Homologs in group_1145

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06555 FBDBKF_06555 91.6 Morganella morganii S1 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
EHELCC_09600 EHELCC_09600 91.6 Morganella morganii S2 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
NLDBIP_09980 NLDBIP_09980 91.6 Morganella morganii S4 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
LHKJJB_07775 LHKJJB_07775 91.6 Morganella morganii S3 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
HKOGLL_07325 HKOGLL_07325 91.6 Morganella morganii S5 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
PMI_RS18490 PMI_RS18490 71.6 Proteus mirabilis HI4320 gpmB 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB

Distribution of the homologs in the orthogroup group_1145

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1145

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A4W6B3 3.87e-111 320 70 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Enterobacter sp. (strain 638)
B4EY52 4.18e-111 320 71 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Proteus mirabilis (strain HI4320)
A1JJB8 6.88e-108 311 69 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MIJ0 1.36e-107 311 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Cronobacter sakazakii (strain ATCC BAA-894)
B7LNT7 2.24e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1JL20 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EU3 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQH5 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pestis (strain Pestoides F)
Q1CMX2 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R032 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIP0 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pestis
B2K3K5 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0L5 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMF8 3.08e-107 310 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6TI09 3.22e-107 310 69 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y264 4.19e-107 309 69 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Klebsiella pneumoniae (strain 342)
A8G9J4 6.07e-106 306 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Serratia proteamaculans (strain 568)
A9MR94 1.66e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3YTZ9 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella sonnei (strain Ss046)
P0A7A4 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella flexneri
Q0SX17 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella flexneri serotype 5b (strain 8401)
B1LEK2 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain SMS-3-5 / SECEC)
B6I6P3 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain SE11)
B7NH70 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A7A2 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain K12)
B1IS24 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A8C4 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O9:H4 (strain HS)
B1XFK5 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain K12 / DH10B)
C4ZT77 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXV9 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O8 (strain IAI1)
B5Z4S7 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A7A3 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O157:H7
B7LEP1 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain 55989 / EAEC)
A7ZVT7 2.66e-105 305 68 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8ZJU8 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TU55 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella schwarzengrund (strain CVM19633)
A9N7F5 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PK44 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4I9 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella newport (strain SL254)
B4TH18 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella heidelberg (strain SL476)
B5R9W3 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3B7 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella enteritidis PT4 (strain P125109)
B5FTD9 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella dublin (strain CT_02021853)
B5F543 2.75e-105 305 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella agona (strain SL483)
Q8Z0T4 4.97e-105 304 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella typhi
Q57G26 1.18e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella choleraesuis (strain SC-B67)
Q1R246 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli (strain UTI89 / UPEC)
Q8FA40 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T8R6 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AJW4 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O1:K1 / APEC
B7MTE3 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O81 (strain ED1a)
B7NW76 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MNK4 1.69e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Escherichia coli O45:K1 (strain S88 / ExPEC)
Q31SU3 1.91e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella boydii serotype 4 (strain Sb227)
B2TZS8 1.91e-104 303 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q7N900 2.16e-104 303 66 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C0Q8F5 2.57e-104 302 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella paratyphi C (strain RKS4594)
B5BAL1 7.11e-104 301 67 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Salmonella paratyphi A (strain AKU_12601)
Q327K0 2.25e-103 300 66 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Shigella dysenteriae serotype 1 (strain Sd197)
A8ALW1 6.5e-103 299 66 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VH13 1.07e-101 296 64 0 215 3 gpmB Probable phosphoglycerate mutase GpmB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9SCS3 9.07e-27 105 33 5 208 2 At3g50520 Phosphoglycerate mutase-like protein 4 Arabidopsis thaliana
F4KI56 5.32e-25 100 33 5 209 1 IPSP Metal-independent phosphoserine phosphatase Arabidopsis thaliana
O07617 3.59e-20 87 31 3 189 3 phoE Uncharacterized phosphatase PhoE Bacillus subtilis (strain 168)
W5EP13 6.3e-17 82 32 4 191 1 None 2-carboxy-D-arabinitol-1-phosphatase Triticum aestivum
D3DFP8 3.1e-16 77 29 1 164 1 pspB Putative phosphoserine phosphatase 2 Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
Q9FNJ9 4.99e-16 79 32 4 187 1 At5g22620 Probable 2-carboxy-D-arabinitol-1-phosphatase Arabidopsis thaliana
D3DFG8 1.72e-14 72 28 2 187 1 pspA Phosphoserine phosphatase 1 Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
Q7NJF7 4.77e-14 71 31 7 203 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q12040 5.36e-14 71 26 8 215 1 YOR283W Broad-specificity phosphatase YOR283W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P52086 6.3e-14 70 26 0 185 1 cobC Adenosylcobalamin/alpha-ribazole phosphatase Escherichia coli (strain K12)
Q1JQA7 6.9e-14 72 30 6 202 2 TIGAR Fructose-2,6-bisphosphatase TIGAR Bos taurus
Q7ZVE3 7.15e-13 68 31 4 154 1 tigarb Fructose-2,6-bisphosphatase TIGAR B Danio rerio
Q9NQ88 7.52e-13 68 33 6 171 1 TIGAR Fructose-2,6-bisphosphatase TIGAR Homo sapiens
P36623 1.42e-12 67 32 7 179 1 gpm1 Phosphoglycerate mutase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39701 2.29e-12 66 25 0 184 1 cobC Adenosylcobalamin/alpha-ribazole phosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HIJ2 6.45e-12 65 27 5 208 1 Ta1347 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B0UBD4 6.59e-12 65 33 7 183 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylobacterium sp. (strain 4-46)
B1M6A7 1.58e-11 64 32 6 171 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A5E8K1 2.08e-11 63 32 7 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
P58652 2.51e-11 63 25 0 184 3 cobC Adenosylcobalamin/alpha-ribazole phosphatase Salmonella typhi
A6WYJ2 3.57e-11 63 33 6 175 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B1WAX6 4.19e-11 64 33 4 136 2 tigar Fructose-2,6-bisphosphatase TIGAR Xenopus tropicalis
A6UEW3 4.59e-11 63 33 7 174 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Sinorhizobium medicae (strain WSM419)
Q4V7R0 6.2e-11 63 39 3 100 2 tigar Fructose-2,6-bisphosphatase TIGAR Xenopus laevis
B1ZA86 7.93e-11 62 31 6 174 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
C3MBY8 9.85e-11 62 33 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A9W5P5 1.04e-10 62 31 6 174 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylorubrum extorquens (strain PA1)
B7KNX9 1.04e-10 62 31 6 174 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q8YDC9 1.48e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMJ1 1.48e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella melitensis biotype 2 (strain ATCC 23457)
P59160 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella suis biovar 1 (strain 1330)
A9WW62 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9MCX8 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q576R3 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella abortus biovar 1 (strain 9-941)
Q2YJN6 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella abortus (strain 2308)
B2SC37 1.6e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella abortus (strain S19)
A5VVV5 1.92e-10 61 34 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B9JYQ2 2.15e-10 61 32 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q92T25 2.33e-10 61 33 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium meliloti (strain 1021)
Q98DM0 2.86e-10 60 33 6 172 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8KL44 2.95e-10 60 31 3 158 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A4YJP8 4.42e-10 60 31 7 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bradyrhizobium sp. (strain ORS 278)
A7IC75 5.08e-10 60 29 6 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q8BZA9 5.4e-10 60 37 3 98 1 Tigar Fructose-2,6-bisphosphatase TIGAR Mus musculus
Q74L45 7.1e-10 60 32 8 192 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A9IXE7 7.33e-10 59 30 6 173 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q8L1Z7 7.71e-10 59 30 6 173 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B2IEV6 9.63e-10 59 30 6 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A1WDX2 1.09e-09 59 28 7 189 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Verminephrobacter eiseniae (strain EF01-2)
A7HZ35 1.23e-09 59 28 7 175 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B0KBW9 1.3e-09 59 28 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8R7C8 1.41e-09 59 27 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1GZZ1 1.82e-09 59 26 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Endomicrobium trichonymphae
B3PXK3 1.95e-09 58 32 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium etli (strain CIAT 652)
B6JCI9 2.1e-09 58 30 7 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A6LUA1 2.33e-09 58 27 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q73M14 2.4e-09 58 28 6 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A8IGZ9 2.5e-09 58 32 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B9J6R3 2.74e-09 58 31 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B0K4E2 2.85e-09 58 28 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Thermoanaerobacter sp. (strain X514)
B9J102 3.6e-09 58 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain Q1)
B7HS46 3.6e-09 58 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain AH187)
Q6HIL9 3.89e-09 58 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus thuringiensis subsp. konkukian (strain 97-27)
A1K9B9 4.31e-09 58 27 7 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Azoarcus sp. (strain BH72)
Q6MEW4 5.58e-09 57 26 5 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Protochlamydia amoebophila (strain UWE25)
B4RZM6 5.67e-09 57 25 5 197 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B3QVL0 5.88e-09 57 30 8 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q737X5 6.79e-09 57 25 6 197 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8A765 7.38e-09 57 24 6 228 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q01YD0 7.59e-09 57 29 9 199 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Solibacter usitatus (strain Ellin6076)
Q1MMY4 8.31e-09 57 32 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A2SDN6 8.47e-09 57 29 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q7MXP1 8.79e-09 57 25 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RHB7 8.79e-09 57 25 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q29RA5 1e-08 57 28 4 138 2 tigara Probable fructose-2,6-bisphosphatase TIGAR A Danio rerio
A1UTM4 1.02e-08 56 29 6 181 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B8D7J7 1.03e-08 57 27 7 221 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D995 1.03e-08 57 27 7 221 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q89WK1 1.03e-08 56 28 6 180 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
C0QV47 1.07e-08 57 28 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
P30798 1.08e-08 57 29 7 194 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B5ZWT2 1.1e-08 56 32 7 168 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B7JPK2 1.18e-08 57 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain AH820)
Q6KSL4 1.18e-08 57 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus anthracis
C3LIE5 1.18e-08 57 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PAW8 1.18e-08 57 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus anthracis (strain A0248)
A5EV29 1.2e-08 57 26 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Dichelobacter nodosus (strain VCS1703A)
Q81DD2 1.3e-08 56 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P57390 1.34e-08 56 27 7 221 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B5Y7Q7 1.37e-08 56 26 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q11SV1 1.46e-08 56 28 5 180 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B8EML2 1.57e-08 56 30 6 180 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B9L9H5 1.64e-08 56 25 5 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B1XS92 1.71e-08 56 30 7 193 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q5YP50 1.71e-08 56 30 7 184 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Nocardia farcinica (strain IFM 10152)
B3EFK8 1.9e-08 56 28 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q8PST3 1.99e-08 56 27 7 225 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q07UT3 2.05e-08 55 28 6 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhodopseudomonas palustris (strain BisA53)
Q6FZ12 2.17e-08 55 30 6 173 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bartonella quintana (strain Toulouse)
B7H7P4 2.25e-08 56 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain B4264)
A1BE55 2.44e-08 56 29 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q9Z743 2.55e-08 55 26 6 201 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia pneumoniae
B7J2L3 2.63e-08 55 27 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borreliella burgdorferi (strain ZS7)
O51602 2.63e-08 55 27 7 197 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B4S616 2.64e-08 55 29 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q63B92 2.7e-08 55 24 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain ZK / E33L)
Q0ALQ9 3.2e-08 55 28 8 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Maricaulis maris (strain MCS10)
Q21CH5 4.29e-08 55 30 7 178 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhodopseudomonas palustris (strain BisB18)
P07953 4.9e-08 55 29 6 164 1 Pfkfb1 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 1 Rattus norvegicus
Q0SMJ5 5.09e-08 55 27 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borreliella afzelii (strain PKo)
Q031Y3 5.28e-08 55 25 6 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Lactococcus lactis subsp. cremoris (strain SK11)
A2RI67 5.28e-08 55 25 6 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Lactococcus lactis subsp. cremoris (strain MG1363)
Q6MJP3 5.61e-08 55 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P16118 5.91e-08 55 29 6 164 1 PFKFB1 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 1 Homo sapiens
Q3SW71 6.49e-08 54 30 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P9WIC7 6.92e-08 54 31 5 161 1 gpgP Glucosyl-3-phosphoglycerate phosphatase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIC6 6.92e-08 54 31 5 161 3 gpgP Glucosyl-3-phosphoglycerate phosphatase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8K9N1 7.59e-08 54 26 7 218 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B7GUR7 7.82e-08 54 26 6 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
P59159 7.82e-08 54 26 6 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bifidobacterium longum (strain NCC 2705)
B3DQI6 7.82e-08 54 26 6 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bifidobacterium longum (strain DJO10A)
B2KBU4 9.26e-08 54 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Elusimicrobium minutum (strain Pei191)
Q9CIM0 9.27e-08 54 25 6 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Lactococcus lactis subsp. lactis (strain IL1403)
Q7W1Q6 9.76e-08 54 27 8 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A4T096 1.04e-07 53 29 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q38Z74 1.08e-07 53 27 6 198 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Latilactobacillus sakei subsp. sakei (strain 23K)
C1EUQ5 1.15e-07 53 25 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain 03BB102)
A0RE96 1.15e-07 53 25 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus thuringiensis (strain Al Hakam)
Q21122 1.25e-07 54 28 4 158 3 pfkb-1.2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase Caenorhabditis elegans
Q3B5J2 1.29e-07 53 27 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B7IX37 1.32e-07 53 24 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cereus (strain G9842)
A1R083 1.32e-07 53 27 6 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borrelia turicatae (strain 91E135)
Q2N682 1.4e-07 53 25 6 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Erythrobacter litoralis (strain HTCC2594)
P49872 1.46e-07 54 29 6 164 2 PFKFB1 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 1 Bos taurus
Q7VS43 1.6e-07 53 27 8 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WQN2 1.6e-07 53 27 8 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5P7N4 1.62e-07 53 27 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1TC01 1.79e-07 53 38 0 84 1 gpgP Glucosyl-3-phosphoglycerate phosphatase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q39V40 1.81e-07 53 27 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8GFF8 1.98e-07 53 25 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q8A8R2 2.13e-07 53 24 6 218 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1QRT7 2.37e-07 52 30 7 176 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
C4K389 2.42e-07 53 26 5 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q8RFG9 2.51e-07 53 24 6 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B2S101 2.65e-07 53 27 6 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borrelia hermsii (strain HS1 / DAH)
F4I8M8 2.83e-07 53 26 5 192 2 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Arabidopsis thaliana
Q8Y571 2.84e-07 52 27 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P70266 2.95e-07 53 28 6 164 1 Pfkfb1 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 1 Mus musculus
B8DFA5 3.04e-07 52 27 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria monocytogenes serotype 4a (strain HCC23)
C5CWV9 3.09e-07 52 36 2 94 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Variovorax paradoxus (strain S110)
Q660L2 4.71e-07 52 36 1 86 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A9M1A2 5.61e-07 52 26 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria meningitidis serogroup C (strain 053442)
Q9JTF2 5.84e-07 52 26 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
O94420 5.99e-07 52 26 4 163 3 SPCC1620.13 Probable phosphatase C1620.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0KET8 6.52e-07 52 26 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2L0A6 6.53e-07 52 27 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bordetella avium (strain 197N)
Q9JYF7 6.62e-07 51 26 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q71XG0 6.79e-07 51 27 7 199 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria monocytogenes serotype 4b (strain F2365)
C1KXG0 6.79e-07 51 27 7 199 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria monocytogenes serotype 4b (strain CLIP80459)
A1KV25 6.81e-07 51 26 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B8DLN4 6.88e-07 52 26 6 206 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A7MIX7 7.47e-07 51 28 8 193 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cronobacter sakazakii (strain ATCC BAA-894)
B9MEZ2 7.55e-07 51 26 6 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Acidovorax ebreus (strain TPSY)
B5RMK4 7.84e-07 51 26 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borrelia duttonii (strain Ly)
A9IFJ0 8.14e-07 51 27 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B4EST0 8.62e-07 51 25 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Proteus mirabilis (strain HI4320)
A0AKV8 8.64e-07 51 26 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B4SEI0 9.52e-07 51 27 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
P32604 1.06e-06 52 25 5 191 1 FBP26 Fructose-2,6-bisphosphatase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q057P1 1.12e-06 51 27 7 188 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
B0BPB3 1.15e-06 51 26 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1G9 1.15e-06 51 26 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0J2 1.15e-06 51 26 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9LM13 1.15e-06 51 26 6 199 2 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Arabidopsis thaliana
Q64R85 1.21e-06 51 25 7 218 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacteroides fragilis (strain YCH46)
Q5LAT7 1.21e-06 51 25 7 218 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q2YBZ1 1.23e-06 51 29 6 199 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B4RIY7 1.29e-06 50 26 8 195 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7C0 1.29e-06 50 26 8 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
C5BJ25 1.31e-06 51 26 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Teredinibacter turnerae (strain ATCC 39867 / T7901)
A1JRT1 1.35e-06 51 26 6 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B6IYD3 1.8e-06 50 26 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhodospirillum centenum (strain ATCC 51521 / SW)
C4XIQ5 1.88e-06 50 27 8 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B5FP39 2e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella dublin (strain CT_02021853)
Q732Z5 2.01e-06 50 24 6 195 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B1JSU1 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66D83 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNS2 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pestis (strain Pestoides F)
Q1CFN6 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3B3 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGY5 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pestis
B2K8R3 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C964 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FKP6 2.13e-06 50 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5RQ00 2.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Borrelia recurrentis (strain A1)
A1TTW5 2.31e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Paracidovorax citrulli (strain AAC00-1)
Q15SN0 2.5e-06 50 27 6 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B1JZ61 2.51e-06 50 26 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia orbicola (strain MC0-3)
B4EA64 2.51e-06 50 26 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q88T35 2.55e-06 50 25 8 193 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q2G373 2.57e-06 50 25 7 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4SDM0 2.74e-06 50 26 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A8GBA2 2.92e-06 50 26 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Serratia proteamaculans (strain 568)
A9VFW9 2.92e-06 50 23 6 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus mycoides (strain KBAB4)
A1WBJ3 3.13e-06 50 26 6 199 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Acidovorax sp. (strain JS42)
B5BC52 3.15e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella paratyphi A (strain AKU_12601)
Q5PG75 3.15e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQS2 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MTL3 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TC26 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella heidelberg (strain SL476)
B5R739 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QX43 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella enteritidis PT4 (strain P125109)
B5F050 3.18e-06 50 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella agona (strain SL483)
Q8Z8B2 3.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella typhi
B4TQR7 3.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella schwarzengrund (strain CVM19633)
C0PWW0 3.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella paratyphi C (strain RKS4594)
B4SZH5 3.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella newport (strain SL254)
Q57RI5 3.28e-06 50 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Salmonella choleraesuis (strain SC-B67)
P82612 3.99e-06 49 27 6 190 1 GPM1 Phosphoglycerate mutase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8Y2I3 4.03e-06 49 25 5 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8KFC8 4.09e-06 49 26 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q21YW0 4.12e-06 49 25 5 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8TN93 4.39e-06 49 42 0 66 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A7I8A7 4.42e-06 49 25 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q32IH0 4.65e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella dysenteriae serotype 1 (strain Sd197)
A9KN01 4.72e-06 49 26 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q3Z455 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella sonnei (strain Ss046)
P62710 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella flexneri
Q0T6Y5 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella flexneri serotype 5b (strain 8401)
Q324G4 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella boydii serotype 4 (strain Sb227)
B2TUY6 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK04 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4W897 4.88e-06 49 26 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Enterobacter sp. (strain 638)
B1LM46 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain SMS-3-5 / SECEC)
B6I7Q9 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain SE11)
B7N9Z7 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P62707 4.88e-06 49 25 6 198 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain K12)
B1IXY1 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P62708 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJU6 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8Z8 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O1:K1 / APEC
A7ZY11 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O9:H4 (strain HS)
B1X786 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain K12 / DH10B)
C4ZXS6 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6B8 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O8 (strain IAI1)
B7MPN9 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O81 (strain ED1a)
B7NNH7 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YRF2 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P62709 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O157:H7
B7LAF6 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli (strain 55989 / EAEC)
B7MGL2 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7ULM8 4.88e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q6ADH3 5e-06 49 27 7 193 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Leifsonia xyli subsp. xyli (strain CTCB07)
Q39CN6 5.06e-06 49 26 7 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A7ZJD0 5.07e-06 49 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Escherichia coli O139:H28 (strain E24377A / ETEC)
A6T6I3 5.37e-06 49 26 6 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZB2 5.37e-06 49 26 6 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Klebsiella pneumoniae (strain 342)
Q0BBK5 5.46e-06 49 26 7 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B3QPN8 5.59e-06 49 25 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q74CR0 5.81e-06 49 27 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q88YY8 5.89e-06 48 31 8 188 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q929G8 6.06e-06 48 26 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A4JI45 6.3e-06 48 26 7 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2VBS6 6.31e-06 48 26 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AJ40 7.2e-06 48 25 6 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B3DZZ7 7.69e-06 48 27 8 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methylacidiphilum infernorum (isolate V4)
O35552 8.33e-06 49 28 6 164 2 Pfkfb3 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 Rattus norvegicus
Q4JSW4 8.39e-06 48 27 6 186 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium jeikeium (strain K411)
B8F5J4 8.43e-06 48 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Glaesserella parasuis serovar 5 (strain SH0165)
Q7N6S0 8.62e-06 48 25 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O94461 9.44e-06 48 26 8 212 3 SPAC1687.21 Probable phosphatase C1687.21 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0SF09 9.53e-06 48 27 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhodococcus jostii (strain RHA1)
Q1GP88 9.7e-06 48 26 7 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P44865 9.73e-06 48 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UDW8 1.05e-05 48 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Haemophilus influenzae (strain PittEE)
Q4QME2 1.05e-05 48 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Haemophilus influenzae (strain 86-028NP)
A5UHR1 1.09e-05 48 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Haemophilus influenzae (strain PittGG)
Q30WZ8 1.14e-05 48 27 7 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q2FTH0 1.25e-05 48 27 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q63XU7 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia pseudomallei (strain K96243)
A3N5B0 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia pseudomallei (strain 668)
Q3JWH7 1.26e-05 48 27 7 219 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia pseudomallei (strain 1710b)
A3NR09 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia pseudomallei (strain 1106a)
A1UZX9 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia mallei (strain SAVP1)
Q62F43 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia mallei (strain ATCC 23344)
A2S625 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia mallei (strain NCTC 10229)
A3MQ23 1.26e-05 48 27 7 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia mallei (strain NCTC 10247)
B1YNA6 1.28e-05 48 26 7 202 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia ambifaria (strain MC40-6)
A1VKR6 1.31e-05 48 38 1 70 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Polaromonas naphthalenivorans (strain CJ2)
Q2T1H5 1.42e-05 48 28 8 198 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q16877 1.48e-05 48 27 7 173 1 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 Homo sapiens
Q6NJL2 1.55e-05 47 25 7 186 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q256A6 1.55e-05 47 25 5 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia felis (strain Fe/C-56)
A9BUZ3 1.56e-05 47 39 1 64 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q4R8B6 1.57e-05 48 27 7 173 2 PFKFB4 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 Macaca fascicularis
Q5L4Y3 1.58e-05 47 27 7 200 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia abortus (strain DSM 27085 / S26/3)
B2SX15 1.67e-05 47 36 2 93 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B0SY17 1.7e-05 47 28 8 187 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Caulobacter sp. (strain K31)
B9DL85 1.72e-05 47 25 6 204 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus carnosus (strain TM300)
A7GPN5 1.73e-05 47 24 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3AU60 1.76e-05 47 26 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium chlorochromatii (strain CaD3)
B2AGP7 1.79e-05 47 25 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C6DCF6 1.96e-05 47 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q11CB5 2.01e-05 47 29 7 177 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chelativorans sp. (strain BNC1)
B1Y3R5 2.09e-05 47 26 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q6AAU8 2.21e-05 47 28 8 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cutibacterium acnes (strain DSM 16379 / KPA171202)
P36136 2.25e-05 47 27 6 184 1 SHB17 Sedoheptulose 1,7-bisphosphatase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A1WWH7 2.5e-05 47 27 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Halorhodospira halophila (strain DSM 244 / SL1)
C1AZ61 2.74e-05 47 27 7 192 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhodococcus opacus (strain B4)
A6VLV0 2.75e-05 47 26 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q6D7E3 2.95e-05 47 27 7 191 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P15259 3.13e-05 47 26 7 208 1 PGAM2 Phosphoglycerate mutase 2 Homo sapiens
A6L9K8 3.18e-05 47 22 6 219 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q54NE6 3.19e-05 47 22 5 197 1 gpmA Probable phosphoglycerate mutase Dictyostelium discoideum
B0US27 3.66e-05 46 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Histophilus somni (strain 2336)
Q0I4D8 3.66e-05 46 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Histophilus somni (strain 129Pt)
C4LLD4 3.69e-05 47 26 7 187 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
C1CSS1 3.76e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CLZ5 3.76e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain P1031)
B2IRR1 3.76e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain CGSP14)
B8ZM52 3.76e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CFM7 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain JJA)
P0A3Y4 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A3Y3 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1I720 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain Hungary19A-6)
C1C8P5 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae (strain 70585)
B5E706 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae serotype 19F (strain G54)
Q04JB4 4.29e-05 46 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q0RS35 4.33e-05 46 28 7 188 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P64956 4.41e-05 47 31 4 188 4 BQ2027_MB2253C Uncharacterized protein Mb2253c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLH4 4.41e-05 47 31 4 188 4 MT2287 Uncharacterized protein MT2287 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WLH5 4.41e-05 47 31 4 188 1 Rv2228c Bifunctional protein Rv2228c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9PLK4 4.43e-05 46 40 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia muridarum (strain MoPn / Nigg)
Q821N6 4.46e-05 46 38 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q7VL28 4.5e-05 46 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O60825 4.7e-05 47 28 6 163 1 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 2 Homo sapiens
A5VB15 5.03e-05 46 26 7 188 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q97FJ6 5.31e-05 46 31 2 94 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9JJH5 5.67e-05 47 28 10 200 1 Pfkfb2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 2 Rattus norvegicus
Q1LTL3 5.71e-05 46 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q5R9C1 6.6e-05 46 28 6 164 2 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 Pongo abelii
Q91309 7.03e-05 46 27 6 164 2 None 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase Aquarana catesbeiana
P70265 7.06e-05 46 28 10 200 1 Pfkfb2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 2 Mus musculus
Q16875 7.26e-05 46 28 6 164 1 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 Homo sapiens
Q839H4 7.28e-05 45 24 7 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8CN61 8.63e-05 45 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P16290 9.95e-05 45 25 6 206 1 Pgam2 Phosphoglycerate mutase 2 Rattus norvegicus
Q82TU0 0.000106 45 25 7 192 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P25114 0.000134 45 26 7 173 1 Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 Rattus norvegicus
Q8NTA5 0.000135 45 27 8 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QB41 0.000135 45 27 8 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium glutamicum (strain R)
Q6DTY7 0.000135 45 26 7 173 2 Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 Mus musculus
P26285 0.000137 45 28 6 163 1 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 2 Bos taurus
Q2Y9Z7 0.000142 45 25 6 197 3 gpmA2 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NK82 0.000169 44 22 6 197 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P00950 0.000177 44 25 7 197 1 GPM1 Phosphoglycerate mutase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B3EN99 0.000211 44 26 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlorobium phaeobacteroides (strain BS1)
Q5HLI0 0.000216 44 25 6 197 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2JC95 0.000222 44 35 2 93 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2NUK6 0.000233 44 35 0 53 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Sodalis glossinidius (strain morsitans)
Q9CKU9 0.000234 44 25 7 196 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pasteurella multocida (strain Pm70)
Q5NVT1 0.000254 45 28 6 163 2 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 2 Pongo abelii
A8AW46 0.000271 44 24 6 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q38ZH8 0.000275 44 27 7 188 3 gpmA1 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1 Latilactobacillus sakei subsp. sakei (strain 23K)
O70250 0.000284 44 25 6 206 1 Pgam2 Phosphoglycerate mutase 2 Mus musculus
B0BAH7 0.000329 43 38 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B8U8 0.000329 43 38 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A0JSU9 0.000352 43 26 8 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Arthrobacter sp. (strain FB24)
Q4L8T0 0.000352 43 28 7 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus haemolyticus (strain JCSC1435)
Q65Q32 0.000392 43 25 7 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C5BEL3 0.0004 43 24 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Edwardsiella ictaluri (strain 93-146)
Q5FMJ3 0.000406 43 21 7 220 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B8GYN6 0.000412 43 27 7 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A634 0.000412 43 27 7 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q82GB8 0.000436 43 28 9 195 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q476J7 0.000444 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P65709 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain MW2)
A8YYG4 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6Q5 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain MSSA476)
P99153 0.000569 43 25 6 190 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain N315)
P65708 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJQ5 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain Newman)
Q5HDD9 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain COL)
Q2YVZ6 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IVJ6 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain JH9)
Q2FVK8 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FE81 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain USA300)
A6U4E6 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain JH1)
A7X656 0.000569 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P15327 0.000574 43 24 6 199 1 Bpgm Bisphosphoglycerate mutase Mus musculus
Q49ZZ2 0.000648 43 24 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8FSH0 0.000663 43 25 7 186 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O84727 0.000698 42 38 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKX2 0.000698 42 38 0 65 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q6GE17 0.000699 43 25 6 190 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Staphylococcus aureus (strain MRSA252)
P33158 0.000715 43 29 8 195 1 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8HCQ9 0.001 42 27 8 194 3 gpmA 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15380
Feature type CDS
Gene gpmB
Product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB
Location 61361 - 62008 (strand: 1)
Length 648 (nucleotides) / 215 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1145
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00300 Histidine phosphatase superfamily (branch 1)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0406 Carbohydrate transport and metabolism (G) G Broad specificity phosphatase PhoE

Kegg Ortholog Annotation(s)

Protein Sequence

MTQVFLVRHGETEWNVQRRIQGHSDSPLTQSGIDQAGQVAARLKNEGITHIIASDLGRTQQTAQLIADACGCDVIADPRLRELNMGILEKRQIHTLNAEEEGWRQSLLNGAEEGRIPQGESLTELESRMRAALESTLELPEGSRVLLVSHGIALGCLIGSVMGLAPYAERRLRLRNCSLSVLEYQESPWLADGWVVETAGDTTHLTLPALDEVQR

Flanking regions ( +/- flanking 50bp)

GGTATCGGGGTAATCAGACTTCCACACAGCAAGAGCAGAGATTGATAGTTATGACACAGGTATTTCTTGTCCGTCACGGTGAAACCGAATGGAATGTTCAGCGCCGTATCCAGGGGCATTCCGACAGCCCGTTAACGCAAAGTGGTATTGATCAGGCCGGTCAGGTTGCCGCGCGTCTGAAAAATGAAGGGATCACGCATATTATCGCCAGTGATCTGGGTCGCACACAACAGACTGCGCAACTGATAGCAGATGCCTGCGGCTGTGATGTGATTGCAGATCCACGTCTGCGTGAGCTGAATATGGGGATTCTGGAAAAACGTCAGATCCATACCCTGAACGCTGAAGAAGAGGGCTGGCGTCAGAGCCTGCTCAACGGCGCAGAAGAAGGACGTATTCCTCAGGGAGAATCTCTCACTGAGCTGGAAAGCCGGATGCGTGCTGCTCTGGAAAGCACCCTTGAACTGCCGGAAGGCAGCCGGGTTCTGCTGGTCAGTCACGGTATAGCGCTGGGTTGTCTGATTGGCTCGGTGATGGGGCTGGCACCTTACGCGGAGCGTCGTCTGCGTCTGCGCAACTGTTCATTGTCTGTACTGGAATACCAGGAAAGCCCGTGGCTGGCAGATGGCTGGGTGGTGGAAACTGCGGGGGATACCACGCATCTTACCCTTCCGGCACTGGATGAAGTGCAACGCTGAACAGACAGATAATATAACTGATGCCGCTCCCGGAGGAACAGATACCGCCC