Homologs in group_198

Help

8 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11815 FBDBKF_11815 85.9 Morganella morganii S1 murP PTS N-acetylmuramic acid transporter subunit IIBC
EHELCC_14490 EHELCC_14490 85.9 Morganella morganii S2 murP PTS N-acetylmuramic acid transporter subunit IIBC
NLDBIP_15585 NLDBIP_15585 85.9 Morganella morganii S4 murP PTS N-acetylmuramic acid transporter subunit IIBC
LHKJJB_15025 LHKJJB_15025 85.9 Morganella morganii S3 murP PTS N-acetylmuramic acid transporter subunit IIBC
HKOGLL_14145 HKOGLL_14145 85.9 Morganella morganii S5 murP PTS N-acetylmuramic acid transporter subunit IIBC
PMI_RS01405 PMI_RS01405 28.3 Proteus mirabilis HI4320 treB PTS trehalose transporter subunit IIBC
PMI_RS10970 PMI_RS10970 25.7 Proteus mirabilis HI4320 - beta-glucoside-specific PTS transporter subunit IIABC
PMI_RS17475 PMI_RS17475 38.6 Proteus mirabilis HI4320 - PTS transporter subunit EIIC

Distribution of the homologs in the orthogroup group_198

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_198

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N9D9 0.0 719 76 1 484 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5E5T6 0.0 693 73 1 484 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87FD5 0.0 672 69 1 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MBS2 0.0 671 69 2 487 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q8D4Z3 0.0 671 69 2 487 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
Q9CKN5 0.0 647 65 1 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q9KVD9 0.0 646 69 3 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P77272 0.0 572 62 4 485 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q83QN3 0.0 571 62 5 486 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q8XBJ1 0.0 571 62 4 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q8FFA9 0.0 571 62 4 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R8U3 0.0 570 62 4 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q31Y50 0.0 570 62 4 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
Q32DC5 0.0 567 62 4 485 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
Q4L8H5 1.07e-87 280 39 14 479 3 SH0741 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus haemolyticus (strain JCSC1435)
Q797S1 3.41e-85 272 38 13 475 3 ybbF Putative PTS system EIIBC component YbbF Bacillus subtilis (strain 168)
Q2YV12 1e-83 270 38 13 482 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GKB4 4.51e-83 268 38 13 482 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q7A1Y1 6.84e-83 267 38 13 482 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 6.84e-83 267 38 13 482 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 6.84e-83 267 38 13 482 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 6.84e-83 267 38 13 482 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 6.84e-83 267 38 13 482 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 6.84e-83 267 38 13 482 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 6.84e-83 267 38 13 482 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q8CNB2 2.28e-79 258 37 10 474 3 SE_1890 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLT2 2.28e-79 258 37 10 474 3 SERP1900 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49ZN7 9.43e-78 254 36 12 477 3 SSP0594 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P05306 8.55e-53 187 29 11 476 1 sacP PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
P22825 1.5e-46 171 30 15 496 3 scrA PTS system sucrose-specific EIIBC component Vibrio alginolyticus
P51184 3.39e-46 170 30 14 490 3 scrA PTS system sucrose-specific EIIBC component Staphylococcus xylosus
P08470 2.13e-45 167 31 13 483 3 scrA PTS system sucrose-specific EIIBC component Salmonella typhimurium
Q9CJZ2 2.44e-45 168 28 14 494 3 scrA PTS system sucrose-specific EIIBC component Pasteurella multocida (strain Pm70)
P27219 5.03e-45 166 32 13 410 3 scrA PTS system sucrose-specific EIIBC component Klebsiella pneumoniae
P08722 3.09e-43 164 28 11 441 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
Q9KF90 8.51e-39 152 29 13 436 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P40739 6.79e-37 146 28 12 473 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
P39794 1.6e-35 140 28 13 432 2 treP PTS system trehalose-specific EIIBC component Bacillus subtilis (strain 168)
P36672 3.65e-35 140 23 7 435 1 treB PTS system trehalose-specific EIIBC component Escherichia coli (strain K12)
P15400 2.76e-34 137 26 11 408 1 sacX Probable PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
P26207 1.71e-32 134 28 12 482 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
P12655 4.72e-32 133 28 14 429 1 scrA PTS system sucrose-specific EIIBCA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P43470 7.54e-30 126 28 14 460 3 scrA PTS system sucrose-specific EIIBCA component Pediococcus pentosaceus
P24241 1.62e-25 112 24 10 498 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q46072 5.71e-23 105 25 13 495 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q45298 1.16e-22 105 24 12 491 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
Q6GKB7 2.44e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q2YUZ1 2.51e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A807 2.53e-06 53 28 2 103 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 2.53e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 2.53e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 2.53e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 2.53e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NYM1 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 2.55e-06 53 28 2 103 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q57071 3.38e-06 53 29 2 97 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
P20166 2.67e-05 50 28 3 104 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q4L945 2.68e-05 50 29 3 98 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q53922 4.39e-05 49 29 3 100 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
P69790 5.55e-05 47 39 3 74 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 5.55e-05 47 39 3 74 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q7CCJ4 0.000196 47 29 2 98 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 0.000196 47 29 2 98 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 0.000196 47 29 2 98 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
P42015 0.000542 45 37 1 59 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
Q2YWC1 0.000623 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3G4 0.000629 46 29 1 87 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 0.000629 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 0.000629 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDR0 0.000656 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q8NUS2 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
A5IVW5 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
Q2FV87 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
A6U4R9 0.000668 46 29 1 87 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
O34521 0.000669 45 38 2 68 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14840
Feature type CDS
Gene murP
Product PTS N-acetylmuramic acid transporter subunit IIBC
Location 202303 - 203760 (strand: -1)
Length 1458 (nucleotides) / 485 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_198
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11192 N-acetylmuramic acid PTS system EIICB component [EC:2.7.1.192] Amino sugar and nucleotide sugar metabolism
Phosphotransferase system (PTS)		 -

Protein Sequence

MAKITQSTIIQILAAIGGPGNVAHSGNCMTRLRLTLNNSQLADKIAIKKIEGVLGVIESDEQFQIVLGPGKAQTAAELMQHQLDEYTPDSYSENGDENRSLKEIAAEQKQHLKEKQTNPVQRFLAKFATIFTPLIPGFIGVGLLLGLATLGEQLWITGNEAPNQTLVEILAYMKIFSKGMFTFLSILIGYNAQKAFGGSGVNGAIIAALFVFGYDPQVTKGFYSGMETFFGHAIDPRGNIIGVLIAAILGAWVERNVRKIIPATLDIILTSAITLLIMGAVTFVVIMPVGVYLFDGMSWLFTHLNGNPFGTAVLAGLFLIAVMFGVHQGFIPVYFALVDAQGFNSLFPILAMAGAGQVGAALALYMKAKKDSLLRTQIKGAIIPGFLGIGEPLIYGVTLPRLKPFITACLGGAAGGFFIGLVAWMGLPVGLNTVFGPSGLVAIPLMTSNSGIFAGMGVYVAGLLVAYLAGFLLTLLFGSKNVDLR

Flanking regions ( +/- flanking 50bp)

TCCGTGATGCTCTCGCCGGTACGGCACACGCTTAACACAAGGTAATAACCATGGCAAAAATCACGCAATCGACAATTATACAGATTCTGGCTGCCATCGGCGGTCCGGGTAATGTGGCACACAGCGGCAACTGCATGACTCGTCTGCGCCTGACACTGAACAACTCACAGCTCGCAGACAAGATAGCCATCAAAAAAATTGAGGGTGTGCTGGGTGTTATTGAAAGTGATGAACAGTTCCAGATAGTCCTCGGGCCGGGCAAAGCACAAACCGCCGCAGAGCTGATGCAACATCAGTTAGATGAATACACCCCTGACAGTTATTCAGAAAACGGTGATGAAAACCGCAGCCTGAAAGAGATTGCGGCAGAACAAAAACAGCATCTGAAAGAGAAGCAAACCAATCCCGTACAGCGCTTTCTGGCAAAATTTGCCACTATTTTTACGCCGCTGATCCCGGGATTTATTGGTGTTGGTCTGTTACTGGGGCTGGCAACACTCGGTGAGCAACTCTGGATAACCGGCAATGAAGCCCCGAACCAGACACTGGTGGAAATCCTCGCTTACATGAAAATCTTCAGTAAGGGGATGTTCACCTTCCTGAGTATTCTGATTGGTTATAACGCACAGAAGGCTTTTGGCGGCTCCGGCGTGAACGGGGCAATCATCGCCGCACTGTTTGTCTTCGGTTATGATCCGCAGGTAACCAAGGGATTCTATTCCGGCATGGAAACCTTCTTCGGCCATGCTATCGATCCGCGCGGGAATATTATCGGTGTACTGATCGCCGCGATCCTCGGCGCATGGGTGGAGCGTAATGTCCGGAAAATCATCCCCGCCACTCTTGATATTATTCTGACATCAGCAATCACGCTGCTGATTATGGGAGCCGTAACCTTTGTCGTCATCATGCCGGTCGGCGTTTATCTGTTTGACGGTATGTCATGGCTGTTCACACATCTCAACGGAAACCCGTTCGGAACCGCCGTGTTAGCGGGTCTGTTTCTGATAGCGGTAATGTTCGGCGTACATCAGGGCTTTATCCCTGTGTATTTTGCCCTGGTCGATGCGCAGGGATTCAACTCACTGTTTCCGATCCTCGCGATGGCGGGAGCCGGTCAGGTGGGAGCCGCACTCGCGCTCTATATGAAAGCCAAAAAAGATTCACTGCTGCGCACACAAATCAAAGGTGCCATTATCCCGGGCTTTCTCGGCATTGGTGAACCGCTGATTTACGGCGTGACATTACCGCGCCTGAAACCGTTTATAACCGCGTGTCTCGGCGGCGCTGCGGGTGGTTTCTTTATCGGGCTGGTTGCCTGGATGGGCTTACCGGTCGGGTTGAATACGGTATTCGGACCCTCCGGTCTGGTTGCGATACCACTGATGACATCAAATAGCGGGATCTTTGCCGGGATGGGTGTGTATGTCGCGGGTCTGCTGGTCGCGTATCTGGCGGGTTTCCTGCTGACGCTGCTGTTCGGCAGCAAAAATGTGGATTTACGTTAGTTACCCCGCAGCGTATACAAAAACAGACCGCAATGCGGTCTGTTTTTACT