Homologs in group_340

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11620 FBDBKF_11620 30.2 Morganella morganii S1 ligA NAD-dependent DNA ligase LigA
EHELCC_17540 EHELCC_17540 30.2 Morganella morganii S2 ligA NAD-dependent DNA ligase LigA
NLDBIP_18750 NLDBIP_18750 30.2 Morganella morganii S4 ligA NAD-dependent DNA ligase LigA
LHKJJB_17980 LHKJJB_17980 30.2 Morganella morganii S3 ligA NAD-dependent DNA ligase LigA
HKOGLL_18670 HKOGLL_18670 30.2 Morganella morganii S5 ligA NAD-dependent DNA ligase LigA
F4V73_RS08060 F4V73_RS08060 28.5 Morganella psychrotolerans ligA NAD-dependent DNA ligase LigA
PMI_RS08995 PMI_RS08995 28.5 Proteus mirabilis HI4320 ligA NAD-dependent DNA ligase LigA

Distribution of the homologs in the orthogroup group_340

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_340

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5EXF2 1.25e-135 408 44 6 484 3 ligB DNA ligase B Salmonella agona (strain SL483)
B4TZZ8 1.9e-135 408 44 6 484 3 ligB DNA ligase B Salmonella schwarzengrund (strain CVM19633)
Q8ZL42 8.45e-135 406 44 6 484 3 ligB DNA ligase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R5H2 9.52e-135 406 44 6 484 3 ligB DNA ligase B Salmonella enteritidis PT4 (strain P125109)
C0Q1X9 1.07e-134 406 44 6 484 3 ligB DNA ligase B Salmonella paratyphi C (strain RKS4594)
Q57I94 1.07e-134 406 44 6 484 3 ligB DNA ligase B Salmonella choleraesuis (strain SC-B67)
B5RG75 1.47e-134 405 44 6 484 3 ligB DNA ligase B Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MVP4 1.63e-134 405 43 6 484 3 ligB DNA ligase B Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FM71 3.19e-134 405 43 6 484 3 ligB DNA ligase B Salmonella dublin (strain CT_02021853)
B5BI22 1.06e-133 404 43 6 484 3 ligB DNA ligase B Salmonella paratyphi A (strain AKU_12601)
Q5PC41 1.06e-133 404 43 6 484 3 ligB DNA ligase B Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9Z1 1.48e-133 403 43 6 484 3 ligB DNA ligase B Salmonella heidelberg (strain SL476)
B4SXE9 8.06e-133 401 43 6 484 3 ligB DNA ligase B Salmonella newport (strain SL254)
A7MQB5 8.42e-133 401 41 9 530 3 ligB DNA ligase B Cronobacter sakazakii (strain ATCC BAA-894)
B1LK84 1.08e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli (strain SMS-3-5 / SECEC)
B7N287 1.2e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli O81 (strain ED1a)
Q1R4U5 1.25e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli (strain UTI89 / UPEC)
A1AHH8 1.25e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli O1:K1 / APEC
B7MFK8 1.25e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FC83 1.38e-131 398 41 4 480 3 ligB DNA ligase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7NQ11 3.21e-131 397 41 4 480 3 ligB DNA ligase B Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7NEV1 3.46e-131 397 41 4 480 3 ligB DNA ligase B Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q4K4I6 4.51e-131 397 39 7 534 3 ligB DNA ligase B Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1JHV9 2.67e-130 395 40 7 542 3 ligB DNA ligase B Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YW09 5.54e-130 394 40 4 480 3 ligB DNA ligase B Shigella sonnei (strain Ss046)
A8ARN4 7.75e-130 394 42 3 477 3 ligB DNA ligase B Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TBG2 2.11e-129 392 40 4 480 3 ligB DNA ligase B Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3K5E7 2.47e-129 392 39 7 536 3 ligB DNA ligase B Pseudomonas fluorescens (strain Pf0-1)
P25772 2.57e-129 392 39 5 497 1 ligB DNA ligase B Escherichia coli (strain K12)
B1X980 2.57e-129 392 39 5 497 3 ligB DNA ligase B Escherichia coli (strain K12 / DH10B)
C4ZXN9 2.57e-129 392 39 5 497 3 ligB DNA ligase B Escherichia coli (strain K12 / MC4100 / BW2952)
B7L771 5.83e-129 391 40 4 480 3 ligB DNA ligase B Escherichia coli (strain 55989 / EAEC)
B1IYV3 6.42e-129 391 40 4 480 3 ligB DNA ligase B Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M4D2 6.7e-129 391 40 4 480 3 ligB DNA ligase B Escherichia coli O8 (strain IAI1)
A9MKM6 8.13e-129 391 42 6 484 3 ligB DNA ligase B Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q4ZLZ9 1.08e-128 390 40 7 505 3 ligB DNA ligase B Pseudomonas syringae pv. syringae (strain B728a)
Q0SYH4 1.14e-128 390 40 4 480 3 ligB DNA ligase B Shigella flexneri serotype 5b (strain 8401)
A8A6A9 1.25e-128 390 40 4 480 3 ligB DNA ligase B Escherichia coli O9:H4 (strain HS)
B7UM69 1.99e-128 390 40 6 482 3 ligB DNA ligase B Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTJ9 2.27e-128 390 40 4 480 3 ligB DNA ligase B Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83PM9 4.75e-127 386 40 4 480 3 ligB DNA ligase B Shigella flexneri
Q88AK8 1.21e-126 385 40 7 505 3 ligB DNA ligase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B5YWE6 1.64e-126 385 40 4 480 3 ligB DNA ligase B Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XD89 1.64e-126 385 40 4 480 3 ligB DNA ligase B Escherichia coli O157:H7
A6TFP6 2.23e-126 385 39 7 505 3 ligB DNA ligase B Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6DB58 7.79e-126 383 40 5 492 3 ligB DNA ligase B Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N9N4 1e-125 384 35 6 566 3 ligB DNA ligase B Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5XTF0 1.25e-125 383 40 7 500 3 ligB DNA ligase B Klebsiella pneumoniae (strain 342)
A4W502 4.94e-125 381 40 4 480 3 ligB DNA ligase B Enterobacter sp. (strain 638)
C3K3F7 1.19e-123 377 40 10 534 3 ligB DNA ligase B Pseudomonas fluorescens (strain SBW25)
B1J2Z7 4.75e-123 376 38 10 545 3 ligB DNA ligase B Pseudomonas putida (strain W619)
A4XPF7 2.76e-120 369 40 8 481 3 ligB DNA ligase B Pseudomonas mendocina (strain ymp)
C6DJC3 5.49e-120 368 41 7 495 3 ligB DNA ligase B Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A5WA01 9.72e-120 368 38 7 538 3 ligB DNA ligase B Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q66GE4 3.23e-119 366 38 5 522 3 ligB DNA ligase B Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JYM4 3.23e-119 366 38 5 522 3 ligB DNA ligase B Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1I3X5 6.13e-119 365 39 6 494 3 ligB DNA ligase B Pseudomonas entomophila (strain L48)
Q88D59 7.26e-119 365 38 7 538 3 ligB DNA ligase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1C259 1.09e-118 365 38 5 522 3 ligB DNA ligase B Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCR5 1.14e-118 365 38 5 522 3 ligB DNA ligase B Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JQZ3 3.3e-118 364 38 5 522 3 ligB DNA ligase B Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TSE5 3.3e-118 364 38 5 522 3 ligB DNA ligase B Yersinia pestis (strain Pestoides F)
Q1CCZ4 3.3e-118 364 38 5 522 3 ligB DNA ligase B Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CLB2 3.3e-118 364 38 5 522 3 ligB DNA ligase B Yersinia pestis
A9R666 3.8e-118 363 38 5 522 3 ligB DNA ligase B Yersinia pestis bv. Antiqua (strain Angola)
C1DIC2 9.94e-116 357 39 10 543 3 ligB DNA ligase B Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1QXD7 3.19e-115 358 40 7 495 3 ligB DNA ligase B Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4VRF3 1.01e-113 352 40 9 489 3 ligB DNA ligase B Stutzerimonas stutzeri (strain A1501)
B0KLZ2 1.56e-109 342 40 5 457 3 ligB DNA ligase B Pseudomonas putida (strain GB-1)
Q03DT9 9.37e-40 157 28 20 524 3 ligA DNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q492G5 6.05e-38 151 27 19 525 3 ligA DNA ligase Blochmanniella pennsylvanica (strain BPEN)
Q8DFK5 1.74e-34 141 27 14 418 3 ligA DNA ligase Vibrio vulnificus (strain CMCP6)
Q04BW0 2e-34 141 28 13 407 3 ligA DNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q03AC3 1.15e-33 139 27 20 515 3 ligA DNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q1GBF7 1.2e-33 139 28 13 407 3 ligA DNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B3WD54 1.51e-33 139 27 20 515 3 ligA DNA ligase Lacticaseibacillus casei (strain BL23)
Q7MMT5 1.56e-33 139 28 12 391 3 ligA DNA ligase Vibrio vulnificus (strain YJ016)
Q9ZFY8 2.34e-33 138 27 24 573 3 ligA DNA ligase Thermus sp. (strain AK16D)
Q1J0I6 2.98e-33 138 27 20 517 3 ligA DNA ligase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q03Q13 4.53e-33 137 27 18 519 3 ligA DNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B4SCX5 8.19e-33 136 26 18 527 3 ligA DNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1QZY4 1.55e-32 135 27 11 386 3 ligA DNA ligase Borrelia turicatae (strain 91E135)
Q5FUI5 2.3e-32 135 28 11 392 3 ligA DNA ligase Gluconobacter oxydans (strain 621H)
Q4L7L9 2.36e-32 135 26 19 512 3 ligA DNA ligase Staphylococcus haemolyticus (strain JCSC1435)
B2A5W5 3.12e-32 135 26 22 517 3 ligA DNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q7VRU2 3.52e-32 134 25 18 528 3 ligA DNA ligase Blochmanniella floridana
B5FGU7 3.64e-32 134 27 13 417 3 ligA DNA ligase Aliivibrio fischeri (strain MJ11)
A9BJX5 3.91e-32 134 25 21 520 3 ligA DNA ligase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q3Z8W1 1.02e-31 133 28 13 386 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q5E3L1 1.34e-31 133 27 10 389 3 ligA DNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q04GN6 1.53e-31 133 26 18 529 3 ligA DNA ligase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A7HJG6 2.22e-31 132 26 18 512 3 ligA DNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B9DMU3 3.69e-31 132 26 20 512 3 ligA DNA ligase Staphylococcus carnosus (strain TM300)
B6IRF1 3.87e-31 132 28 19 530 3 ligA DNA ligase Rhodospirillum centenum (strain ATCC 51521 / SW)
C3L496 4.02e-31 131 28 12 389 3 ligA DNA ligase Amoebophilus asiaticus (strain 5a2)
Q3ATX4 4.14e-31 131 26 15 526 3 ligA DNA ligase Chlorobium chlorochromatii (strain CaD3)
Q9ZHI0 4.47e-31 131 27 22 525 1 ligA DNA ligase Thermus filiformis
A4SG85 5.03e-31 131 26 20 525 3 ligA DNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
C0M6L2 5.14e-31 131 28 18 415 3 ligA DNA ligase Streptococcus equi subsp. equi (strain 4047)
B3PMJ0 5.56e-31 131 25 15 479 3 ligA DNA ligase Metamycoplasma arthritidis (strain 158L3-1)
A7MT54 6.4e-31 131 28 13 402 3 ligA DNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q0SMV7 6.72e-31 130 22 19 558 3 ligA DNA ligase Borreliella afzelii (strain PKo)
B9MIW4 8.29e-31 131 29 15 418 3 ligA DNA ligase Acidovorax ebreus (strain TPSY)
Q1LU20 9.28e-31 130 25 16 521 3 ligA DNA ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q2GDR2 9.42e-31 130 28 12 379 3 ligA DNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q1WSH6 1.03e-30 130 29 15 408 3 ligA DNA ligase Ligilactobacillus salivarius (strain UCC118)
B6EJQ6 1.05e-30 130 26 13 420 3 ligA DNA ligase Aliivibrio salmonicida (strain LFI1238)
Q9KF37 1.11e-30 130 25 21 516 3 ligA DNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5FRL4 1.38e-30 130 27 18 431 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B4U2C7 1.44e-30 130 28 18 415 3 ligA DNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A1W7N4 1.71e-30 130 29 14 395 3 ligA DNA ligase Acidovorax sp. (strain JS42)
Q5UY84 2.08e-30 129 24 14 511 3 ligA DNA ligase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P78021 2.1e-30 129 24 19 518 3 ligA DNA ligase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9KTD1 2.26e-30 129 25 16 512 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B7GFV1 2.75e-30 129 25 19 514 3 ligA DNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q8D2B9 2.93e-30 128 24 13 428 3 ligA DNA ligase Wigglesworthia glossinidia brevipalpis
C3LTL9 3.12e-30 129 25 16 512 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain M66-2)
A5F2W3 3.12e-30 129 25 16 512 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P26996 4.75e-30 128 26 22 534 1 ligA DNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q3ZX08 4.82e-30 128 27 14 390 3 ligA DNA ligase Dehalococcoides mccartyi (strain CBDB1)
B2KE31 5.42e-30 128 27 11 384 3 ligA DNA ligase Elusimicrobium minutum (strain Pei191)
Q21JI8 5.93e-30 128 25 18 517 3 ligA DNA ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q041K2 7.7e-30 127 25 18 513 3 ligA DNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A0KHL9 8.44e-30 127 26 18 510 3 ligA DNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q74I49 9e-30 127 25 14 474 3 ligA DNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2NSC2 9.69e-30 127 25 20 528 3 ligA DNA ligase Sodalis glossinidius (strain morsitans)
Q180F3 9.72e-30 127 25 13 393 3 ligA DNA ligase Clostridioides difficile (strain 630)
Q6YQD6 1.1e-29 127 26 21 517 3 ligA DNA ligase Onion yellows phytoplasma (strain OY-M)
Q72JN8 1.25e-29 127 26 21 529 3 ligA DNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q11VI1 1.27e-29 127 27 10 385 3 ligA DNA ligase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q5HEL8 1.6e-29 127 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain COL)
A8YTZ3 1.63e-29 127 28 13 391 3 ligA DNA ligase Lactobacillus helveticus (strain DPC 4571)
A9NHW0 1.68e-29 126 26 15 431 3 ligA DNA ligase Acholeplasma laidlawii (strain PG-8A)
Q6GFF3 1.73e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain MRSA252)
Q7A4Q5 1.99e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain N315)
Q99SY3 1.99e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IU71 1.99e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain JH9)
A6U309 1.99e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain JH1)
A7X432 1.99e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q604U8 2.07e-29 126 25 19 515 3 ligA DNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B7VIK3 2.18e-29 126 23 14 514 3 ligA DNA ligase Vibrio atlanticus (strain LGP32)
Q7A0H1 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain MW2)
Q9AIU7 2.26e-29 126 26 19 511 1 ligA DNA ligase Staphylococcus aureus
A8Z2R8 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G829 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain MSSA476)
A6QID2 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain Newman)
Q2G1Y0 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFJ1 2.26e-29 126 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain USA300)
Q49YU8 2.38e-29 126 25 19 513 3 ligA DNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2JW63 2.53e-29 126 24 17 521 3 ligA DNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q4FPL3 2.53e-29 126 26 9 367 3 ligA DNA ligase Pelagibacter ubique (strain HTCC1062)
C1CVC7 2.62e-29 126 26 17 513 3 ligA2 DNA ligase 2 Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q2YU70 3.14e-29 125 26 19 511 3 ligA DNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B5RMA6 3.37e-29 125 23 16 507 3 ligA DNA ligase Borrelia duttonii (strain Ly)
Q87RJ4 3.47e-29 125 27 13 414 3 ligA DNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2G7J5 3.91e-29 125 26 11 399 3 ligA DNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B5Y6V5 4.15e-29 125 24 18 518 3 ligA DNA ligase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
B2S0Q2 5.31e-29 125 26 11 387 3 ligA DNA ligase Borrelia hermsii (strain HS1 / DAH)
A0LI67 5.48e-29 125 25 21 536 3 ligA DNA ligase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q5HN30 5.95e-29 125 25 20 530 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CRU0 6.4e-29 125 25 20 530 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B5RPQ2 6.5e-29 125 23 17 507 3 ligA DNA ligase Borrelia recurrentis (strain A1)
D4GY98 7.34e-29 125 27 21 508 1 ligN DNA ligase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
B4EZR2 7.81e-29 124 25 21 513 3 ligA DNA ligase Proteus mirabilis (strain HI4320)
Q3B278 7.94e-29 124 28 15 421 3 ligA DNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q9PR23 9.31e-29 124 22 15 517 3 ligA DNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIB0 9.31e-29 124 22 15 517 3 ligA DNA ligase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
B2GDS9 9.33e-29 124 28 10 387 3 ligA DNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q5FLL4 9.58e-29 124 27 11 390 3 ligA DNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
C1DN27 9.59e-29 125 26 18 537 3 ligA DNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q83DZ6 9.66e-29 124 27 13 390 3 ligA DNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q6LTU5 9.84e-29 124 27 10 383 3 ligA DNA ligase Photobacterium profundum (strain SS9)
Q660X2 1.09e-28 124 22 18 559 3 ligA DNA ligase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
O51502 1.12e-28 124 25 11 385 3 ligA DNA ligase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q03YP0 1.13e-28 124 26 20 520 3 ligA DNA ligase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B6J878 1.15e-28 124 27 13 390 3 ligA DNA ligase Coxiella burnetii (strain CbuK_Q154)
C3PFU5 1.17e-28 124 28 24 534 3 ligA DNA ligase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q0AAV2 1.26e-28 124 27 19 529 3 ligA DNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B6J1C6 1.26e-28 124 26 13 395 3 ligA DNA ligase Coxiella burnetii (strain CbuG_Q212)
B3PGQ8 1.38e-28 124 26 18 519 3 ligA DNA ligase Cellvibrio japonicus (strain Ueda107)
B7J2B3 1.58e-28 124 25 11 385 3 ligA DNA ligase Borreliella burgdorferi (strain ZS7)
Q822R2 1.62e-28 124 26 18 503 3 ligA DNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A9KCS0 1.68e-28 124 26 13 395 3 ligA DNA ligase Coxiella burnetii (strain Dugway 5J108-111)
A9BZW4 1.84e-28 124 29 18 419 3 ligA DNA ligase Delftia acidovorans (strain DSM 14801 / SPH-1)
A9NC33 1.98e-28 123 27 13 390 3 ligA DNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
Q5LCI0 2.19e-28 123 26 15 413 3 ligA DNA ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B0TDL0 2.2e-28 123 27 12 402 3 ligA DNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q64TM7 2.4e-28 123 26 15 413 3 ligA DNA ligase Bacteroides fragilis (strain YCH46)
A5IFV1 2.58e-28 123 25 19 516 3 ligA DNA ligase Legionella pneumophila (strain Corby)
Q2NJF5 2.68e-28 123 26 22 534 3 ligA DNA ligase Aster yellows witches'-broom phytoplasma (strain AYWB)
Q3AD38 3.41e-28 122 27 13 394 3 ligA DNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8E5W1 3.51e-28 122 26 19 533 3 ligA DNA ligase Streptococcus agalactiae serotype III (strain NEM316)
B7IDX6 3.58e-28 122 23 15 506 3 ligA DNA ligase Thermosipho africanus (strain TCF52B)
B5ZAV3 3.68e-28 122 25 10 380 3 ligA DNA ligase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A8ETQ3 4.27e-28 122 25 17 422 3 ligA DNA ligase Aliarcobacter butzleri (strain RM4018)
Q0BV35 4.52e-28 122 25 18 530 3 ligA DNA ligase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q04W02 4.6e-28 122 23 16 516 3 ligA DNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q8A9C1 4.72e-28 122 26 13 382 3 ligA DNA ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9CIE4 4.78e-28 122 25 18 518 3 ligA DNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q74ER9 4.87e-28 122 26 18 519 3 ligA DNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0C308 4.9e-28 122 27 17 492 3 ligA DNA ligase Acaryochloris marina (strain MBIC 11017)
Q04XH0 4.9e-28 122 23 16 516 3 ligA DNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q058C9 4.93e-28 122 24 20 533 3 ligA DNA ligase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
B0KPX3 5.49e-28 122 24 18 540 3 ligA DNA ligase Pseudomonas putida (strain GB-1)
B1ZMR3 5.53e-28 122 28 14 410 3 ligA2 DNA ligase 2 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A9H0L6 5.9e-28 122 26 15 428 3 ligA DNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A1WRA7 6.42e-28 122 25 16 525 3 ligA DNA ligase Verminephrobacter eiseniae (strain EF01-2)
Q9RSQ5 6.55e-28 122 25 19 529 1 ligA DNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q92GM7 7.28e-28 122 25 19 531 3 ligA DNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6NHQ4 7.76e-28 121 27 20 476 3 ligA DNA ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A6LN55 8.25e-28 121 24 19 515 3 ligA DNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B9MK54 8.63e-28 121 26 15 399 3 ligA DNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9DRS2 9.22e-28 121 26 11 381 3 ligA DNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q3K1K8 9.22e-28 121 25 19 532 3 ligA DNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E084 9.39e-28 121 25 19 532 3 ligA DNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A8F541 1.07e-27 121 26 17 516 3 ligA DNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A4XK85 1.1e-27 121 27 13 381 3 ligA DNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q38VC5 1.3e-27 121 25 21 516 3 ligA DNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
B1ZWH2 1.35e-27 121 27 14 395 3 ligA1 DNA ligase 1 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q2LTN8 1.42e-27 120 28 13 391 3 ligA DNA ligase Syntrophus aciditrophicus (strain SB)
P49422 1.57e-27 120 25 20 524 1 ligA DNA ligase Thermus scotoductus
Q1ICK0 1.58e-27 121 23 16 539 3 ligA DNA ligase Pseudomonas entomophila (strain L48)
B4S4Y6 1.71e-27 120 26 20 526 3 ligA DNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A8GTF2 1.82e-27 120 25 19 531 3 ligA DNA ligase Rickettsia rickettsii (strain Sheila Smith)
B0BUZ1 1.82e-27 120 25 19 531 3 ligA DNA ligase Rickettsia rickettsii (strain Iowa)
Q5X6E6 2.04e-27 120 26 21 518 3 ligA DNA ligase Legionella pneumophila (strain Paris)
Q39S28 2.05e-27 120 25 18 525 3 ligA DNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8ETN6 2.16e-27 120 25 21 537 3 ligA DNA ligase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q2KUU5 2.23e-27 120 25 18 541 3 ligA DNA ligase Bordetella avium (strain 197N)
B3EFT6 2.38e-27 120 26 20 535 3 ligA DNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A1WY80 2.41e-27 120 26 20 523 3 ligA DNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
B9LU22 2.65e-27 120 25 17 524 3 ligA DNA ligase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q8KF74 2.69e-27 120 27 13 418 3 ligA DNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q89B02 2.69e-27 120 24 18 524 3 ligA DNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B1LA51 2.79e-27 120 25 18 521 3 ligA DNA ligase Thermotoga sp. (strain RQ2)
A5IKX0 2.79e-27 120 25 18 521 3 ligA DNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
C1C7B1 3.35e-27 119 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain 70585)
Q5HAI7 3.75e-27 119 26 14 411 3 ligA DNA ligase Ehrlichia ruminantium (strain Welgevonden)
Q46IA9 3.85e-27 119 24 19 527 3 ligA DNA ligase Prochlorococcus marinus (strain NATL2A)
Q5FG20 4.58e-27 119 26 14 411 3 ligA DNA ligase Ehrlichia ruminantium (strain Gardel)
B1MXQ8 4.59e-27 119 28 13 390 3 ligA DNA ligase Leuconostoc citreum (strain KM20)
Q2K6D3 4.59e-27 119 25 13 405 3 ligA DNA ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A4VVK7 4.6e-27 119 25 16 454 3 ligA DNA ligase Streptococcus suis (strain 05ZYH33)
A4W1W6 4.85e-27 119 25 16 454 3 ligA DNA ligase Streptococcus suis (strain 98HAH33)
C0R399 5.2e-27 119 26 9 377 3 ligA DNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
C4K0T1 5.47e-27 119 25 19 531 3 ligA DNA ligase Rickettsia peacockii (strain Rustic)
A4TMG4 7.05e-27 119 26 20 518 3 ligA DNA ligase Yersinia pestis (strain Pestoides F)
Q1CJV7 7.05e-27 119 26 20 518 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH0 7.05e-27 119 26 20 518 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q7CJF3 7.05e-27 119 26 20 518 3 ligA DNA ligase Yersinia pestis
Q1C5X9 7.05e-27 119 26 20 518 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8FPZ7 7.09e-27 119 27 21 512 3 ligA DNA ligase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5H057 7.17e-27 119 25 15 493 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P334 7.3e-27 119 25 14 493 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4QDK5 7.32e-27 119 27 21 513 3 ligA DNA ligase Corynebacterium glutamicum (strain R)
A3QFJ5 7.36e-27 119 24 18 518 3 ligA DNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8NR20 7.45e-27 119 27 21 513 3 ligA DNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A5W0U0 7.59e-27 119 24 15 528 3 ligA DNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q73H01 8.47e-27 118 25 9 377 3 ligA DNA ligase Wolbachia pipientis wMel
A1TZT9 8.8e-27 118 25 18 514 3 ligA DNA ligase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TR21 9.29e-27 118 29 13 392 3 ligA DNA ligase Paracidovorax citrulli (strain AAC00-1)
B8GTL0 9.73e-27 118 29 14 389 3 ligA DNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A6L5G8 1.03e-26 118 25 12 382 3 ligA DNA ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q3IKB8 1.04e-26 118 23 17 518 3 ligA DNA ligase Pseudoalteromonas translucida (strain TAC 125)
A8F2K5 1.12e-26 118 24 17 528 3 ligA DNA ligase Rickettsia massiliae (strain Mtu5)
Q031P9 1.13e-26 118 27 12 388 3 ligA DNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
Q668M6 1.15e-26 118 26 20 518 3 ligA DNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K917 1.15e-26 118 26 20 518 3 ligA DNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q2SD47 1.18e-26 118 24 17 518 3 ligA DNA ligase Hahella chejuensis (strain KCTC 2396)
Q5WXV3 1.2e-26 118 25 20 518 3 ligA DNA ligase Legionella pneumophila (strain Lens)
B1JFZ0 1.2e-26 118 26 20 518 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FGC2 1.2e-26 118 26 20 518 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JC06 1.24e-26 118 23 14 529 3 ligA DNA ligase Pseudomonas putida (strain W619)
Q0AZZ5 1.27e-26 118 24 20 517 3 ligA DNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A5EVZ5 1.31e-26 118 23 15 515 3 ligA DNA ligase Dichelobacter nodosus (strain VCS1703A)
Q2RGY0 1.5e-26 117 25 20 519 3 ligA DNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5XCY8 1.55e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q48UE1 1.57e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
B5XKP3 1.6e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q5ZWX6 1.71e-26 117 25 19 516 3 ligA DNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C3PLJ2 1.72e-26 117 25 19 531 3 ligA DNA ligase Rickettsia africae (strain ESF-5)
A2RFD0 1.72e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JHP3 1.72e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P1L1 1.72e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8DPS9 1.82e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KH2 1.82e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2IPZ1 1.87e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain CGSP14)
Q9PKP2 1.97e-26 117 24 18 504 3 ligA DNA ligase Chlamydia muridarum (strain MoPn / Nigg)
Q1J7G9 1.99e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M4 (strain MGAS10750)
C1CRL7 2.01e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B5E4M9 2.01e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
C1CKI0 2.03e-26 117 24 17 505 1 ligA DNA ligase Streptococcus pneumoniae (strain P1031)
Q97QT2 2.08e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8CXK6 2.16e-26 117 26 14 389 3 ligA DNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0DA73 2.18e-26 117 27 12 380 3 ligA DNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA72 2.18e-26 117 27 12 380 3 ligA DNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B1MDV2 2.41e-26 117 29 14 386 3 ligA DNA ligase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q9A0J5 2.61e-26 117 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M1
B7MY64 2.74e-26 117 26 17 519 3 ligA DNA ligase Escherichia coli O81 (strain ED1a)
Q88F25 2.79e-26 117 23 14 528 3 ligA DNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1BDQ5 2.83e-26 117 25 19 530 3 ligA DNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B1IBQ3 2.94e-26 117 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
Q0AHH6 3.64e-26 116 26 19 520 3 ligA DNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2G8T9 3.78e-26 116 25 19 517 3 ligA DNA ligase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VLG6 3.78e-26 116 25 19 517 3 ligA DNA ligase Limosilactobacillus reuteri (strain DSM 20016)
Q31Y68 3.86e-26 116 26 17 519 3 ligA DNA ligase Shigella boydii serotype 4 (strain Sb227)
B5YZV8 3.97e-26 116 28 15 419 3 ligA DNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBL5 3.97e-26 116 28 15 419 3 ligA DNA ligase Escherichia coli O157:H7
B9E830 4.02e-26 116 27 15 401 3 ligA DNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q2S459 4.2e-26 116 25 18 508 3 ligA DNA ligase Salinibacter ruber (strain DSM 13855 / M31)
B4RFE9 4.5e-26 116 30 21 431 3 ligA DNA ligase Phenylobacterium zucineum (strain HLK1)
Q83K81 4.79e-26 116 26 17 519 3 ligA DNA ligase Shigella flexneri
Q0T298 4.79e-26 116 26 17 519 3 ligA DNA ligase Shigella flexneri serotype 5b (strain 8401)
C1CEA4 4.87e-26 116 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain JJA)
B8ZPV9 4.87e-26 116 24 17 505 3 ligA DNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B9JY41 4.9e-26 116 26 16 433 3 ligA DNA ligase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8DT49 5.05e-26 116 26 13 382 3 ligA DNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A2C5E6 5.12e-26 116 24 19 527 3 ligA DNA ligase Prochlorococcus marinus (strain NATL1A)
Q7NR81 5.3e-26 116 29 16 407 3 ligA DNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A2RIF3 5.55e-26 116 27 12 388 3 ligA DNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
B3PTU7 5.6e-26 116 25 13 405 3 ligA DNA ligase Rhizobium etli (strain CIAT 652)
B5ZWH9 5.75e-26 116 25 13 410 3 ligA DNA ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A9L5Z1 5.84e-26 116 25 14 399 3 ligA DNA ligase Shewanella baltica (strain OS195)
B3CPS1 6.2e-26 115 26 9 372 3 ligA DNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q2JLU3 6.3e-26 115 24 18 528 3 ligA DNA ligase Synechococcus sp. (strain JA-2-3B'a(2-13))
A8EZT5 6.57e-26 115 24 20 534 3 ligA DNA ligase Rickettsia canadensis (strain McKiel)
Q1JMJ7 6.68e-26 115 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCM1 6.68e-26 115 27 13 380 3 ligA DNA ligase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q3YZD1 6.69e-26 115 26 17 519 3 ligA DNA ligase Shigella sonnei (strain Ss046)
C1D1Y6 6.95e-26 115 24 13 475 3 ligA1 DNA ligase 1 Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
A8GHF2 7.16e-26 115 28 13 387 3 ligA DNA ligase Serratia proteamaculans (strain 568)
P15042 7.32e-26 115 26 17 519 1 ligA DNA ligase Escherichia coli (strain K12)
B1IX60 7.32e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA82 7.32e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain K12 / DH10B)
B7UGB2 7.38e-26 115 28 15 419 3 ligA DNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q88XQ0 7.41e-26 115 27 10 386 3 ligA DNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B6I4Y8 7.52e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain SE11)
B7M6S1 7.52e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli O8 (strain IAI1)
B7LCF6 7.52e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain 55989 / EAEC)
A7ZPL2 7.52e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
A7Z261 7.54e-26 115 27 14 418 3 ligA DNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A5WCN7 7.67e-26 115 25 21 537 3 ligA DNA ligase Psychrobacter sp. (strain PRwf-1)
Q9WXV5 7.92e-26 115 24 17 520 3 ligA DNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B9K734 8.23e-26 115 24 19 520 3 ligA DNA ligase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B2VE40 8.58e-26 115 27 15 418 3 ligA DNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q4UN15 8.61e-26 115 23 17 517 3 ligA DNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7MV47 8.64e-26 115 24 18 521 3 ligA DNA ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A8AY10 8.84e-26 115 24 15 449 3 ligA DNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q5L5Q2 8.89e-26 115 24 13 501 3 ligA DNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
Q1R8W1 9.42e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain UTI89 / UPEC)
A1ADS8 9.42e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli O1:K1 / APEC
B7MHR5 9.42e-26 115 26 17 519 3 ligA DNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q080K9 9.73e-26 115 27 17 394 3 ligA DNA ligase Shewanella frigidimarina (strain NCIMB 400)
A6WPS5 9.76e-26 115 25 15 406 3 ligA DNA ligase Shewanella baltica (strain OS185)
Q0TF55 1.02e-25 115 26 17 519 3 ligA DNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LMK5 1.03e-25 115 26 17 519 3 ligA DNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FFC1 1.03e-25 115 26 17 519 3 ligA DNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A2Q7 1.03e-25 115 26 17 519 3 ligA DNA ligase Escherichia coli O9:H4 (strain HS)
Q3JAI1 1.03e-25 115 25 21 521 3 ligA DNA ligase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q98KC4 1.09e-25 115 25 16 437 3 ligA DNA ligase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8EEK5 1.15e-25 115 25 14 399 3 ligA DNA ligase Shewanella baltica (strain OS223)
B7NPU7 1.16e-25 115 26 17 519 3 ligA DNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A6W7L4 1.17e-25 115 29 11 364 3 ligA DNA ligase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B7LL73 1.17e-25 115 26 17 519 3 ligA DNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1HTW6 1.19e-25 115 28 14 403 3 ligA DNA ligase Lysinibacillus sphaericus (strain C3-41)
Q3YRC1 1.2e-25 115 22 13 513 3 ligA DNA ligase Ehrlichia canis (strain Jake)
Q72MA6 1.2e-25 115 24 18 513 3 ligA DNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8EYU4 1.21e-25 115 24 18 513 3 ligA DNA ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q837V6 1.33e-25 115 24 14 516 1 ligA DNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
A3DE88 1.41e-25 114 27 14 401 3 ligA DNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A1JLA4 1.52e-25 114 26 20 518 3 ligA DNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B9LHI6 1.54e-25 114 26 20 525 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WCA1 1.54e-25 114 26 20 525 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A6TC47 1.56e-25 114 28 15 418 3 ligA DNA ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A6Q433 1.6e-25 114 25 13 394 3 ligA DNA ligase Nitratiruptor sp. (strain SB155-2)
Q87A88 1.61e-25 115 26 13 476 3 ligA DNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9S4 1.61e-25 115 26 13 476 3 ligA DNA ligase Xylella fastidiosa (strain M23)
B7N602 1.71e-25 114 26 17 519 3 ligA DNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B8F314 1.82e-25 114 25 13 428 3 ligA DNA ligase Glaesserella parasuis serovar 5 (strain SH0165)
B0BBD3 1.93e-25 114 24 15 502 3 ligA DNA ligase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9Q4 1.93e-25 114 24 15 502 3 ligA DNA ligase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B2RKL2 2.07e-25 114 24 18 521 3 ligA DNA ligase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q5WJ30 2.12e-25 114 26 17 405 3 ligA DNA ligase Shouchella clausii (strain KSM-K16)
A0KVI4 2.23e-25 114 25 14 413 3 ligA DNA ligase Shewanella sp. (strain ANA-3)
B3QLI5 2.51e-25 114 25 15 522 3 ligA DNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A9II69 3.25e-25 114 24 17 544 3 ligA DNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
O31498 3.35e-25 113 27 13 402 3 ligA DNA ligase Bacillus subtilis (strain 168)
Q21WC8 3.38e-25 114 27 13 404 3 ligA DNA ligase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B4SP88 3.41e-25 114 26 20 492 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
B8D8M5 3.6e-25 113 23 15 535 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q83HX4 3.62e-25 113 25 13 408 3 ligA DNA ligase Tropheryma whipplei (strain TW08/27)
A4VKN0 3.77e-25 114 24 17 546 3 ligA DNA ligase Stutzerimonas stutzeri (strain A1501)
O66880 3.83e-25 113 26 14 403 3 ligA DNA ligase Aquifex aeolicus (strain VF5)
A2SGT2 3.85e-25 113 25 20 526 3 ligA DNA ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q5GS88 4.24e-25 113 24 14 460 3 ligA DNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q9CKA9 4.29e-25 113 23 14 514 3 ligA DNA ligase Pasteurella multocida (strain Pm70)
Q83G99 4.67e-25 113 25 13 408 3 ligA DNA ligase Tropheryma whipplei (strain Twist)
B5EIJ0 5.44e-25 113 25 20 515 3 ligA DNA ligase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q82TW6 5.52e-25 113 27 22 522 3 ligA DNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B8HIQ9 5.57e-25 113 25 19 472 3 ligA2 DNA ligase 2 Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q0HK31 5.66e-25 113 25 14 413 3 ligA DNA ligase Shewanella sp. (strain MR-4)
A6LA55 6.11e-25 112 25 13 417 3 ligA DNA ligase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B5XVT4 6.22e-25 112 27 15 418 3 ligA DNA ligase Klebsiella pneumoniae (strain 342)
Q2GHG1 6.24e-25 112 24 10 386 3 ligA DNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C0Z4D6 6.5e-25 112 28 15 414 3 ligA DNA ligase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q5PBN8 6.59e-25 112 25 19 489 3 ligA DNA ligase Anaplasma marginale (strain St. Maries)
Q8XZJ7 6.65e-25 113 27 16 436 3 ligA DNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C0QJ86 6.66e-25 112 24 19 586 3 ligA DNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B2UL69 6.97e-25 113 27 13 390 3 ligA DNA ligase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A5N2X7 7.56e-25 112 27 15 393 3 ligA DNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DWM9 7.56e-25 112 27 15 393 3 ligA DNA ligase Clostridium kluyveri (strain NBRC 12016)
Q3A2F5 8.14e-25 112 27 11 398 3 ligA DNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q0HWD2 8.17e-25 112 25 13 409 3 ligA DNA ligase Shewanella sp. (strain MR-7)
A8H376 8.37e-25 112 24 21 526 3 ligA DNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
P57172 9.23e-25 112 23 15 535 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A7MKW4 9.5e-25 112 26 20 521 3 ligA DNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
A6Q7G2 9.58e-25 112 26 15 406 3 ligA DNA ligase Sulfurovum sp. (strain NBC37-1)
B8D6X9 9.68e-25 112 23 15 535 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A8GPM9 9.71e-25 112 23 17 528 3 ligA DNA ligase Rickettsia akari (strain Hartford)
B8D122 1.03e-24 112 25 12 391 3 ligA DNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A9CIB3 1.11e-24 112 25 15 408 3 ligA DNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
B0U5G7 1.11e-24 112 25 13 476 3 ligA DNA ligase Xylella fastidiosa (strain M12)
P49421 1.15e-24 112 26 24 533 1 ligA DNA ligase Rhodothermus marinus
B1I551 1.19e-24 112 28 12 389 3 ligA DNA ligase Desulforudis audaxviator (strain MP104C)
A6W0S9 1.28e-24 112 27 14 400 3 ligA DNA ligase Marinomonas sp. (strain MWYL1)
Q8RC42 1.41e-24 111 26 14 383 3 ligA DNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0TKB2 1.46e-24 111 23 16 517 3 ligA DNA ligase Shewanella halifaxensis (strain HAW-EB4)
B0K3S1 1.48e-24 111 27 13 373 3 ligA DNA ligase Thermoanaerobacter sp. (strain X514)
B7KU78 1.51e-24 112 26 15 445 3 ligA DNA ligase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q7NAF8 1.57e-24 111 24 11 377 3 ligA DNA ligase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A9MIG0 1.67e-24 111 28 14 398 3 ligA DNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O84148 1.69e-24 111 24 15 502 3 ligA DNA ligase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0USD9 1.84e-24 111 23 13 514 3 ligA DNA ligase Histophilus somni (strain 2336)
Q15UZ1 1.88e-24 111 22 14 507 3 ligA DNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1D0P7 1.93e-24 111 28 17 397 3 ligA DNA ligase Myxococcus xanthus (strain DK1622)
O87703 1.97e-24 111 25 19 515 1 ligA DNA ligase Geobacillus stearothermophilus
A1RII7 2.06e-24 111 25 14 400 3 ligA DNA ligase Shewanella sp. (strain W3-18-1)
B9KHN8 2.08e-24 111 25 19 489 3 ligA DNA ligase Anaplasma marginale (strain Florida)
Q32DE2 2.11e-24 111 25 17 519 3 ligA DNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q2RVV5 2.14e-24 111 27 15 408 3 ligA DNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B0KBN6 2.17e-24 111 27 13 373 3 ligA DNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8ED70 2.44e-24 111 25 16 416 3 ligA DNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9VWA4 2.49e-24 111 26 15 440 3 ligA DNA ligase Methylorubrum extorquens (strain PA1)
B5F0F5 2.52e-24 110 28 14 398 3 ligA DNA ligase Salmonella agona (strain SL483)
B5YIF8 2.56e-24 110 25 18 515 3 ligA DNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q3ITK1 2.66e-24 110 24 19 517 3 ligA DNA ligase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q98QH2 2.83e-24 110 25 14 432 3 ligA DNA ligase Mycoplasmopsis pulmonis (strain UAB CTIP)
B4SZU5 2.99e-24 110 28 14 398 3 ligA DNA ligase Salmonella newport (strain SL254)
B4TCF6 2.99e-24 110 28 14 398 3 ligA DNA ligase Salmonella heidelberg (strain SL476)
Q0AMX9 2.99e-24 110 27 16 430 3 ligA DNA ligase Maricaulis maris (strain MCS10)
A1UTB5 3.14e-24 110 26 17 415 3 ligA DNA ligase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
C3MEL9 3.17e-24 110 25 13 408 3 ligA DNA ligase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
C0PZB4 3.18e-24 110 28 14 398 3 ligA DNA ligase Salmonella paratyphi C (strain RKS4594)
B5R3V4 3.24e-24 110 28 14 398 3 ligA DNA ligase Salmonella enteritidis PT4 (strain P125109)
B1YJ17 3.27e-24 110 24 19 510 3 ligA DNA ligase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q57LT1 3.32e-24 110 28 14 398 3 ligA DNA ligase Salmonella choleraesuis (strain SC-B67)
A4Y802 3.49e-24 110 24 13 400 3 ligA DNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B5FQB9 3.84e-24 110 28 14 398 3 ligA DNA ligase Salmonella dublin (strain CT_02021853)
Q6FZ81 3.91e-24 110 25 13 410 3 ligA DNA ligase Bartonella quintana (strain Toulouse)
Q89FV8 3.96e-24 110 24 17 465 3 ligA DNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3KMM3 4.01e-24 110 24 15 502 3 ligA DNA ligase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B5RCP9 4.05e-24 110 28 14 398 3 ligA DNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q9PAG2 4.11e-24 110 26 14 476 3 ligA DNA ligase Xylella fastidiosa (strain 9a5c)
Q7NMN8 4.51e-24 110 29 15 388 3 ligA DNA ligase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q30ZK6 4.8e-24 110 25 18 523 3 ligA DNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7MBH2 4.98e-24 110 27 15 402 3 ligA DNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B3QZS5 5.1e-24 110 25 14 382 3 ligA DNA ligase Phytoplasma mali (strain AT)
Q11GT5 5.28e-24 110 24 17 465 3 ligA DNA ligase Chelativorans sp. (strain BNC1)
Q01NV7 5.42e-24 110 25 12 382 3 ligA DNA ligase Solibacter usitatus (strain Ellin6076)
Q73EM3 5.51e-24 110 27 18 427 3 ligA DNA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
A5GA98 5.96e-24 109 25 17 521 3 ligA DNA ligase Geotalea uraniireducens (strain Rf4)
B3EM49 6.01e-24 109 26 10 409 3 ligA DNA ligase Chlorobium phaeobacteroides (strain BS1)
Q03JF6 6.04e-24 109 26 12 398 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q1MRS8 6.32e-24 109 25 11 392 3 ligA DNA ligase Lawsonia intracellularis (strain PHE/MN1-00)
Q4FUW9 7.17e-24 109 26 16 441 3 ligA DNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A6VR16 7.26e-24 109 25 13 397 3 ligA DNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q82JK7 7.64e-24 109 28 17 399 3 ligA DNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5L3B9 8.04e-24 109 25 18 514 3 ligA DNA ligase Geobacillus kaustophilus (strain HTA426)
A5CZ68 8.28e-24 109 29 9 297 3 ligA DNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q18E49 8.66e-24 109 24 19 533 3 ligA DNA ligase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B2V5U1 8.8e-24 109 24 13 463 3 ligA DNA ligase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q6D165 8.93e-24 109 27 14 392 3 ligA DNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1VG01 9.17e-24 109 27 13 376 3 ligA DNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A4IJY6 9.45e-24 109 24 15 511 3 ligA DNA ligase Geobacillus thermodenitrificans (strain NG80-2)
Q5M382 9.71e-24 108 26 12 398 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYL9 9.71e-24 108 26 12 398 3 ligA DNA ligase Streptococcus thermophilus (strain CNRZ 1066)
Q65MR2 9.81e-24 109 26 12 399 3 ligA DNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C3JXX6 9.99e-24 109 25 16 460 3 ligA DNA ligase Pseudomonas fluorescens (strain SBW25)
Q9I3I4 1.05e-23 109 25 17 462 3 ligA DNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ3 1.05e-23 109 25 17 462 3 ligA DNA ligase Pseudomonas aeruginosa (strain LESB58)
Q02K12 1.07e-23 109 25 17 462 3 ligA DNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
A4SKA6 1.09e-23 108 24 21 514 3 ligA DNA ligase Aeromonas salmonicida (strain A449)
B2FKJ1 1.15e-23 109 28 17 401 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
A0QUW7 1.21e-23 108 26 12 400 1 ligA DNA ligase A Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B9J1L6 1.24e-23 108 27 18 427 3 ligA DNA ligase Bacillus cereus (strain Q1)
B7HSW5 1.24e-23 108 27 18 427 3 ligA DNA ligase Bacillus cereus (strain AH187)
Q1QDW8 1.32e-23 108 27 15 431 3 ligA DNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4KFH1 1.42e-23 108 24 15 461 3 ligA DNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0I2H6 1.47e-23 108 23 13 514 3 ligA DNA ligase Histophilus somni (strain 129Pt)
B1XLV0 1.52e-23 108 24 17 531 3 ligA DNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14615
Feature type CDS
Gene ligB
Product NAD-dependent DNA ligase LigB
Location 155742 - 157433 (strand: 1)
Length 1692 (nucleotides) / 563 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_340
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01653 NAD-dependent DNA ligase adenylation domain
PF03120 NAD-dependent DNA ligase OB-fold domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0272 Replication, recombination and repair (L) L NAD-dependent DNA ligase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01972 DNA ligase (NAD+) [EC:6.5.1.2] DNA replication
Base excision repair
Nucleotide excision repair
Mismatch repair
-

Protein Sequence

MFRMKLLFIKRIFITGILSGGLFCAVAAFAGVKAQSGCPPHPVVQAETEVAELRKQLAHWDKRYYTQGVSEVSDETYDQMRARLVTLEQCYGQQTPVRLPSSVRYNLKHPVVHSGVRKAASDNAVEQWLRHRKNVWVQPKVDGVAVSLVYSHGKLTHMISRGDGRHGLDWTEKALHIPAIPQEITTELTDVILQGEIFLRREGHVQSRDGGKNLRSVTAGLLMRQANDEQLRALDVFIWAWPGGTTDMQHYLNTLTEWGFPLTAQYTKPVSGAESAAEQREAWYRQPLPFAGDGIVLKQMPPQDTSRWQTGHNHWSLAWKYPVQTAVTEVRHVQFPVGRTGRITVLLSVEPVIIDGKTIKRVAMGSLAVWMKQRIHPGDLIVVGLQGQGIPKVREVIRKTETPPELNVPGKADFHRTSCLTYTPLCRQQYLARLNWLGKQLGMTGTGVRNWGKLADHYTFSGLLDWMLLDEDQLKAALGKVRGVNFYRQGNAARQKSFSVWINALGVPGKSPLPADWSLFRQENRLKTERNHYAQALEAEGVVASLQLQGVDGFTGANPDSHN

Flanking regions ( +/- flanking 50bp)

AGTCTGTGGCTGTGTAATGTCCTGAATTCAGGCGGACAGGGAGTAATATAATGTTCAGGATGAAATTATTATTTATAAAACGCATTTTTATCACGGGTATCTTATCCGGCGGATTATTCTGTGCGGTAGCAGCGTTTGCCGGGGTGAAAGCACAGTCCGGATGCCCGCCACACCCGGTGGTACAGGCGGAAACAGAAGTGGCCGAACTACGTAAACAACTGGCTCACTGGGATAAACGTTATTATACACAAGGGGTAAGTGAGGTCAGTGATGAGACGTATGATCAGATGCGGGCAAGGCTGGTTACGCTTGAGCAGTGTTACGGACAGCAGACCCCGGTAAGATTGCCGTCTTCAGTACGCTACAACCTGAAGCACCCGGTGGTACATAGCGGCGTGCGTAAAGCGGCATCAGATAACGCGGTTGAACAATGGTTGCGTCACCGGAAAAATGTCTGGGTCCAGCCTAAAGTAGATGGTGTGGCGGTATCCCTGGTGTACAGCCACGGAAAGCTGACTCATATGATAAGCCGCGGAGACGGGCGTCACGGTCTTGACTGGACAGAGAAAGCTCTGCATATCCCTGCAATCCCGCAGGAAATTACAACAGAACTTACAGATGTTATTTTGCAGGGGGAAATTTTTCTGCGCCGGGAAGGTCATGTGCAGTCCCGTGACGGCGGGAAAAATCTCCGCTCAGTCACTGCCGGTCTGCTGATGAGGCAGGCAAATGACGAACAACTACGGGCGCTGGATGTCTTTATCTGGGCATGGCCGGGGGGTACAACAGATATGCAGCACTATCTGAATACCCTGACAGAATGGGGATTTCCGCTGACCGCACAATATACAAAGCCGGTTAGTGGCGCGGAAAGTGCCGCAGAGCAGCGGGAAGCCTGGTATCGCCAGCCGCTGCCGTTTGCCGGTGACGGTATTGTTCTCAAGCAAATGCCCCCGCAGGACACTTCCCGCTGGCAGACGGGGCATAACCACTGGTCACTGGCATGGAAATACCCGGTACAAACGGCAGTTACCGAAGTTCGGCATGTACAGTTTCCGGTCGGGCGGACAGGGCGGATCACGGTATTACTCTCTGTTGAGCCGGTTATTATTGACGGGAAAACAATTAAGCGGGTAGCTATGGGGTCGCTTGCGGTCTGGATGAAACAGCGCATTCATCCGGGAGATTTGATTGTGGTGGGATTGCAAGGACAGGGTATCCCGAAAGTGCGGGAGGTTATCCGGAAAACAGAAACACCACCGGAACTGAATGTACCCGGTAAAGCGGATTTTCACCGTACAAGCTGTCTGACATATACTCCGCTGTGTCGTCAGCAGTACCTGGCCCGCCTGAATTGGCTGGGAAAGCAGCTCGGAATGACCGGAACGGGTGTCCGCAACTGGGGAAAACTGGCGGATCACTATACCTTTTCCGGTCTGCTGGATTGGATGTTACTGGACGAAGATCAGCTTAAAGCCGCGTTAGGCAAAGTGAGAGGCGTGAATTTTTACCGGCAGGGTAATGCGGCACGACAGAAGTCATTTTCTGTCTGGATAAATGCGCTGGGTGTGCCGGGAAAGAGCCCGTTACCGGCTGACTGGTCGCTGTTCAGACAGGAAAACCGGCTGAAGACCGAACGCAACCACTATGCACAGGCGCTGGAAGCGGAAGGTGTGGTTGCGTCATTACAATTACAGGGTGTGGACGGATTTACCGGCGCTAATCCTGATTCTCATAATTAAAGACCGGCAGCCCCAGGCGGTAGCGGATAGCGATTAAGCGGGAACTGAGC