Homologs in group_1701

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11860 FBDBKF_11860 86.7 Morganella morganii S1 ppiA peptidylprolyl isomerase A
EHELCC_14445 EHELCC_14445 86.7 Morganella morganii S2 ppiA peptidylprolyl isomerase A
NLDBIP_15540 NLDBIP_15540 86.7 Morganella morganii S4 ppiA peptidylprolyl isomerase A
LHKJJB_15070 LHKJJB_15070 86.7 Morganella morganii S3 ppiA peptidylprolyl isomerase A
HKOGLL_14190 HKOGLL_14190 86.7 Morganella morganii S5 ppiA peptidylprolyl isomerase A
PMI_RS13945 PMI_RS13945 70.7 Proteus mirabilis HI4320 ppiA peptidylprolyl isomerase A

Distribution of the homologs in the orthogroup group_1701

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1701

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O53021 2.99e-94 275 69 1 189 3 rotA Peptidyl-prolyl cis-trans isomerase A Dickeya dadantii (strain 3937)
P0AFL3 6.76e-87 256 65 1 189 1 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli (strain K12)
P0AFL4 6.76e-87 256 65 1 189 3 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFL5 6.76e-87 256 65 1 189 3 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli O157:H7
P20753 1.2e-81 243 69 0 160 3 ppiA Peptidyl-prolyl cis-trans isomerase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q59641 2.29e-69 212 59 3 187 3 ppiA Peptidyl-prolyl cis-trans isomerase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42693 9.01e-68 207 55 2 186 3 rotA Peptidyl-prolyl cis-trans isomerase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P83221 6.63e-54 172 54 1 162 1 cyp18 Peptidyl-prolyl cis-trans isomerase cyp18 Streptomyces antibioticus
P44499 1.69e-53 171 52 1 163 3 ppiB Peptidyl-prolyl cis-trans isomerase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23869 7.02e-53 169 53 1 161 1 ppiB Peptidyl-prolyl cis-trans isomerase B Escherichia coli (strain K12)
Q8W4D0 6.05e-21 92 40 6 160 1 CYP71 Peptidyl-prolyl cis-trans isomerase CYP71 Arabidopsis thaliana
Q8G0J9 6.67e-21 88 39 6 171 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella suis biovar 1 (strain 1330)
Q8YHB5 6.67e-21 88 39 6 171 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57D43 1.54e-20 87 38 6 171 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella abortus biovar 1 (strain 9-941)
Q2YPY5 1.54e-20 87 38 6 171 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella abortus (strain 2308)
Q4I1Y1 1.54e-20 86 34 7 170 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4WCR3 1.71e-20 86 34 7 170 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7SF72 7.65e-20 84 34 7 170 3 ppi-1 Peptidyl-prolyl cis-trans isomerase-like 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P87051 8.06e-20 84 35 7 164 1 ppi1 Peptidyl-prolyl cis-trans isomerase ppi1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0C1I4 4.36e-19 82 37 6 151 3 cyp3 Peptidyl-prolyl cis-trans isomerase-like 1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q8X191 4.71e-19 82 34 7 170 3 cypC Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus niger
Q5ASQ0 6.48e-19 82 32 7 170 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2U6U0 1.76e-18 81 33 7 170 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P0CP86 2.91e-17 78 35 5 157 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP87 2.91e-17 78 35 5 157 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP84 5.46e-17 77 34 6 148 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP85 5.46e-17 77 34 6 148 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q09928 1.59e-16 80 36 5 155 2 cyp8 Peptidyl-prolyl cis-trans isomerase cyp8 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P52009 1.67e-16 76 32 5 184 2 cyn-1 Peptidyl-prolyl cis-trans isomerase 1 Caenorhabditis elegans
Q8SRE1 1.99e-16 76 38 6 139 1 CPR1 Peptidyl-prolyl cis-trans isomerase Encephalitozoon cuniculi (strain GB-M1)
Q8CEC6 2.35e-16 79 36 5 157 1 Ppwd1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Mus musculus
Q29RZ2 2.68e-16 79 36 5 157 2 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Bos taurus
Q54E95 3.05e-16 75 34 6 158 3 ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Dictyostelium discoideum
Q9NI62 3.06e-16 75 34 7 164 1 cypE Peptidyl-prolyl cis-trans isomerase cypE Dictyostelium discoideum
Q7SG06 6.95e-16 75 37 7 159 3 cyp-3 Peptidyl-prolyl cis-trans isomerase H Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O74942 7.38e-16 78 33 6 158 1 cyp9 Peptidyl-prolyl cis-trans isomerase 9 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LPC7 8.3e-16 74 33 7 162 2 CYP18-1 Peptidyl-prolyl cis-trans isomerase CYP18-1 Arabidopsis thaliana
P72704 1.25e-15 75 33 3 154 3 sll0227 Probable peptidyl-prolyl cis-trans isomerase sll0227 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q96BP3 1.3e-15 77 35 5 157 1 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Homo sapiens
Q5NVL7 1.34e-15 77 35 5 157 2 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Pongo abelii
P0C1I0 1.65e-15 74 38 8 163 3 cyp9 Peptidyl-prolyl cis-trans isomerase B2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q5ZLV2 2.62e-15 72 33 6 159 2 PPIL3 Peptidyl-prolyl cis-trans isomerase-like 3 Gallus gallus
Q39613 3.07e-15 73 38 6 144 1 PCKR1 Peptidyl-prolyl cis-trans isomerase Catharanthus roseus
P0C1J1 3.29e-15 76 34 7 164 3 cyp14 Peptidyl-prolyl cis-trans isomerase-like 2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9D6L8 3.52e-15 72 32 6 159 1 Ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Mus musculus
P0C1I5 4.39e-15 72 33 7 173 3 cyp4 Peptidyl-prolyl cis-trans isomerase-like 3 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9SIH1 4.98e-15 72 30 6 162 2 CYP18-2 Peptidyl-prolyl cis-trans isomerase CYP18-2 Arabidopsis thaliana
P0C1J0 5.2e-15 75 37 4 137 3 cyp15 Peptidyl-prolyl cis-trans isomerase cyp15 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q13356 5.32e-15 75 33 5 169 1 PPIL2 RING-type E3 ubiquitin-protein ligase PPIL2 Homo sapiens
Q812D3 5.77e-15 72 32 6 159 2 Ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Rattus norvegicus
P24525 6.08e-15 72 37 6 146 2 CYP Peptidyl-prolyl cis-trans isomerase Brassica napus
P0C1I2 6.86e-15 74 38 7 148 3 cyp10 Peptidyl-prolyl cis-trans isomerase E Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q4R713 7.69e-15 75 35 7 160 2 CWC27 Spliceosome-associated protein CWC27 homolog Macaca fascicularis
Q5R7W3 7.92e-15 75 35 7 160 2 CWC27 Spliceosome-associated protein CWC27 homolog Pongo abelii
Q41651 1.03e-14 73 37 7 154 1 None Peptidyl-prolyl cis-trans isomerase, chloroplastic Vicia faba
O93826 1.03e-14 72 37 8 155 2 CPR2 Peptidyl-prolyl cis-trans isomerase B Arthroderma benhamiae
D4AY02 1.03e-14 72 37 8 155 1 ARB_01071 Probable peptidyl-prolyl cis-trans isomerase ARB_01071 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q9H2H8 1.14e-14 71 33 5 154 1 PPIL3 Peptidyl-prolyl cis-trans isomerase-like 3 Homo sapiens
Q26565 1.62e-14 70 39 7 139 1 None Peptidyl-prolyl cis-trans isomerase Schistosoma mansoni
P52012 1.89e-14 73 30 5 161 1 cyn-4 Peptidyl-prolyl cis-trans isomerase 4 Caenorhabditis elegans
Q6UX04 2.48e-14 73 34 6 158 1 CWC27 Spliceosome-associated protein CWC27 homolog Homo sapiens
O43447 2.97e-14 70 35 8 157 1 PPIH Peptidyl-prolyl cis-trans isomerase H Homo sapiens
Q0P5D0 2.97e-14 70 35 8 157 2 PPIH Peptidyl-prolyl cis-trans isomerase H Bos taurus
Q38900 3.08e-14 70 36 6 146 1 CYP19-1 Peptidyl-prolyl cis-trans isomerase CYP19-1 Arabidopsis thaliana
P52017 3.44e-14 70 32 5 157 2 cyn-10 Peptidyl-prolyl cis-trans isomerase 10 Caenorhabditis elegans
Q9V3G3 3.77e-14 72 35 6 160 1 cyp33 Peptidyl-prolyl cis-trans isomerase E Drosophila melanogaster
Q42406 4.4e-14 70 36 6 147 1 CYP18-4 Peptidyl-prolyl cis-trans isomerase CYP18-4 Arabidopsis thaliana
P0CP90 5.35e-14 72 32 7 168 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP91 5.35e-14 72 32 7 168 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q4IPH4 5.74e-14 69 37 5 143 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P91791 5.99e-14 69 37 6 137 2 None Peptidyl-prolyl cis-trans isomerase Hemicentrotus pulcherrimus
P34887 7.15e-14 68 37 7 146 2 CYP Peptidyl-prolyl cis-trans isomerase Allium cepa
Q9D787 7.56e-14 72 31 5 169 1 Ppil2 RING-type E3 ubiquitin-protein ligase PPIL2 Mus musculus
P0CP82 1.17e-13 68 35 8 160 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP83 1.17e-13 68 35 8 160 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9SKQ0 1.18e-13 68 35 7 160 2 CYP19-2 Peptidyl-prolyl cis-trans isomerase CYP19-2 Arabidopsis thaliana
P0CP88 1.23e-13 71 36 9 165 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP89 1.23e-13 71 36 9 165 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q27774 1.42e-13 69 34 9 189 2 None Peptidyl-prolyl cis-trans isomerase B Schistosoma japonicum
O94273 1.53e-13 68 37 9 159 3 cyp4 Peptidyl-prolyl cis-trans isomerase B Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9TW32 1.67e-13 68 35 8 160 1 cypB Peptidyl-prolyl cis-trans isomerase B Dictyostelium discoideum
Q9ZJH5 1.67e-13 68 33 3 136 3 ppiA Peptidyl-prolyl cis-trans isomerase Helicobacter pylori (strain J99 / ATCC 700824)
Q9TTC6 1.87e-13 68 36 7 148 2 PPIA Peptidyl-prolyl cis-trans isomerase A Oryctolagus cuniculus
Q0ZQK6 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Symphalangus syndactylus
Q5R8S7 2.12e-13 67 37 7 143 2 PPIA Peptidyl-prolyl cis-trans isomerase A Pongo pygmaeus
P62941 2.12e-13 67 37 7 143 2 PPIA Peptidyl-prolyl cis-trans isomerase A Papio anubis
Q0ZQL1 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Pan troglodytes
Q0ZQL2 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Pan paniscus
Q0ZQK7 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Nomascus leucogenys
P62940 2.12e-13 67 37 7 143 1 PPIA Peptidyl-prolyl cis-trans isomerase A Macaca mulatta
Q0ZQK8 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Hylobates lar
P62937 2.12e-13 67 37 7 143 1 PPIA Peptidyl-prolyl cis-trans isomerase A Homo sapiens
Q0ZQL0 2.12e-13 67 37 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Gorilla gorilla gorilla
P62938 2.12e-13 67 37 7 143 1 PPIA Peptidyl-prolyl cis-trans isomerase A Chlorocebus aethiops
Q8LDP4 2.57e-13 68 35 5 140 1 CYP19-4 Peptidyl-prolyl cis-trans isomerase CYP19-4 Arabidopsis thaliana
Q4IPB8 2.64e-13 67 32 7 171 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P17742 2.7e-13 67 37 7 143 1 Ppia Peptidyl-prolyl cis-trans isomerase A Mus musculus
Q8L8W5 2.81e-13 68 33 5 154 2 CYP21-2 Peptidyl-prolyl cis-trans isomerase CYP21-2 Arabidopsis thaliana
P14851 2.97e-13 67 39 7 132 2 PPIA Peptidyl-prolyl cis-trans isomerase A Cricetulus griseus
Q5B4R3 3.35e-13 68 38 7 136 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AXT6 3.37e-13 70 29 5 173 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O25982 3.4e-13 67 35 4 138 3 ppiA Peptidyl-prolyl cis-trans isomerase Helicobacter pylori (strain ATCC 700392 / 26695)
P10111 3.58e-13 67 39 7 131 1 Ppia Peptidyl-prolyl cis-trans isomerase A Rattus norvegicus
P23285 4.22e-13 68 39 6 139 1 CPR2 Peptidyl-prolyl cis-trans isomerase B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P52018 4.53e-13 67 34 7 160 2 cyn-11 Peptidyl-prolyl cis-trans isomerase 11 Caenorhabditis elegans
P34790 4.55e-13 67 36 6 153 1 CYP18-3 Peptidyl-prolyl cis-trans isomerase CYP18-3 Arabidopsis thaliana
P35137 4.76e-13 66 38 6 134 1 ppiB Peptidyl-prolyl cis-trans isomerase B Bacillus subtilis (strain 168)
P0C1H9 4.83e-13 67 30 7 205 3 cyp8 Peptidyl-prolyl cis-trans isomerase B1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q7S7Z6 5.9e-13 68 38 9 152 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9UA41 6.73e-13 67 33 4 146 1 cypD Peptidyl-prolyl cis-trans isomerase D, mitochondrial Dictyostelium discoideum
P0CP92 6.81e-13 69 32 4 159 3 CWC27 Peptidyl-prolyl isomerase CWC27 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP93 6.81e-13 69 32 4 159 3 CWC27 Peptidyl-prolyl isomerase CWC27 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P21568 7.06e-13 66 36 6 146 1 CYP Peptidyl-prolyl cis-trans isomerase Solanum lycopersicum
P62936 1.01e-12 66 37 7 143 1 PPIA Peptidyl-prolyl cis-trans isomerase A Sus scrofa
P62935 1.01e-12 66 37 7 143 1 PPIA Peptidyl-prolyl cis-trans isomerase A Bos taurus
Q38867 1.04e-12 66 35 7 153 2 CYP19-3 Peptidyl-prolyl cis-trans isomerase CYP19-3 Arabidopsis thaliana
P35176 1.07e-12 67 36 7 144 1 CPR5 Peptidyl-prolyl cis-trans isomerase D Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54985 1.09e-12 65 37 6 136 2 CYPA Peptidyl-prolyl cis-trans isomerase Blattella germanica
O00060 1.35e-12 65 40 7 134 2 PIG28 Peptidyl-prolyl cis-trans isomerase Uromyces fabae
Q9FJX0 1.46e-12 68 30 5 165 2 CYP65 Peptidyl-prolyl cis-trans isomerase CYP65 Arabidopsis thaliana
P29820 1.49e-12 65 42 2 111 3 rot Peptidyl-prolyl cis-trans isomerase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q26551 1.57e-12 66 37 8 159 2 CYP Peptidyl-prolyl cis-trans isomerase B Schistosoma mansoni
Q01490 1.61e-12 66 35 9 171 1 CYPB Peptidyl-prolyl cis-trans isomerase B Orpinomyces sp. (strain PC-2)
P0C1H8 1.66e-12 65 37 6 137 3 cyp1 Peptidyl-prolyl cis-trans isomerase A2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q6Q152 1.7e-12 68 36 3 122 1 CYP57 Peptidyl-prolyl cis-trans isomerase CYP57 Arabidopsis thaliana
P21569 1.79e-12 65 36 6 146 2 CYP Peptidyl-prolyl cis-trans isomerase Zea mays
Q4WP12 1.8e-12 66 35 9 159 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4IBK5 2.32e-12 67 37 4 137 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P14088 2.37e-12 65 38 6 137 2 CYP-1 Peptidyl-prolyl cis-trans isomerase Echinococcus granulosus
O49886 2.77e-12 65 36 6 144 2 None Peptidyl-prolyl cis-trans isomerase Lupinus luteus
Q9Y3C6 3.12e-12 64 30 7 169 1 PPIL1 Peptidyl-prolyl cis-trans isomerase-like 1 Homo sapiens
Q5E992 3.12e-12 64 30 7 169 2 PPIL1 Peptidyl-prolyl cis-trans isomerase-like 1 Bos taurus
P0C1I8 3.35e-12 65 30 5 167 3 cyp6 Peptidyl-prolyl cis-trans isomerase cyp6 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P80311 3.64e-12 65 40 8 140 1 PPIB Peptidyl-prolyl cis-trans isomerase B Bos taurus
Q9D868 3.68e-12 65 34 6 136 1 Ppih Peptidyl-prolyl cis-trans isomerase H Mus musculus
Q2TZ33 3.93e-12 65 33 5 154 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5XIB2 4.11e-12 67 34 6 158 1 Cwc27 Spliceosome-associated protein CWC27 homolog Rattus norvegicus
P77949 4.21e-12 64 33 6 160 1 cypB Peptidyl-prolyl cis-trans isomerase B Streptomyces anulatus
Q9SP02 4.6e-12 65 35 5 140 1 CYP20-1 Peptidyl-prolyl cis-trans isomerase CYP20-1 Arabidopsis thaliana
Q5AQL0 4.75e-12 64 33 6 152 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0ZQK3 5.2e-12 64 36 7 143 3 PPIA Peptidyl-prolyl cis-trans isomerase A Saguinus oedipus
Q6DTV9 5.2e-12 64 36 7 143 2 PPIA Peptidyl-prolyl cis-trans isomerase A Aotus trivirgatus
Q3TKY6 5.38e-12 66 34 6 158 1 Cwc27 Spliceosome-associated protein CWC27 homolog Mus musculus
P25007 5.56e-12 65 36 6 134 1 Cyp1 Peptidyl-prolyl cis-trans isomerase Drosophila melanogaster
Q4WMB6 5.62e-12 65 32 8 180 3 cyp10 Peptidyl-prolyl cis-trans isomerase-like 3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P52014 5.8e-12 64 39 7 132 2 cyn-6 Peptidyl-prolyl cis-trans isomerase 6 Caenorhabditis elegans
Q9D0W5 7.69e-12 63 31 7 164 1 Ppil1 Peptidyl-prolyl cis-trans isomerase-like 1 Mus musculus
P18253 8.59e-12 63 37 6 139 3 ppi1 Peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8HXS3 8.65e-12 63 36 7 143 2 PPIA Peptidyl-prolyl cis-trans isomerase A Felis catus
O66105 9.86e-12 64 40 6 134 1 ppiB Probable peptidyl-prolyl cis-trans isomerase Treponema pallidum (strain Nichols)
P0CP78 1.04e-11 64 36 6 142 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q9ASS6 1.05e-11 65 36 6 138 1 PNSL5 Photosynthetic NDH subunit of lumenal location 5, chloroplastic Arabidopsis thaliana
Q5BAH7 1.18e-11 64 32 8 184 3 cyp10 Peptidyl-prolyl cis-trans isomerase-like 3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P34791 1.24e-11 64 35 6 137 1 CYP20-3 Peptidyl-prolyl cis-trans isomerase CYP20-3, chloroplastic Arabidopsis thaliana
P0DN26 1.42e-11 63 37 6 131 3 PPIAL4F Peptidyl-prolyl cis-trans isomerase A-like 4F Homo sapiens
A0A075B759 1.42e-11 63 37 6 131 3 PPIAL4E Peptidyl-prolyl cis-trans isomerase A-like 4E Homo sapiens
P0CP79 1.42e-11 64 36 6 142 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
O74729 1.61e-11 63 36 7 138 3 cyp3 Peptidyl-prolyl cis-trans isomerase cyp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4P555 1.64e-11 65 34 7 152 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Ustilago maydis (strain 521 / FGSC 9021)
Q4P6X6 1.7e-11 62 33 8 163 3 CYP3 Peptidyl-prolyl cis-trans isomerase H (Fragment) Ustilago maydis (strain 521 / FGSC 9021)
A0A0B4J2A2 1.73e-11 62 37 6 131 2 PPIAL4C Peptidyl-prolyl cis-trans isomerase A-like 4C Homo sapiens
P24367 1.76e-11 63 39 8 141 2 PPIB Peptidyl-prolyl cis-trans isomerase B Gallus gallus
P0C1I3 2.27e-11 62 33 7 161 3 cyp7 Peptidyl-prolyl cis-trans isomerase H Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q4G338 2.37e-11 64 34 8 155 1 None Peptidyl-prolyl cis-trans isomerase E Haemonchus contortus
P35627 2.56e-11 62 37 5 132 2 None Peptidyl-prolyl cis-trans isomerase Unspecified eudicot DB-1992
Q4IPB3 2.73e-11 64 27 6 183 3 CWC27 Peptidyl-prolyl isomerase CWC27 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8LDR3 2.78e-11 63 32 4 159 2 CYP23 Peptidyl-prolyl cis-trans isomerase CYP23 Arabidopsis thaliana
Q5XAQ1 4.03e-11 64 40 2 97 1 M6_Spy1377 Putative bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B3A0R0 4.13e-11 62 39 7 125 1 None Putative peptidyl-prolyl cis-trans isomerase Lottia gigantea
Q54SM3 4.65e-11 62 37 5 139 1 ppiA Peptidyl-prolyl cis-trans isomerase A Dictyostelium discoideum
Q2UGK2 4.67e-11 62 34 8 149 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q4WCM6 4.76e-11 62 34 7 152 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P29117 5.07e-11 62 32 8 171 1 Ppif Peptidyl-prolyl cis-trans isomerase F, mitochondrial Rattus norvegicus
P24369 5.08e-11 62 38 8 142 1 Ppib Peptidyl-prolyl cis-trans isomerase B Mus musculus
Q49W93 5.24e-11 62 31 7 181 3 SSP1821 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q26548 5.4e-11 63 38 7 135 1 None Peptidyl-prolyl cis-trans isomerase E Schistosoma mansoni
P0C1J2 5.55e-11 63 32 8 164 3 cwc27 Peptidyl-prolyl isomerase cwc27 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q5AUG9 5.76e-11 63 31 7 173 3 cwc27 Peptidyl-prolyl isomerase cwc27 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WVU5 6.04e-11 63 28 5 173 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q17QX9 6.14e-11 63 34 6 158 2 CWC27 Spliceosome-associated protein CWC27 homolog Bos taurus
P52010 6.91e-11 61 29 6 167 2 cyn-2 Peptidyl-prolyl cis-trans isomerase 2 Caenorhabditis elegans
F5H284 6.93e-11 61 37 6 129 3 PPIAL4D Peptidyl-prolyl cis-trans isomerase A-like 4D Homo sapiens
Q99KR7 7.85e-11 62 38 7 134 1 Ppif Peptidyl-prolyl cis-trans isomerase F, mitochondrial Mus musculus
Q26516 9.07e-11 61 38 7 134 2 None Peptidyl-prolyl cis-trans isomerase E (Fragment) Schistosoma japonicum
P25719 9.43e-11 61 32 7 173 1 CPR3 Peptidyl-prolyl cis-trans isomerase C, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WE62 9.46e-11 63 30 7 173 3 cwc27 Peptidyl-prolyl isomerase cwc27 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P30405 9.95e-11 61 38 7 134 1 PPIF Peptidyl-prolyl cis-trans isomerase F, mitochondrial Homo sapiens
Q8W171 1.05e-10 60 34 6 145 2 Cyp1 Peptidyl-prolyl cis-trans isomerase 1 Glycine max
P22011 1.46e-10 60 38 7 131 1 CYP1 Peptidyl-prolyl cis-trans isomerase Candida albicans (strain SC5314 / ATCC MYA-2876)
P0DN37 1.55e-10 60 36 6 131 1 PPIAL4G Peptidyl-prolyl cis-trans isomerase A-like 4G Homo sapiens
Q9C566 1.58e-10 62 34 8 160 2 CYP40 Peptidyl-prolyl cis-trans isomerase CYP40 Arabidopsis thaliana
P24368 1.63e-10 61 38 8 140 1 Ppib Peptidyl-prolyl cis-trans isomerase B Rattus norvegicus
Q4I5R9 1.74e-10 61 34 6 136 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P0C1H7 1.79e-10 60 32 6 155 3 cyp2 Peptidyl-prolyl cis-trans isomerase A1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q2U5W8 1.9e-10 62 29 5 166 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P23284 2.22e-10 60 40 8 128 1 PPIB Peptidyl-prolyl cis-trans isomerase B Homo sapiens
P84343 3.25e-10 59 38 6 121 1 None Peptidyl-prolyl cis-trans isomerase Neospora caninum
Q9Y536 3.32e-10 59 36 6 131 1 PPIAL4A Peptidyl-prolyl cis-trans isomerase A-like 4A Homo sapiens
A0A075B767 3.64e-10 59 35 6 131 1 PPIAL4H Peptidyl-prolyl cis-trans isomerase A-like 4H Homo sapiens
Q8X166 3.88e-10 60 36 7 134 1 cypB Peptidyl-prolyl cis-trans isomerase B Aspergillus niger
P0C1I9 4.19e-10 61 33 6 154 3 cyp11 Peptidyl-prolyl cis-trans isomerase cyp11 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P30404 4.89e-10 59 36 7 138 1 PPIF Peptidyl-prolyl cis-trans isomerase F, mitochondrial Bos taurus
Q9LY75 5.69e-10 60 33 5 157 1 CYP63 Peptidyl-prolyl cis-trans isomerase CYP63 Arabidopsis thaliana
P52015 5.75e-10 58 31 5 138 1 cyn-7 Peptidyl-prolyl cis-trans isomerase 7 Caenorhabditis elegans
P14832 6.19e-10 58 35 5 130 1 CPR1 Peptidyl-prolyl cis-trans isomerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0C1I7 6.91e-10 58 28 6 167 3 cyp5 Peptidyl-prolyl cis-trans isomerase cyp5 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q6C4W6 8.6e-10 59 34 10 195 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6GLX7 9.83e-10 60 32 6 158 2 cwc27 Spliceosome-associated protein CWC27 homolog Xenopus laevis
O42941 1.09e-09 60 31 5 158 1 cyp7 Peptidylprolyl isomerase cyp7 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1RMP7 1.51e-09 59 29 4 152 2 PPIL6 Probable inactive peptidyl-prolyl cis-trans isomerase-like 6 Bos taurus
Q7SBX8 1.7e-09 59 27 5 183 3 cwc-27 Peptidyl-prolyl isomerase cwc-27 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P52011 1.85e-09 57 32 5 137 1 cyn-3 Peptidyl-prolyl cis-trans isomerase 3 Caenorhabditis elegans
P10255 1.91e-09 58 35 7 134 1 csr-1 Peptidyl-prolyl cis-trans isomerase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P9WHW3 2.71e-09 57 32 9 195 1 ppiA Peptidyl-prolyl cis-trans isomerase A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHW2 2.71e-09 57 32 9 195 3 ppiA Peptidyl-prolyl cis-trans isomerase A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65763 2.71e-09 57 32 9 195 3 ppiA Probable peptidyl-prolyl cis-trans isomerase A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5R723 2.95e-09 58 32 6 146 2 PPIE Peptidyl-prolyl cis-trans isomerase E Pongo abelii
Q9UNP9 3.07e-09 58 32 6 146 1 PPIE Peptidyl-prolyl cis-trans isomerase E Homo sapiens
Q9QZH3 3.13e-09 58 32 6 146 1 Ppie Peptidyl-prolyl cis-trans isomerase E Mus musculus
A4FV72 3.19e-09 58 31 6 146 2 PPIE Peptidyl-prolyl cis-trans isomerase E Bos taurus
Q4P0V4 6.94e-09 57 34 6 139 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Ustilago maydis (strain 521 / FGSC 9021)
P0C1I6 7.69e-09 57 32 6 156 3 cyp13 Peptidyl-prolyl cis-trans isomerase-like 4 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9ZVJ4 7.73e-09 56 29 7 175 2 CYP22 Peptidyl-prolyl cis-trans isomerase CYP22 Arabidopsis thaliana
Q7A1C0 9.03e-09 56 30 7 173 3 MW0836 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MW2)
Q6GAX2 9.03e-09 56 30 7 173 3 SAS0824 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MSSA476)
Q6GID4 9.03e-09 56 30 7 173 3 SAR0916 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MRSA252)
Q7A6I1 9.03e-09 56 30 7 173 1 SA0815 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain N315)
Q99VD4 9.03e-09 56 30 7 173 3 SAV0954 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YWT2 9.03e-09 56 30 7 173 3 SAB0821 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FZU9 9.03e-09 56 30 7 173 3 SAOUHSC_00891 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC1 9.03e-09 56 30 7 173 3 SAUSA300_0857 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain USA300)
Q8CT84 9.31e-09 56 31 5 157 3 SE_0648 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQK8 9.31e-09 56 31 5 157 3 SERP0540 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P52013 9.74e-09 56 36 7 135 1 cyn-5 Peptidyl-prolyl cis-trans isomerase 5 Caenorhabditis elegans
Q7ZW86 9.92e-09 57 34 3 129 2 cwc27 Spliceosome-associated protein CWC27 homolog Danio rerio
P73789 1.1e-08 55 32 6 141 1 slr1251 Peptidyl-prolyl cis-trans isomerase slr1251 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P15425 1.48e-08 55 30 8 180 1 ninaA Peptidyl-prolyl cis-trans isomerase, rhodopsin-specific isozyme Drosophila melanogaster
O00845 1.64e-08 54 31 5 151 3 None Peptidyl-prolyl cis-trans isomerase Paramecium primaurelia
Q9CDE9 1.95e-08 55 31 8 194 3 ppiA Probable peptidyl-prolyl cis-trans isomerase A Mycobacterium leprae (strain TN)
Q4P7H2 1.96e-08 56 30 6 170 3 CWC27 Peptidyl-prolyl isomerase CWC27 Ustilago maydis (strain 521 / FGSC 9021)
Q7RXA6 2.1e-08 56 31 5 144 3 ppi-2 Peptidyl-prolyl cis-trans isomerase-like 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6CBP4 2.69e-08 55 31 6 158 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4L4W9 3.76e-08 54 39 2 97 3 SH1997 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus haemolyticus (strain JCSC1435)
Q5HHD1 4.15e-08 54 29 7 173 3 SACOL0957 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain COL)
P30412 4.84e-08 54 35 5 137 1 Ppic Peptidyl-prolyl cis-trans isomerase C Mus musculus
Q6MWS8 4.98e-08 53 30 7 156 3 cyp-10 Peptidyl-prolyl cis-trans isomerase-like 3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P52016 5.27e-08 55 30 7 158 2 cyn-8 Peptidyl-prolyl cis-trans isomerase 8 Caenorhabditis elegans
Q5U8Z7 5.37e-08 55 32 6 161 2 Cyp40 Peptidyl-prolyl cis-trans isomerase D Amanita muscaria
H2QII6 7.28e-08 55 35 6 133 1 RANBP2 E3 SUMO-protein ligase RanBP2 Pan troglodytes
Q9P3X9 9.9e-08 54 30 4 153 1 cyp41 41 kDa peptidyl-prolyl cis-trans isomerase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q08E11 1.19e-07 53 34 5 137 2 PPIC Peptidyl-prolyl cis-trans isomerase C Bos taurus
Q4PCH8 1.28e-07 52 25 5 163 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Ustilago maydis (strain 521 / FGSC 9021)
Q09637 1.37e-07 53 32 7 150 2 cyn-9 Peptidyl-prolyl cis-trans isomerase 9 Caenorhabditis elegans
Q94A16 1.97e-07 52 26 4 156 2 CYP21-3 Peptidyl-prolyl cis-trans isomerase CYP21-3, mitochondrial Arabidopsis thaliana
Q5ARI5 1.98e-07 53 30 5 156 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P45877 2.03e-07 52 30 7 183 1 PPIC Peptidyl-prolyl cis-trans isomerase C Homo sapiens
P0CP81 2.07e-07 53 31 5 151 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q4WAQ9 2.86e-07 53 30 6 162 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0CP80 3.62e-07 52 32 6 151 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P28517 3.72e-07 52 33 7 139 2 NINAA Peptidyl-prolyl cis-trans isomerase, rhodopsin-specific isozyme Calliphora vicina
Q871A4 4.04e-07 52 28 7 185 3 cyp-6 Peptidyl-prolyl cis-trans isomerase-like 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q06118 4.73e-07 50 35 9 154 1 ppiA Peptidyl-prolyl cis-trans isomerase A Streptomyces anulatus
O49605 5.63e-07 51 32 6 138 2 CYP21-1 Peptidyl-prolyl cis-trans isomerase CYP21-1 Arabidopsis thaliana
Q9ERU9 5.73e-07 52 33 4 119 1 Ranbp2 E3 SUMO-protein ligase RanBP2 Mus musculus
P48820 6.88e-07 52 35 8 142 2 RANBP2 E3 SUMO-protein ligase RanBP2 (Fragment) Bos taurus
Q27450 9.35e-07 51 29 4 160 1 CYP-1 Peptidyl-prolyl cis-trans isomerase 1 Brugia malayi
P49792 1.06e-06 51 34 6 133 1 RANBP2 E3 SUMO-protein ligase RanBP2 Homo sapiens
Q4HXF6 1.59e-06 50 32 7 152 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WHW1 2.68e-06 50 29 6 153 1 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHW0 2.68e-06 50 29 6 153 3 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4IE79 3.02e-06 50 29 6 176 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q2U256 4.38e-06 49 31 7 163 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5ACI8 5.77e-06 48 34 7 138 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Candida albicans (strain SC5314 / ATCC MYA-2876)
Q11004 6.18e-06 48 33 5 139 2 wis2 40 kDa peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6Q151 6.67e-06 48 30 7 154 1 CYP59 Peptidyl-prolyl cis-trans isomerase CYP59 Arabidopsis thaliana
Q9D6D8 8.42e-06 48 26 5 146 1 Ppil6 Probable inactive peptidyl-prolyl cis-trans isomerase-like 6 Mus musculus
P46697 9.33e-06 48 27 5 147 3 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium leprae (strain TN)
Q9CXG3 9.83e-06 48 28 6 160 1 Ppil4 Peptidyl-prolyl cis-trans isomerase-like 4 Mus musculus
P30414 9.85e-06 48 27 6 168 1 NKTR NK-tumor recognition protein Homo sapiens
Q13427 1.03e-05 48 31 5 147 1 PPIG Peptidyl-prolyl cis-trans isomerase G Homo sapiens
P30415 1.12e-05 48 27 6 168 1 Nktr NK-tumor recognition protein Mus musculus
Q6CGK4 1.18e-05 48 30 2 110 3 CWC27 Peptidyl-prolyl isomerase CWC27 Yarrowia lipolytica (strain CLIB 122 / E 150)
A2AR02 1.38e-05 48 31 5 147 1 Ppig Peptidyl-prolyl cis-trans isomerase G Mus musculus
O55035 1.4e-05 48 31 5 147 1 Ppig Peptidyl-prolyl cis-trans isomerase G Rattus norvegicus
Q2U0E0 1.57e-05 47 32 6 148 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q8WUA2 2.03e-05 47 27 6 160 1 PPIL4 Peptidyl-prolyl cis-trans isomerase-like 4 Homo sapiens
Q5B4E7 2.08e-05 47 31 6 152 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P26882 2.53e-05 47 31 6 137 1 PPID Peptidyl-prolyl cis-trans isomerase D Bos taurus
P0C1I1 2.76e-05 47 32 5 130 3 cyp12 Peptidyl-prolyl cis-trans isomerase D Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
A8X8D0 2.87e-05 47 28 7 159 2 cyn-9 Peptidyl-prolyl cis-trans isomerase 9 Caenorhabditis briggsae
Q9CR16 2.94e-05 47 30 6 137 1 Ppid Peptidyl-prolyl cis-trans isomerase D Mus musculus
Q6DGG0 3.2e-05 47 30 6 137 1 Ppid Peptidyl-prolyl cis-trans isomerase D Rattus norvegicus
Q55118 4.36e-05 46 28 6 165 3 sll0408 Putative thylakoid lumen peptidyl-prolyl cis-trans isomerase sll0408 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q4WIF3 0.000122 45 32 6 140 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q08752 0.000124 45 30 6 137 1 PPID Peptidyl-prolyl cis-trans isomerase D Homo sapiens
Q75A33 0.000136 45 35 5 126 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8RWY7 0.000154 45 28 6 154 1 CYP95 Peptidyl-prolyl cis-trans isomerase CYP95 Arabidopsis thaliana
Q9UUE4 0.0003 43 27 7 161 1 cyp6 Peptidyl-prolyl cis-trans isomerase cyp6 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O49939 0.000398 43 30 6 151 1 TLP40 Peptidyl-prolyl cis-trans isomerase, chloroplastic Spinacia oleracea
Q9C835 0.000528 42 26 4 145 2 CYP21-4 Peptidyl-prolyl cis-trans isomerase CYP21-4 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14790
Feature type CDS
Gene ppiA
Product peptidylprolyl isomerase A
Location 194546 - 195112 (strand: 1)
Length 567 (nucleotides) / 188 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1701
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00160 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0652 Posttranslational modification, protein turnover, chaperones (O) O Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03767 peptidyl-prolyl cis-trans isomerase A (cyclophilin A) [EC:5.2.1.8] Cationic antimicrobial peptide (CAMP) resistance
Viral life cycle - HIV-1
Necroptosis		 -

Protein Sequence

MLKRVLVSLVAACTLSASSLAFAAEQTHIQFVTSAGNFEIALDDEKAPETVKNFKQYVTDKFYDDTTFHRVIPGFMVQGGGFTADLTQKPTRPPVKNEADNGLRNVRGTLSMARTADVNSATSQFFINVADNAFLDHGQRDFGYAVFGKVVNGMDVVDKMSKVKTDDIGPYQNVPSVPIKIISATIIK

Flanking regions ( +/- flanking 50bp)

TTAAAATCGATAAGAACAGTGTCAGCATATTTCGTTGAAAGGAATTTGGAATGTTAAAACGTGTTTTAGTTTCACTTGTGGCGGCTTGTACTCTCAGTGCGTCTTCGCTGGCTTTTGCGGCGGAGCAGACCCATATTCAATTTGTTACCTCAGCGGGTAATTTTGAAATTGCACTGGATGATGAAAAAGCGCCGGAGACAGTAAAGAATTTCAAGCAATATGTTACCGACAAGTTTTATGACGATACAACATTCCATCGTGTTATCCCGGGTTTTATGGTGCAGGGCGGTGGTTTTACCGCTGATCTGACCCAGAAACCAACCCGTCCCCCGGTTAAAAATGAAGCTGATAATGGCTTACGTAATGTGCGCGGAACGCTCTCGATGGCACGTACTGCCGATGTAAACAGCGCAACCAGCCAGTTCTTTATTAATGTGGCGGATAATGCATTCCTGGATCACGGACAACGTGATTTTGGTTATGCCGTATTTGGTAAGGTTGTGAACGGGATGGATGTCGTTGATAAAATGTCAAAAGTGAAAACAGATGACATCGGTCCCTATCAGAATGTCCCTTCCGTACCAATCAAAATTATCTCTGCAACTATCATAAAATAAGCCTTATTTTATCGCAGACTAAGGGGAATATTTCCTGATATTCCCCTTGG