Homologs in group_1692

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11795 FBDBKF_11795 86.0 Morganella morganii S1 kefG glutathione-regulated potassium-efflux system ancillary protein KefG
EHELCC_14510 EHELCC_14510 86.0 Morganella morganii S2 kefG glutathione-regulated potassium-efflux system ancillary protein KefG
NLDBIP_15605 NLDBIP_15605 86.0 Morganella morganii S4 kefG glutathione-regulated potassium-efflux system ancillary protein KefG
LHKJJB_15005 LHKJJB_15005 86.0 Morganella morganii S3 kefG glutathione-regulated potassium-efflux system ancillary protein KefG
HKOGLL_19280 HKOGLL_19280 86.0 Morganella morganii S5 kefG glutathione-regulated potassium-efflux system ancillary protein KefG
PMI_RS13860 PMI_RS13860 57.8 Proteus mirabilis HI4320 kefG glutathione-regulated potassium-efflux system ancillary protein KefG

Distribution of the homologs in the orthogroup group_1692

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1692

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8GKL4 2.68e-88 259 65 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Serratia proteamaculans (strain 568)
A1JS77 4.43e-87 256 64 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8AQP1 1.4e-85 253 62 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C6DG98 4.44e-84 249 63 0 177 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CZU4 2.37e-83 247 63 0 177 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7ME22 2.95e-83 247 63 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Cronobacter sakazakii (strain ATCC BAA-894)
A4WFE5 3.05e-83 247 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Enterobacter sp. (strain 638)
Q83PX9 9.95e-83 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Shigella flexneri
Q0SZW5 9.95e-83 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Shigella flexneri serotype 5b (strain 8401)
B7LS58 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2R0 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain SE11)
B7NDW0 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A756 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain K12)
P0A757 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A5F9 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O9:H4 (strain HS)
B1X6K1 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain K12 / DH10B)
C4ZUK7 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1Q3 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O8 (strain IAI1)
B7NMB9 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTQ8 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A758 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O157:H7
B7L4M8 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain 55989 / EAEC)
A7ZSM7 1.24e-82 245 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IPB3 1.82e-82 244 61 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B2VK48 2.1e-82 244 62 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7FNQ1 2.58e-82 244 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1R5T1 1e-81 243 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli (strain UTI89 / UPEC)
A1AGN7 1e-81 243 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O1:K1 / APEC
B7N1D3 1e-81 243 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O81 (strain ED1a)
B7MCW7 1e-81 243 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UK62 1e-81 243 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1JIU3 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q4 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX4 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pestis (strain Pestoides F)
Q1CCS6 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pestis bv. Antiqua (strain Nepal516)
B2K5P7 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2S8 1.36e-81 243 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pestis bv. Antiqua (strain Antiqua)
A9R474 1.54e-81 242 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC5 1.54e-81 242 61 0 181 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Yersinia pestis
Q32B14 4.3e-81 241 60 0 183 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Shigella dysenteriae serotype 1 (strain Sd197)
Q0TCA9 1.09e-80 240 61 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P65510 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65511 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella typhi
B4TXG0 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella schwarzengrund (strain CVM19633)
B5BH04 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella paratyphi A (strain AKU_12601)
Q5PL20 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUV8 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella newport (strain SL254)
B4TKN3 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella heidelberg (strain SL476)
B5R2A9 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella enteritidis PT4 (strain P125109)
B5FJN2 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella dublin (strain CT_02021853)
Q57J14 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella choleraesuis (strain SC-B67)
B5F8H0 3.97e-80 239 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella agona (strain SL483)
A9MT18 1.24e-79 238 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5RGZ7 2.47e-79 237 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella gallinarum (strain 287/91 / NCTC 13346)
C0Q0D4 3.25e-79 236 59 0 182 3 kefG Glutathione-regulated potassium-efflux system ancillary protein KefG Salmonella paratyphi C (strain RKS4594)
Q3Z5W3 6.37e-36 126 45 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella sonnei (strain Ss046)
P54439 2.33e-35 125 38 0 168 3 yrkL Uncharacterized NAD(P)H oxidoreductase YrkL Bacillus subtilis (strain 168)
Q326I7 3.72e-35 124 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella boydii serotype 4 (strain Sb227)
B2U254 3.72e-35 124 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IRD0 3.72e-35 124 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P80871 9.9e-35 123 38 0 171 1 ywrO General stress protein 14 Bacillus subtilis (strain 168)
Q8ZRW3 1.81e-34 122 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWT0 1.87e-34 122 40 1 172 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella schwarzengrund (strain CVM19633)
Q83SQ4 2.29e-34 122 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella flexneri
Q0T8E9 2.29e-34 122 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella flexneri serotype 5b (strain 8401)
Q8Z9K1 2.64e-34 122 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella typhi
B4TII5 4.43e-34 122 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella heidelberg (strain SL476)
B5F766 4.43e-34 122 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella agona (strain SL483)
C0Q4M9 4.53e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella paratyphi C (strain RKS4594)
B4T6L1 4.53e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella newport (strain SL254)
Q57TH5 4.53e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella choleraesuis (strain SC-B67)
B5RGB7 4.78e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LVT7 6.61e-34 121 44 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5R1S3 6.83e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella enteritidis PT4 (strain P125109)
B5FI28 6.83e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella dublin (strain CT_02021853)
B1LFY0 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain SMS-3-5 / SECEC)
B6HYZ7 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain SE11)
B7N7S1 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A754 8.12e-34 121 43 1 147 1 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain K12)
P0A755 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZVZ8 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O9:H4 (strain HS)
B1XC47 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain K12 / DH10B)
C4ZPX2 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0E3 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O8 (strain IAI1)
B7MNQ3 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O81 (strain ED1a)
B7NHF0 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L4G9 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain 55989 / EAEC)
B7UI92 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHD9 8.12e-34 121 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O139:H28 (strain E24377A / ETEC)
P96674 9.68e-34 121 43 0 148 3 ydeQ Uncharacterized NAD(P)H oxidoreductase YdeQ Bacillus subtilis (strain 168)
B5YZ82 1.43e-33 120 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA24 1.43e-33 120 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O157:H7
Q0TLU3 1.47e-33 120 43 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A9MQG7 4.07e-33 119 42 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q1RGF2 5.87e-33 119 42 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli (strain UTI89 / UPEC)
A1A795 5.87e-33 119 42 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O1:K1 / APEC
B7MAG9 5.87e-33 119 42 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Escherichia coli O45:K1 (strain S88 / ExPEC)
Q32K50 7.53e-33 118 42 1 147 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Shigella dysenteriae serotype 1 (strain Sd197)
A4W6F2 1.63e-30 112 37 2 174 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Enterobacter sp. (strain 638)
A8ALQ5 6.47e-30 111 37 1 162 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9X755 1.61e-29 110 39 1 162 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Klebsiella aerogenes
B5Y1Z9 4.83e-29 108 39 1 162 3 kefF Glutathione-regulated potassium-efflux system ancillary protein KefF Klebsiella pneumoniae (strain 342)
Q5RBB9 1.14e-11 64 28 6 210 2 NQO2 Ribosyldihydronicotinamide dehydrogenase [quinone] Pongo abelii
P16083 1.82e-11 63 28 7 213 1 NQO2 Ribosyldihydronicotinamide dehydrogenase [quinone] Homo sapiens
Q9JI75 3.6e-10 60 29 6 187 1 Nqo2 Ribosyldihydronicotinamide dehydrogenase [quinone] Mus musculus
Q6AY80 1.95e-09 58 29 8 206 1 Nqo2 Ribosyldihydronicotinamide dehydrogenase [quinone] Rattus norvegicus
A0A481WNM5 2.94e-08 55 29 7 175 3 traD Ribosyldihydronicotinamide dehydrogenase-like protein traD Penicillium crustosum
P05982 1.72e-06 50 48 0 43 1 Nqo1 NAD(P)H dehydrogenase [quinone] 1 Rattus norvegicus
P45245 3.59e-06 48 28 5 145 3 HI_1544 Uncharacterized NAD(P)H oxidoreductase HI_1544 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CHK7 2.89e-05 46 28 4 138 2 NQO1 NAD(P)H dehydrogenase [quinone] 1 Cavia porcellus
Q5RD31 4.33e-05 46 44 0 43 2 NQO1 NAD(P)H dehydrogenase [quinone] 1 Pongo abelii
Q64669 4.89e-05 46 26 3 132 1 Nqo1 NAD(P)H dehydrogenase [quinone] 1 Mus musculus
P15559 5.91e-05 45 44 0 43 1 NQO1 NAD(P)H dehydrogenase [quinone] 1 Homo sapiens
Q5R0V3 0.000353 43 36 3 73 3 azoR2 FMN-dependent NADH:quinone oxidoreductase 2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14860
Feature type CDS
Gene kefG
Product glutathione-regulated potassium-efflux system ancillary protein KefG
Location 207935 - 208501 (strand: 1)
Length 567 (nucleotides) / 188 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1692
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02525 Flavodoxin-like fold

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2249 General function prediction only (R) R Putative NADPH-quinone reductase (modulator of drug activity B)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11748 glutathione-regulated potassium-efflux system ancillary protein KefG - -

Protein Sequence

MTNNPTILLLYAHPEPHHSIANKALISGASELEHVTVHDLYGAYPDFFIDIRHEQALLSRHDIIVFQHPLYTYSCPALLKEWFDRVLTRDFSGEQGGKQLSGKYWRQVITTGEPSDAYQPGGYNRFPLSDLLRPFELTASMCEMHWLAPVVIYEARRQEKSVLHEQTQAWCDWLRTPQLTGGRTDDNG

Flanking regions ( +/- flanking 50bp)

AGGCATAGTAGCGAAAATCACAGCAATTCTCACGCGTTTAAGAGGAAGTGATGACAAATAATCCGACTATATTACTGCTTTATGCCCATCCGGAGCCGCATCACTCCATCGCAAACAAGGCGCTGATAAGCGGCGCGTCTGAGCTGGAACATGTCACTGTTCATGACCTTTACGGTGCCTATCCGGATTTTTTTATTGATATCCGTCATGAGCAGGCATTGCTCAGCCGGCACGATATCATCGTATTTCAGCACCCGCTGTATACTTACAGTTGCCCCGCATTGCTGAAAGAGTGGTTTGACCGGGTGCTCACCCGTGATTTTTCCGGTGAGCAGGGCGGAAAGCAATTATCAGGTAAATACTGGCGCCAGGTTATCACCACCGGCGAGCCGTCAGATGCCTATCAGCCCGGCGGTTATAACCGTTTTCCGCTGAGTGATTTACTGCGCCCCTTTGAACTGACCGCATCCATGTGTGAAATGCACTGGCTGGCGCCGGTAGTGATTTATGAGGCGCGCCGTCAGGAAAAATCGGTATTGCATGAACAGACTCAGGCATGGTGTGACTGGCTTCGCACCCCGCAACTGACAGGAGGGCGCACGGATGACAATGGATGACGGTAACTTACTGCATGCGGGGATTATTTTTCTGGCGGCGGCGGTCATTA