(+)/H(+) antiporter NhaA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q12KG9 3.29e-123 364 55 0 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q2NVY9 6.21e-122 361 54 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Sodalis glossinidius (strain morsitans)
A7ZBN0 9e-122 361 46 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter concisus (strain 13826)
Q7W1Y0 2.79e-121 359 50 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQV8 2.79e-121 359 50 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6AQH5 9.11e-118 350 50 1 386 3 nhaA Na(+)/H(+) antiporter NhaA Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7GYJ7 2.73e-117 349 46 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter curvus (strain 525.92)
Q1Q8V3 1.59e-116 347 50 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5WCD3 2.95e-116 347 51 1 360 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter sp. (strain PRwf-1)
Q0P7X3 4.01e-116 346 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q4FQM2 6.6e-116 346 49 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1W1Q7 1.26e-115 345 47 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNW7 1.26e-115 345 47 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HSD8 1.63e-115 344 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni (strain RM1221)
A0RRP1 5.05e-115 343 48 2 371 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter fetus subsp. fetus (strain 82-40)
Q2GBB8 6.74e-115 344 49 4 384 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A7HZF9 1.54e-114 342 44 4 395 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A7H600 8.81e-114 340 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A0L5H1 1.96e-113 339 49 3 397 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q21EC5 1.17e-112 337 47 3 390 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2RY62 5.45e-112 336 49 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A6TJ58 1.47e-111 334 50 4 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q0P7X4 1.91e-110 332 43 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HSD9 1.12e-109 330 43 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni (strain RM1221)
Q48E39 3.43e-109 328 49 4 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A8FNW6 1.26e-108 327 43 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W1Q6 1.31e-108 327 43 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H5Z9 1.95e-108 327 43 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q2W4H6 6.53e-108 325 48 4 380 3 nhaA Na(+)/H(+) antiporter NhaA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2NDA1 1.21e-107 325 46 4 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Erythrobacter litoralis (strain HTCC2594)
Q4ZNN2 2.29e-107 324 48 4 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. syringae (strain B728a)
Q87WL3 3.1e-107 323 49 4 381 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5FBK7 4.29e-107 323 45 2 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q1QF31 9.85e-106 320 47 5 394 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q4ZZI6 4.57e-105 318 48 3 386 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. syringae (strain B728a)
Q98C38 6.02e-105 318 48 4 383 3 nhaA Na(+)/H(+) antiporter NhaA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4FLX6 9.26e-105 317 45 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Pelagibacter ubique (strain HTCC1062)
Q2NCP2 1.98e-104 317 50 3 377 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Erythrobacter litoralis (strain HTCC2594)
A6WW92 4.41e-104 315 47 5 394 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q48PL9 4.61e-104 315 47 3 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0RMW2 1.01e-103 314 45 3 383 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter fetus subsp. fetus (strain 82-40)
Q87UW8 1.07e-103 314 48 3 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9AAZ2 2.84e-103 314 47 4 373 3 nhaA Na(+)/H(+) antiporter NhaA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q30XM9 2.93e-103 315 42 4 434 3 nhaA Na(+)/H(+) antiporter NhaA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1GVK1 6.93e-103 313 50 7 390 3 nhaA Na(+)/H(+) antiporter NhaA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A6LXJ5 8.23e-101 307 44 7 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LTE4 1.79e-99 304 45 3 348 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q1CR54 2.21e-99 305 41 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain HPAG1)
A8EVL5 5.05e-99 303 42 5 397 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Aliarcobacter butzleri (strain RM4018)
B5Z9I3 5.99e-99 304 42 5 423 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain G27)
Q0AM65 9.07e-99 302 43 4 379 3 nhaA Na(+)/H(+) antiporter NhaA Maricaulis maris (strain MCS10)
Q9ZJ68 1.45e-98 303 40 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain J99 / ATCC 700824)
A5IF79 2.54e-97 298 45 3 384 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Corby)
B7J5J3 1.43e-96 298 41 5 434 3 nhaA Na(+)/H(+) antiporter NhaA Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
O26076 1.08e-95 295 41 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain ATCC 700392 / 26695)
B6JP50 3.64e-95 294 40 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain P12)
Q8G2C7 5.21e-95 292 46 6 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis biovar 1 (strain 1330)
A5VNX4 5.21e-95 292 46 6 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M8H1 5.21e-95 292 46 6 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q17YZ5 2.43e-94 292 40 3 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter acinonychis (strain Sheeba)
B0CK83 2.73e-94 290 46 6 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis (strain ATCC 23445 / NCTC 10510)
Q11TX2 3.07e-94 290 44 4 387 3 nhaA Na(+)/H(+) antiporter NhaA Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q1IJ81 7.03e-94 291 42 4 409 3 nhaA Na(+)/H(+) antiporter NhaA Koribacter versatilis (strain Ellin345)
Q5X2E5 1.71e-93 288 46 3 377 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Paris)
Q1I836 2.19e-93 288 46 3 390 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas entomophila (strain L48)
A8I126 3.61e-93 288 44 4 387 3 nhaA Na(+)/H(+) antiporter NhaA Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2KCN1 4.03e-93 287 47 5 375 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0BSV4 7.13e-93 286 45 6 376 3 nhaA Na(+)/H(+) antiporter NhaA Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q8YFI5 8.8e-93 296 46 5 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q7VFN0 1.22e-92 288 40 8 422 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q5WU67 1.88e-92 285 45 3 384 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Lens)
Q2YMB3 2.31e-92 295 46 5 394 3 nhaA Na(+)/H(+) antiporter NhaA Brucella abortus (strain 2308)
Q7M922 4.47e-92 286 41 6 426 3 nhaA Na(+)/H(+) antiporter NhaA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A0Q8N8 9.06e-92 283 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. novicida (strain U112)
Q2G4Z2 2.39e-91 283 44 4 384 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A7HH11 3.3e-91 285 40 4 426 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter sp. (strain Fw109-5)
Q21JV7 4.03e-91 285 41 5 429 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0BP56 5.45e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5W5 5.45e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain LVS)
A7N9B9 5.45e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q5NE91 6.99e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FP4 6.99e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain FSC 198)
B2SEL7 7.3e-91 281 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. mediasiatica (strain FSC147)
A8EUK5 1.31e-90 282 40 4 420 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Aliarcobacter butzleri (strain RM4018)
Q30PM3 2.46e-90 282 40 5 422 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A9GMF2 4.46e-90 282 43 5 419 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Sorangium cellulosum (strain So ce56)
A4IVT5 7.63e-90 279 44 5 379 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain WY96-3418)
Q3SNN8 8.7e-90 281 41 6 417 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A6H0G8 1.5e-89 278 41 4 392 3 nhaA Na(+)/H(+) antiporter NhaA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q1D5J5 3.98e-89 279 41 5 421 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Myxococcus xanthus (strain DK1622)
Q47I87 6.54e-89 276 44 6 383 3 nhaA Na(+)/H(+) antiporter NhaA Dechloromonas aromatica (strain RCB)
Q5FNE6 1.07e-88 276 39 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Gluconobacter oxydans (strain 621H)
A9EYV6 1.74e-88 278 41 6 416 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Sorangium cellulosum (strain So ce56)
Q0K437 2.83e-88 277 40 7 418 3 nhaA Na(+)/H(+) antiporter NhaA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9IQG4 4.24e-88 276 38 5 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6G5K1 5.79e-88 276 37 5 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q7UTY3 3.16e-87 274 39 7 427 3 nhaA Na(+)/H(+) antiporter NhaA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A5V7M2 3.4e-87 271 47 5 382 3 nhaA Na(+)/H(+) antiporter NhaA Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q8D2Q7 1.95e-86 270 40 4 356 3 nhaA Na(+)/H(+) antiporter NhaA Wigglesworthia glossinidia brevipalpis
Q5LC87 5.97e-86 270 38 3 432 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64T76 2.25e-85 269 38 3 432 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain YCH46)
Q88FW9 3.85e-85 269 39 7 419 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A6X1P0 5e-85 266 46 5 391 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q1IY26 5.63e-85 267 44 5 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q6G0H9 7.03e-85 268 38 6 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella quintana (strain Toulouse)
A6L743 2.24e-84 266 38 4 426 3 nhaA Na(+)/H(+) antiporter NhaA Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A1SDK4 2.48e-83 264 40 6 394 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0LLE6 3.08e-83 265 38 4 423 3 nhaA Na(+)/H(+) antiporter NhaA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A1URT7 4.88e-83 263 38 6 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B2RLS8 5.73e-83 263 38 6 442 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A5W1K7 6.85e-83 263 39 8 420 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q7MTR7 1.17e-82 262 37 6 442 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A5FLP0 3.41e-82 259 42 5 383 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8AA31 9.3e-82 259 37 3 435 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A9IMX7 2.3e-81 259 38 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A5EUT7 2.97e-81 259 38 5 420 3 nhaA Na(+)/H(+) antiporter NhaA Dichelobacter nodosus (strain VCS1703A)
Q5NRB1 3.82e-81 256 41 4 392 3 nhaA Na(+)/H(+) antiporter NhaA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1J2Y8 3.82e-81 258 41 4 391 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A5FT18 6.22e-81 258 36 6 421 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Acidiphilium cryptum (strain JF-5)
A8F302 8.16e-81 256 34 4 390 3 nhaA Na(+)/H(+) antiporter NhaA Rickettsia massiliae (strain Mtu5)
A6SWX0 1.11e-80 257 39 6 420 3 nhaA Na(+)/H(+) antiporter NhaA Janthinobacterium sp. (strain Marseille)
A5FTA4 2.71e-79 254 36 6 421 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Acidiphilium cryptum (strain JF-5)
A7I1I1 3e-79 252 40 2 379 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A5FT52 3.63e-79 253 36 6 421 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Acidiphilium cryptum (strain JF-5)
Q47MI6 1e-78 251 40 7 388 3 nhaA Na(+)/H(+) antiporter NhaA Thermobifida fusca (strain YX)
A6LAI2 1.6e-78 252 36 5 442 3 nhaA Na(+)/H(+) antiporter NhaA Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q0RG46 2.28e-78 252 37 5 410 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A9H2L4 1.03e-77 248 38 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A1SRH4 9.03e-77 248 37 8 428 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A4X422 1.19e-76 247 40 7 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q0S8L7 2.7e-76 245 39 5 384 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Rhodococcus jostii (strain RHA1)
A8M393 6.24e-76 245 39 8 394 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora arenicola (strain CNS-205)
A1SRG6 1.84e-75 243 40 8 424 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q2Y8T1 2.57e-75 248 37 6 428 3 nhaA Na(+)/H(+) antiporter NhaA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3A1R2 1.27e-74 241 38 5 436 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8D666 2.43e-74 241 34 6 427 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Vibrio vulnificus (strain CMCP6)
A3PYK5 1.12e-73 239 39 4 389 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain JLS)
A1UF43 1.71e-73 239 39 4 389 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain KMS)
Q1B9W9 1.74e-73 238 39 4 389 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain MCS)
Q15N95 1.91e-73 239 35 8 425 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q12P61 5.91e-73 237 36 6 428 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1WCI8 3.24e-72 234 43 4 356 3 nhaA Na(+)/H(+) antiporter NhaA Acidovorax sp. (strain JS42)
A6W9V1 3.42e-72 236 39 5 376 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q93F90 3e-71 234 40 5 383 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces antibioticus
A8M1G0 4.19e-71 232 42 7 344 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora arenicola (strain CNS-205)
Q1CZI3 4.24e-71 233 40 2 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Myxococcus xanthus (strain DK1622)
A4X6R9 1.01e-69 228 42 6 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q5Z2Z5 3.91e-69 226 39 5 384 3 nhaA Na(+)/H(+) antiporter NhaA Nocardia farcinica (strain IFM 10152)
A1T7Y9 3.92e-69 228 39 5 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A4FCM4 1.84e-68 224 38 4 374 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q6AB77 4.56e-68 224 37 9 392 3 nhaA Na(+)/H(+) antiporter NhaA Cutibacterium acnes (strain DSM 16379 / KPA171202)
A4F6L1 5.72e-68 223 41 3 349 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A1SHU2 9.42e-68 228 35 6 411 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Nocardioides sp. (strain ATCC BAA-499 / JS614)
A9WU27 1.15e-67 223 39 7 381 3 nhaA Na(+)/H(+) antiporter NhaA Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A4TCS6 2.55e-67 223 39 5 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium gilvum (strain PYR-GCK)
Q92Y37 2.74e-66 219 38 6 414 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium meliloti (strain 1021)
Q2J9U7 1.8e-65 218 41 6 375 3 nhaA Na(+)/H(+) antiporter NhaA Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A0M0N2 3.69e-65 217 42 6 400 3 nhaA Na(+)/H(+) antiporter NhaA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0QW18 4.03e-64 214 39 5 373 3 nhaA Na(+)/H(+) antiporter NhaA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A4G6P0 7.11e-63 215 34 6 411 3 nhaA Na(+)/H(+) antiporter NhaA Herminiimonas arsenicoxydans
Q4UJQ7 1.53e-62 205 35 3 289 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A0JR38 1.94e-62 210 39 6 377 3 nhaA Na(+)/H(+) antiporter NhaA Arthrobacter sp. (strain FB24)
A5CM04 1.53e-61 207 38 8 395 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q2IE76 1.46e-60 209 37 8 425 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9X929 4e-60 204 40 5 376 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82EL6 9.08e-60 203 39 5 388 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A1R4H0 1.45e-59 202 38 7 391 3 nhaA Na(+)/H(+) antiporter NhaA Paenarthrobacter aurescens (strain TC1)
Q0SG15 1.75e-59 206 36 9 421 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Rhodococcus jostii (strain RHA1)
Q8G5R2 4.96e-59 201 33 9 408 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium longum (strain NCC 2705)
A6W4F5 8.24e-58 197 38 6 381 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q2VPW7 1.25e-57 197 33 9 403 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium breve (strain NCIMB 8807 / UCC2003)
A1A0Y8 1.72e-56 194 34 7 358 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A8LVS8 2.13e-55 196 34 9 419 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora arenicola (strain CNS-205)
A8GU51 4.02e-55 185 37 2 262 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Sheila Smith)
B0BVP1 4.02e-55 185 37 2 262 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Iowa)
Q7VFN1 1.36e-54 191 40 1 238 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7VFN1 6.63e-23 103 40 2 137 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A3PTR0 4.64e-54 191 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain JLS)
Q1BES7 1.05e-53 191 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain MCS)
A1UA55 1.05e-53 191 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain KMS)
Q9S1X8 2.25e-53 185 39 6 354 3 nhaA1 Na(+)/H(+) antiporter NhaA 1/4 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1T2V5 3.57e-52 186 34 6 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q0RHS2 2.73e-51 181 39 6 350 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A4T134 5.91e-51 183 34 4 388 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium gilvum (strain PYR-GCK)
Q9S2C8 9.2e-51 183 33 8 400 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4X5I0 1.35e-49 180 34 9 411 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A5CTB2 4.75e-46 166 38 7 339 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q0RPD5 9.1e-45 163 38 7 356 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q83N58 3.04e-37 142 30 12 394 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain TW08/27)
Q83MP1 3.37e-37 141 30 12 394 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain Twist)
Q28L40 1.53e-30 124 33 16 409 3 nhaA Na(+)/H(+) antiporter NhaA Jannaschia sp. (strain CCS1)
A8GYC5 4.2e-30 117 35 2 171 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain OSU 85-389)
Q74AP9 2.6e-29 120 31 12 363 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q24V86 4.49e-29 119 31 15 392 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain Y51)
B8FPI3 4.49e-29 119 31 15 392 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q39WP5 3.62e-28 117 33 10 305 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1ATB4 4.41e-26 111 30 15 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5G6V8 1.39e-23 104 32 12 353 3 nhaA Na(+)/H(+) antiporter NhaA Geotalea uraniireducens (strain Rf4)
Q1RGL5 5.84e-23 96 40 0 106 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain RML369-C)
A1AK41 1.74e-21 98 31 13 385 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q92FX2 2.08e-19 87 35 2 136 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GQA2 7.77e-12 63 41 0 60 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia akari (strain Hartford)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15455
Feature type CDS
Gene nhaA
Product Na+/H+ antiporter NhaA
Location 79393 - 80571 (strand: 1)
Length 1179 (nucleotides) / 392 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1134
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06965 Na+/H+ antiporter 1

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3004 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)		 CP Na+/H+ antiporter NhaA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03313 Na+:H+ antiporter, NhaA family - -

Protein Sequence

MKAIIRQFLRLEAAGGILLIIAALVALIMANTSLSVVYQQFLDIPVAVKFSALEIDKPLLLWINDALMAIFFLVVGLEVKRELMVGSLAGRDKAMFPAIAALGGMVAPALVYLLFNGSDPAASQGWAIPAATDIAFALGVMALLGKRVPTELKVFLLALAIIDDLGVIVIIALFYTKTVSLTALLLAALMVVVLCLMNWRNVNNTAAYMVAGLILWVCILKSGVHATLAGVIVGFLIPLRSKDGVHSPSEELEHVMHPWVAYLILPLFAFANAGVNVQGISMDALMGTLPLGILLGLFIGKPLGIFTACLISVKLGFAKLPERITLNHIFAVSVLCGIGFTMSIFIAGLAFDGLPEAFNTYSKLGILIGSTMAAVTGLFLLHSVLPKKTVRQ

Flanking regions ( +/- flanking 50bp)

AGTATTGATGTCGATAGTATTATTGTCGACAGTGTAAACGGAGTTAAATTATGAAAGCAATTATCCGACAGTTTTTAAGACTTGAAGCCGCAGGTGGCATACTGCTGATTATTGCAGCTCTGGTTGCATTAATAATGGCAAATACATCGCTGTCGGTAGTGTATCAGCAGTTTCTTGATATTCCGGTTGCCGTGAAATTTTCTGCACTGGAAATTGATAAGCCCTTGTTATTATGGATTAATGATGCCCTGATGGCGATATTTTTCCTTGTCGTCGGGCTGGAAGTTAAGCGGGAGCTGATGGTCGGCTCTCTGGCCGGTCGTGATAAAGCGATGTTTCCGGCGATTGCCGCACTTGGTGGTATGGTTGCCCCTGCGCTGGTGTATCTTTTGTTCAACGGGAGTGATCCCGCAGCCAGTCAGGGTTGGGCAATACCTGCGGCAACCGATATCGCTTTTGCACTCGGCGTTATGGCGCTGCTGGGCAAGCGGGTGCCGACAGAACTGAAAGTCTTTCTGCTGGCGCTGGCAATTATTGATGACCTCGGCGTCATTGTGATTATTGCCTTATTTTATACAAAAACAGTATCGCTTACGGCGTTACTGCTGGCGGCATTAATGGTTGTGGTGCTGTGCCTGATGAACTGGCGCAATGTTAACAATACAGCGGCTTACATGGTTGCGGGGCTGATATTATGGGTCTGCATTCTGAAGTCCGGTGTCCACGCCACACTGGCGGGGGTGATTGTCGGGTTCCTTATCCCGCTGCGCAGTAAAGATGGAGTACACTCTCCGTCTGAAGAGCTGGAGCATGTTATGCATCCGTGGGTGGCGTATCTTATCCTGCCACTGTTTGCGTTTGCGAATGCAGGCGTCAATGTACAGGGTATTTCAATGGATGCGTTGATGGGGACATTGCCGCTGGGAATACTGCTCGGGTTATTTATCGGTAAACCGCTGGGGATTTTCACGGCGTGTCTGATTTCGGTAAAACTGGGCTTTGCAAAATTGCCGGAGAGGATTACTCTTAACCATATATTTGCGGTATCAGTGTTGTGCGGGATCGGTTTTACTATGTCAATCTTTATCGCGGGGCTGGCATTTGACGGACTACCGGAAGCGTTTAACACCTACTCTAAGCTGGGAATTCTGATTGGTTCCACAATGGCGGCGGTCACCGGGTTATTTTTACTTCATTCTGTGTTACCGAAGAAAACCGTCCGGCAGTAATGAATTATTCACCGGCCTCCCGGCCGGTGAATACAACAGAATTTCCGAGT