Homologs in group_1733

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12095 FBDBKF_12095 94.4 Morganella morganii S1 typA ribosome-dependent GTPase TypA
EHELCC_14210 EHELCC_14210 94.4 Morganella morganii S2 typA ribosome-dependent GTPase TypA
NLDBIP_15305 NLDBIP_15305 94.4 Morganella morganii S4 typA ribosome-dependent GTPase TypA
LHKJJB_15305 LHKJJB_15305 94.4 Morganella morganii S3 typA ribosome-dependent GTPase TypA
HKOGLL_14425 HKOGLL_14425 94.4 Morganella morganii S5 typA ribosome-dependent GTPase TypA
PMI_RS14240 PMI_RS14240 88.3 Proteus mirabilis HI4320 typA ribosome-dependent GTPase TypA

Distribution of the homologs in the orthogroup group_1733

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1733

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A3B4 0.0 1071 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Shigella flexneri
P0DTT0 0.0 1071 85 0 602 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli (strain K12)
P0A3B1 0.0 1071 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A3B3 0.0 1071 85 0 602 3 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O157:H7
P0A3B2 0.0 1071 85 0 602 1 bipA Large ribosomal subunit assembly factor BipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
H9L427 0.0 1068 85 0 603 1 bipA Large ribosomal subunit assembly factor BipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44910 0.0 991 77 1 605 1 bipA Large ribosomal subunit assembly factor BipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9C8 0.0 906 69 0 602 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57508 0.0 898 69 0 600 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AC9 0.0 851 67 1 597 3 bipA Large ribosomal subunit assembly factor BipA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O07631 0.0 666 53 0 594 2 bipA Large ribosomal subunit assembly factor BipA Bacillus subtilis (strain 168)
Q9ZLZ3 0.0 640 51 2 601 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain J99 / ATCC 700824)
O25225 0.0 640 51 2 601 3 bipA Large ribosomal subunit assembly factor BipA Helicobacter pylori (strain ATCC 700392 / 26695)
P72749 0.0 612 52 1 585 3 bipA Large ribosomal subunit assembly factor BipA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
F4K410 0.0 565 47 3 588 1 SVR3 Putative elongation factor TypA-like SVR3, chloroplastic Arabidopsis thaliana
A0L631 4.08e-52 191 30 17 510 3 lepA Elongation factor 4 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5SKA7 1.44e-49 185 32 16 485 1 lepA Elongation factor 4 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A4J7F8 5.78e-49 183 31 18 518 3 lepA Elongation factor 4 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6TSM4 1.32e-48 182 31 19 498 3 lepA Elongation factor 4 Alkaliphilus metalliredigens (strain QYMF)
B7KJX0 1.58e-48 182 30 19 536 3 lepA Elongation factor 4 Gloeothece citriformis (strain PCC 7424)
Q72KV2 2.11e-48 181 31 16 485 3 lepA Elongation factor 4 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q182F4 4.29e-48 181 30 17 496 3 lepA Elongation factor 4 Clostridioides difficile (strain 630)
B9GHA6 8.87e-48 181 30 16 505 3 POPTRDRAFT_815670 Translation factor GUF1 homolog, chloroplastic Populus trichocarpa
O28385 1.58e-47 181 29 16 467 3 fusA Elongation factor 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8YU48 1.63e-47 179 30 18 514 3 lepA Elongation factor 4 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8MFA6 2.37e-47 178 30 18 501 3 lepA Elongation factor 4 Alkaliphilus oremlandii (strain OhILAs)
Q3MG20 2.5e-47 178 30 17 514 3 lepA Elongation factor 4 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B1XK44 4.64e-47 177 30 17 506 3 lepA Elongation factor 4 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3AF13 5.79e-47 177 30 17 512 3 lepA Elongation factor 4 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9X1V8 7.4e-47 177 33 19 504 3 lepA Elongation factor 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A6Q241 9.57e-47 177 29 18 506 3 lepA Elongation factor 4 Nitratiruptor sp. (strain SB155-2)
Q2SXT6 1e-46 176 29 20 516 3 lepA Elongation factor 4 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2SZV7 1.01e-46 176 30 19 512 3 lepA Elongation factor 4 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q73HR8 2.06e-46 176 29 18 509 3 lepA Elongation factor 4 Wolbachia pipientis wMel
Q9HM85 3.5e-46 177 28 15 518 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R8C8 3.5e-46 177 28 15 518 3 fusA Elongation factor 2 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0C9R9 3.55e-46 175 30 18 519 3 lepA Elongation factor 4 Acaryochloris marina (strain MBIC 11017)
Q2JWR1 4.08e-46 175 31 16 477 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-3-3Ab)
A9RFQ5 4.73e-46 176 28 22 613 3 PHYPADRAFT_158777 Translation factor GUF1 homolog, chloroplastic Physcomitrium patens
Q63S94 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain K96243)
A3NBT1 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 668)
Q3JQ75 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1710b)
A3NXL8 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia pseudomallei (strain 1106a)
A1V6B9 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain SAVP1)
Q62LT1 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain ATCC 23344)
A2S9Z3 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10229)
A3MM44 4.95e-46 174 28 19 514 3 lepA Elongation factor 4 Burkholderia mallei (strain NCTC 10247)
C0R5S3 5.22e-46 174 29 18 509 3 lepA Elongation factor 4 Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B9MJZ5 6.02e-46 174 30 15 499 3 lepA Elongation factor 4 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A5B4D2 8.03e-46 175 30 16 515 3 VITISV_013255 Translation factor GUF1 homolog, chloroplastic Vitis vinifera
Q8RFD1 8.65e-46 174 29 16 497 3 lepA Elongation factor 4 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q13VM6 8.84e-46 174 30 19 517 3 lepA Elongation factor 4 Paraburkholderia xenovorans (strain LB400)
A4IR35 8.98e-46 174 30 19 509 3 lepA Elongation factor 4 Geobacillus thermodenitrificans (strain NG80-2)
Q30Q17 8.98e-46 174 29 19 506 3 lepA Elongation factor 4 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B0JQT7 1.2e-45 174 30 19 522 3 lepA Elongation factor 4 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
C1D7L2 1.39e-45 173 29 17 505 3 lepA Elongation factor 4 Laribacter hongkongensis (strain HLHK9)
Q97JJ6 1.53e-45 173 29 18 504 3 lepA Elongation factor 4 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5KWZ3 1.64e-45 173 30 19 509 3 lepA Elongation factor 4 Geobacillus kaustophilus (strain HTA426)
A4XKA0 1.94e-45 173 29 15 500 3 lepA Elongation factor 4 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q0SP76 2.03e-45 173 30 18 505 3 lepA Elongation factor 4 Borreliella afzelii (strain PKo)
B8I3E6 2.08e-45 173 31 20 503 3 lepA Elongation factor 4 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B2J0M4 2.7e-45 172 29 16 512 3 lepA Elongation factor 4 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
O27131 2.85e-45 174 27 16 503 3 fusA Elongation factor 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B1WWD8 2.92e-45 172 30 19 521 3 lepA Elongation factor 4 Crocosphaera subtropica (strain ATCC 51142 / BH68)
O51115 3.22e-45 172 29 18 505 3 lepA Elongation factor 4 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q4FUV9 3.32e-45 172 27 20 562 3 lepA Elongation factor 4 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7I1F0 3.36e-45 172 29 18 512 3 lepA Elongation factor 4 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P74751 4.4e-45 172 29 20 533 3 lepA Elongation factor 4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C5JRK2 4.5e-45 173 29 20 567 3 GUF1 Translation factor GUF1, mitochondrial Blastomyces gilchristii (strain SLH14081)
C5GRI9 4.5e-45 173 29 20 567 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586)
C4Z9E3 4.86e-45 172 28 20 552 3 lepA Elongation factor 4 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q0BH06 4.94e-45 172 28 20 514 3 lepA Elongation factor 4 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YVM2 4.94e-45 172 28 20 514 3 lepA Elongation factor 4 Burkholderia ambifaria (strain MC40-6)
Q1LTI1 5.45e-45 172 28 18 512 3 lepA Elongation factor 4 Baumannia cicadellinicola subsp. Homalodisca coagulata
Q1QDV6 6.86e-45 171 28 19 541 3 lepA Elongation factor 4 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q01SV7 7.58e-45 171 31 16 509 3 lepA Elongation factor 4 Solibacter usitatus (strain Ellin6076)
Q9FNM5 8.64e-45 172 30 19 517 1 At5g08650 Translation factor GUF1 homolog, chloroplastic Arabidopsis thaliana
Q8DM20 1.1e-44 171 30 18 520 3 lepA Elongation factor 4 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A7MH13 1.17e-44 171 28 16 505 3 lepA Elongation factor 4 Cronobacter sakazakii (strain ATCC BAA-894)
A0RQX4 1.18e-44 171 28 17 506 3 lepA Elongation factor 4 Campylobacter fetus subsp. fetus (strain 82-40)
B3ESU2 1.19e-44 171 29 17 507 3 lepA Elongation factor 4 Amoebophilus asiaticus (strain 5a2)
B8HLK8 1.2e-44 171 29 18 517 3 lepA Elongation factor 4 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A1AWP9 1.22e-44 171 28 18 509 3 lepA Elongation factor 4 Ruthia magnifica subsp. Calyptogena magnifica
Q3IUM4 1.29e-44 172 30 13 467 3 fusA Elongation factor 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q2RKX8 1.3e-44 171 29 16 511 3 lepA Elongation factor 4 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2Y873 1.4e-44 171 29 18 503 3 lepA Elongation factor 4 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q112D2 1.46e-44 171 29 16 517 3 lepA Elongation factor 4 Trichodesmium erythraeum (strain IMS101)
Q7NGX4 1.54e-44 171 31 15 502 3 lepA Elongation factor 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P56865 1.54e-44 170 28 16 508 3 lepA Elongation factor 4 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B0TAD2 1.64e-44 170 31 17 499 3 lepA Elongation factor 4 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
P60792 1.84e-44 170 28 16 526 3 lepA Elongation factor 4 Onion yellows phytoplasma (strain OY-M)
Q2NJE6 2.01e-44 170 28 16 536 3 lepA Elongation factor 4 Aster yellows witches'-broom phytoplasma (strain AYWB)
A2CBG9 2.06e-44 170 29 18 521 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9303)
Q0VP16 2.07e-44 170 29 18 525 3 lepA Elongation factor 4 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7U5L9 2.15e-44 170 29 18 520 3 lepA Elongation factor 4 Parasynechococcus marenigrum (strain WH8102)
A6SXR0 2.26e-44 170 28 16 507 3 lepA Elongation factor 4 Janthinobacterium sp. (strain Marseille)
Q7W5J4 2.31e-44 170 28 16 508 3 lepA Elongation factor 4 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD30 2.31e-44 170 28 16 508 3 lepA Elongation factor 4 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O25122 2.32e-44 170 28 18 504 3 lepA Elongation factor 4 Helicobacter pylori (strain ATCC 700392 / 26695)
Q1BXU3 2.57e-44 170 28 18 508 3 lepA Elongation factor 4 Burkholderia orbicola (strain AU 1054)
B1JYB1 2.57e-44 170 28 18 508 3 lepA Elongation factor 4 Burkholderia orbicola (strain MC0-3)
A0K5V7 2.57e-44 170 28 18 508 3 lepA Elongation factor 4 Burkholderia cenocepacia (strain HI2424)
Q5UZS7 2.64e-44 171 30 17 525 3 fusA Elongation factor 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5GRW9 3.14e-44 169 27 18 522 3 lepA Elongation factor 4 Wolbachia sp. subsp. Brugia malayi (strain TRS)
B3CPV1 3.36e-44 169 28 17 523 3 lepA Elongation factor 4 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q2GGA6 3.39e-44 169 30 17 504 3 lepA Elongation factor 4 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q9Z8I4 3.44e-44 169 28 18 515 3 lepA Elongation factor 4 Chlamydia pneumoniae
A9ADE0 3.84e-44 169 28 20 514 3 lepA Elongation factor 4 Burkholderia multivorans (strain ATCC 17616 / 249)
A3DF29 4.15e-44 169 29 17 480 3 lepA Elongation factor 4 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5WHG5 4.24e-44 169 29 17 502 3 lepA Elongation factor 4 Shouchella clausii (strain KSM-K16)
Q39I75 4.28e-44 169 28 19 514 3 lepA Elongation factor 4 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7V8S4 4.42e-44 169 29 18 521 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9313)
A6TCI3 5.18e-44 169 28 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9VHU6 5.31e-44 169 29 20 546 3 lepA Elongation factor 4 Bacillus mycoides (strain KBAB4)
B7HCU5 5.42e-44 169 29 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain B4264)
A5D3X6 5.55e-44 169 29 16 504 3 lepA Elongation factor 4 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q65H50 5.94e-44 169 29 17 509 3 lepA Elongation factor 4 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7K3Z7 6.02e-44 169 28 17 526 3 lepA Elongation factor 4 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q818E4 6.03e-44 169 29 21 547 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7VJZ1 6.04e-44 169 28 19 517 3 lepA Elongation factor 4 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2GJV7 6.35e-44 169 30 18 511 3 lepA Elongation factor 4 Anaplasma phagocytophilum (strain HZ)
A4WDE0 6.37e-44 169 28 16 506 3 lepA Elongation factor 4 Enterobacter sp. (strain 638)
A8FFD6 6.42e-44 169 29 19 509 3 lepA Elongation factor 4 Bacillus pumilus (strain SAFR-032)
Q11AY3 6.55e-44 169 29 21 514 3 lepA Elongation factor 4 Chelativorans sp. (strain BNC1)
Q3YYU7 6.95e-44 169 28 17 506 3 lepA Elongation factor 4 Shigella sonnei (strain Ss046)
O67618 7.18e-44 169 28 16 508 1 lepA Elongation factor 4 Aquifex aeolicus (strain VF5)
A7Z6W5 7.56e-44 169 28 16 507 3 lepA Elongation factor 4 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B9E6X5 7.77e-44 169 30 21 511 3 lepA Elongation factor 4 Macrococcus caseolyticus (strain JCSC5402)
Q2W0F9 8.23e-44 168 27 17 508 3 lepA Elongation factor 4 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A0Q1R8 8.26e-44 168 29 17 499 3 lepA Elongation factor 4 Clostridium novyi (strain NT)
Q2LTN3 9.02e-44 168 30 14 494 3 lepA Elongation factor 4 Syntrophus aciditrophicus (strain SB)
A4JCQ9 1.01e-43 168 28 20 516 3 lepA Elongation factor 4 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8RB72 1.02e-43 168 30 20 509 3 lepA Elongation factor 4 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1CLD7 1.03e-43 169 29 18 543 3 guf1 Translation factor guf1, mitochondrial Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
C4LBZ6 1.08e-43 168 28 18 515 3 lepA Elongation factor 4 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0K3Y4 1.12e-43 168 29 21 512 3 lepA Elongation factor 4 Thermoanaerobacter sp. (strain X514)
Q662S4 1.21e-43 168 29 18 505 3 lepA Elongation factor 4 Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q9KD76 1.3e-43 168 29 18 503 3 lepA Elongation factor 4 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7VL73 1.34e-43 168 28 18 506 3 lepA Elongation factor 4 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0AF67 1.37e-43 168 28 18 506 3 lepA Elongation factor 4 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q6HDK2 1.4e-43 168 29 20 546 3 lepA Elongation factor 4 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M2 1.4e-43 168 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain ZK / E33L)
C1ESL3 1.4e-43 168 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain 03BB102)
A0RIT7 1.4e-43 168 29 20 546 3 lepA Elongation factor 4 Bacillus thuringiensis (strain Al Hakam)
B7IYH2 1.41e-43 168 29 20 547 3 lepA Elongation factor 4 Bacillus cereus (strain G9842)
A7GHI0 1.43e-43 168 30 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM7 1.43e-43 168 30 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain Okra / Type B1)
Q2GD00 1.49e-43 167 30 17 500 3 lepA Elongation factor 4 Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B0KA85 1.57e-43 167 29 19 507 3 lepA Elongation factor 4 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A6RGX9 1.85e-43 168 28 19 568 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain NAm1 / WU24)
B3PLG4 1.87e-43 167 29 17 511 3 lepA Elongation factor 4 Cellvibrio japonicus (strain Ueda107)
C1FVU4 1.96e-43 167 30 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain Kyoto / Type A2)
B2JFK0 2.19e-43 167 29 19 512 3 lepA Elongation factor 4 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
C3L5S2 2.46e-43 167 29 20 546 3 lepA Elongation factor 4 Bacillus anthracis (strain CDC 684 / NRRL 3495)
A1U2V8 2.58e-43 167 29 18 481 3 lepA Elongation factor 4 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2JQ51 2.63e-43 167 30 19 483 3 lepA Elongation factor 4 Synechococcus sp. (strain JA-2-3B'a(2-13))
A0KGF0 2.66e-43 167 28 24 624 3 lepA Elongation factor 4 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A5I644 2.67e-43 167 30 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL9 2.67e-43 167 30 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain ATCC 19397 / Type A)
C0NZL9 2.69e-43 168 28 19 568 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432)
Q81LR7 2.9e-43 167 29 20 546 3 lepA Elongation factor 4 Bacillus anthracis
C3P8M5 2.9e-43 167 29 20 546 3 lepA Elongation factor 4 Bacillus anthracis (strain A0248)
C1GX39 3.11e-43 167 28 19 569 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
Q8DTF3 3.17e-43 167 29 18 504 3 lepA Elongation factor 4 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C6HPI9 3.3e-43 167 28 19 568 3 GUF1 Translation factor GUF1, mitochondrial Ajellomyces capsulatus (strain H143)
B1KI55 3.32e-43 167 28 17 506 3 lepA Elongation factor 4 Shewanella woodyi (strain ATCC 51908 / MS32)
A4Y4K2 3.7e-43 166 26 21 607 3 lepA Elongation factor 4 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C1F2I3 3.9e-43 166 31 15 479 3 lepA Elongation factor 4 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q1CUF5 4.03e-43 166 28 18 504 3 lepA Elongation factor 4 Helicobacter pylori (strain HPAG1)
A7ZCJ3 4.32e-43 166 27 18 556 3 lepA Elongation factor 4 Campylobacter concisus (strain 13826)
Q7MHN6 4.55e-43 166 28 18 510 3 lepA Elongation factor 4 Vibrio vulnificus (strain YJ016)
Q8DC78 4.55e-43 166 28 18 510 3 lepA Elongation factor 4 Vibrio vulnificus (strain CMCP6)
Q3ALG5 4.57e-43 166 29 18 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9605)
Q39US7 4.9e-43 166 28 21 533 3 lepA Elongation factor 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B7HPL8 4.96e-43 166 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain AH187)
B7JNV1 4.96e-43 166 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain AH820)
B9IY86 5.2e-43 166 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain Q1)
Q15R31 5.39e-43 166 27 19 565 3 lepA Elongation factor 4 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A9M3J8 5.42e-43 166 28 17 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C (strain 053442)
Q21IH3 5.56e-43 166 29 20 512 3 lepA Elongation factor 4 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1IV51 5.65e-43 166 30 14 474 3 lepA Elongation factor 4 Koribacter versatilis (strain Ellin345)
B7GKC4 5.69e-43 166 28 17 502 3 lepA Elongation factor 4 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B5XNG8 5.73e-43 166 28 15 505 3 lepA Elongation factor 4 Klebsiella pneumoniae (strain 342)
C3LR06 5.86e-43 166 28 17 512 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain M66-2)
Q9KPB0 5.86e-43 166 28 17 512 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5G3 5.86e-43 166 28 17 512 3 lepA Elongation factor 4 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q892Q6 6.24e-43 166 28 17 486 3 lepA Elongation factor 4 Clostridium tetani (strain Massachusetts / E88)
Q9K055 7.13e-43 166 28 17 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5NLP5 7.15e-43 166 29 19 525 3 lepA Elongation factor 4 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9JV65 7.2e-43 166 28 18 507 3 lepA Elongation factor 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
C6DZ67 7.24e-43 166 30 20 527 3 lepA Elongation factor 4 Geobacter sp. (strain M21)
B1KZP1 7.44e-43 166 29 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain Loch Maree / Type A3)
Q1GIV5 7.9e-43 166 30 19 512 3 lepA Elongation factor 4 Ruegeria sp. (strain TM1040)
A7GT14 8.24e-43 166 29 22 548 3 lepA Elongation factor 4 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9RHQ5 8.5e-43 167 29 16 505 3 RCOM_1767360 Translation factor GUF1 homolog, chloroplastic Ricinus communis
B2USI5 9.31e-43 166 28 19 506 3 lepA Elongation factor 4 Helicobacter pylori (strain Shi470)
A1KT27 9.64e-43 165 28 17 503 3 lepA Elongation factor 4 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B6JKS8 9.72e-43 165 28 19 504 3 lepA Elongation factor 4 Helicobacter pylori (strain P12)
B4RK41 1.02e-42 165 28 17 503 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain NCCP11945)
Q5F9P9 1.02e-42 165 28 17 503 3 lepA Elongation factor 4 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q2KWY3 1.13e-42 165 28 16 508 3 lepA Elongation factor 4 Bordetella avium (strain 197N)
P37949 1.17e-42 165 29 17 506 3 lepA Elongation factor 4 Bacillus subtilis (strain 168)
Q730L6 1.2e-42 165 29 20 546 3 lepA Elongation factor 4 Bacillus cereus (strain ATCC 10987 / NRS 248)
A1RMC9 1.25e-42 165 26 21 607 3 lepA Elongation factor 4 Shewanella sp. (strain W3-18-1)
B5EB36 1.46e-42 165 29 20 527 3 lepA Elongation factor 4 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B5XLC6 1.53e-42 165 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M49 (strain NZ131)
A5WCD6 1.63e-42 165 28 19 510 3 lepA Elongation factor 4 Psychrobacter sp. (strain PRwf-1)
A5GMR2 1.68e-42 165 29 19 522 3 lepA Elongation factor 4 Synechococcus sp. (strain WH7803)
Q1I5V6 1.81e-42 164 28 17 511 3 lepA Elongation factor 4 Pseudomonas entomophila (strain L48)
Q9PKX6 1.93e-42 164 28 20 515 3 lepA Elongation factor 4 Chlamydia muridarum (strain MoPn / Nigg)
Q4L6T4 2.01e-42 164 28 21 545 3 lepA Elongation factor 4 Staphylococcus haemolyticus (strain JCSC1435)
B5ZAB8 2.11e-42 164 28 19 504 3 lepA Elongation factor 4 Helicobacter pylori (strain G27)
A5VB59 2.37e-42 164 28 21 528 3 lepA Elongation factor 4 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q17X87 2.5e-42 164 28 19 504 3 lepA Elongation factor 4 Helicobacter acinonychis (strain Sheeba)
A6WKQ5 2.54e-42 164 26 21 607 3 lepA Elongation factor 4 Shewanella baltica (strain OS185)
A3D1V4 2.54e-42 164 26 21 607 3 lepA Elongation factor 4 Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9III9 2.58e-42 164 28 17 509 3 lepA Elongation factor 4 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
C3L3H1 2.63e-42 164 29 21 506 3 lepA Elongation factor 4 Clostridium botulinum (strain 657 / Type Ba4)
A5CWJ4 2.64e-42 164 28 17 506 3 lepA Elongation factor 4 Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A6VLV6 2.78e-42 164 28 17 506 3 lepA Elongation factor 4 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C1DQS0 2.8e-42 164 27 16 508 3 lepA Elongation factor 4 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3SVT1 2.91e-42 164 29 20 528 3 lepA Elongation factor 4 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A9L5N4 2.92e-42 164 26 21 607 3 lepA Elongation factor 4 Shewanella baltica (strain OS195)
B8EBQ4 2.92e-42 164 26 21 607 3 lepA Elongation factor 4 Shewanella baltica (strain OS223)
B8CQJ7 3.18e-42 164 28 17 505 3 lepA Elongation factor 4 Shewanella piezotolerans (strain WP3 / JCM 13877)
O84067 3.26e-42 164 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KMV7 3.26e-42 164 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q9ZM93 3.34e-42 164 28 18 503 3 lepA Elongation factor 4 Helicobacter pylori (strain J99 / ATCC 700824)
B0BB51 3.36e-42 164 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9H2 3.36e-42 164 27 20 515 3 lepA Elongation factor 4 Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
P60794 3.38e-42 164 27 17 508 3 lepA Elongation factor 4 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A1D5Z0 3.57e-42 165 27 19 593 3 guf1 Translation factor guf1, mitochondrial Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q1H2L5 3.8e-42 164 28 17 482 3 lepA1 Elongation factor 4 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q24SR6 3.8e-42 164 30 16 477 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain Y51)
B8FUP2 3.8e-42 164 30 16 477 3 lepA Elongation factor 4 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q88VN0 3.92e-42 164 30 16 498 3 lepA1 Elongation factor 4 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P60789 3.94e-42 164 28 18 510 3 lepA Elongation factor 4 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0KV29 4.22e-42 163 28 17 512 3 lepA Elongation factor 4 Pseudomonas putida (strain GB-1)
Q3YSC2 4.63e-42 163 29 18 509 3 lepA Elongation factor 4 Ehrlichia canis (strain Jake)
Q3AWX3 4.86e-42 163 29 20 520 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9902)
A5W8F4 4.93e-42 163 28 17 512 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3J8D2 4.95e-42 163 28 16 507 3 lepA Elongation factor 4 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q87XF8 5.01e-42 163 28 17 508 3 lepA Elongation factor 4 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A8G3D2 5.46e-42 163 29 18 526 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9215)
Q88MY7 5.69e-42 163 28 17 512 3 lepA Elongation factor 4 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1SSM6 6.07e-42 163 28 16 480 3 lepA Elongation factor 4 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1QR19 6.42e-42 163 29 20 528 3 lepA Elongation factor 4 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5FLU8 6.5e-42 163 29 17 511 3 lepA Elongation factor 4 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A3QBS5 6.53e-42 163 27 16 507 3 lepA Elongation factor 4 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0TNS2 6.6e-42 163 28 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B1XTL2 6.94e-42 163 28 18 506 3 lepA Elongation factor 4 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A0M6M2 7.1e-42 163 29 17 504 3 lepA Elongation factor 4 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A4XSC1 7.11e-42 163 28 17 511 3 lepA Elongation factor 4 Pseudomonas mendocina (strain ymp)
B1J4D8 7.18e-42 163 28 17 512 3 lepA Elongation factor 4 Pseudomonas putida (strain W619)
A7IEG8 7.72e-42 163 29 18 506 3 lepA Elongation factor 4 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q3SH47 7.91e-42 163 27 21 570 3 lepA Elongation factor 4 Thiobacillus denitrificans (strain ATCC 25259)
Q9I5G8 8.07e-42 162 28 16 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HR9 8.07e-42 162 28 16 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYX5 8.07e-42 162 28 16 509 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain LESB58)
P65274 8.1e-42 163 29 23 553 3 lepA Elongation factor 4 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P65273 8.1e-42 163 29 23 553 3 lepA Elongation factor 4 Streptococcus agalactiae serotype III (strain NEM316)
Q3K1F9 8.1e-42 163 29 23 553 3 lepA Elongation factor 4 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q831Z0 8.11e-42 163 29 18 507 3 lepA Elongation factor 4 Enterococcus faecalis (strain ATCC 700802 / V583)
A1W018 8.96e-42 162 27 18 509 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PNR1 8.96e-42 162 27 18 509 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FM79 8.96e-42 162 27 18 509 3 lepA Elongation factor 4 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B1V9C5 9.18e-42 162 27 18 530 3 lepA Elongation factor 4 Phytoplasma australiense
A5FY07 9.38e-42 162 26 20 591 3 lepA Elongation factor 4 Acidiphilium cryptum (strain JF-5)
Q65VN2 9.8e-42 162 27 18 511 3 lepA Elongation factor 4 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5HU70 9.97e-42 162 27 18 509 3 lepA Elongation factor 4 Campylobacter jejuni (strain RM1221)
B8JAF3 1.02e-41 162 29 16 474 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B0USR9 1.07e-41 162 28 17 480 3 lepA Elongation factor 4 Histophilus somni (strain 2336)
Q0I4Z1 1.07e-41 162 28 17 480 3 lepA Elongation factor 4 Histophilus somni (strain 129Pt)
B9DSE0 1.08e-41 162 30 21 507 3 lepA Elongation factor 4 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q7UX15 1.16e-41 162 30 17 500 3 lepA1 Elongation factor 4 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q2RNY6 1.19e-41 162 27 20 549 3 lepA Elongation factor 4 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P0DC23 1.22e-41 162 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC22 1.22e-41 162 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A7I4X4 1.22e-41 164 29 13 472 3 fusA Elongation factor 2 Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q92BN4 1.22e-41 162 30 18 505 3 lepA Elongation factor 4 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5L659 1.23e-41 162 28 20 516 3 lepA Elongation factor 4 Chlamydia abortus (strain DSM 27085 / S26/3)
Q0SRD8 1.28e-41 162 28 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain SM101 / Type A)
Q8XIS6 1.28e-41 162 28 16 472 3 lepA Elongation factor 4 Clostridium perfringens (strain 13 / Type A)
B0SRL4 1.33e-41 162 29 19 519 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S8S7 1.33e-41 162 29 19 519 3 lepA Elongation factor 4 Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A6WYK4 1.33e-41 162 29 21 518 3 lepA Elongation factor 4 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A2BPP8 1.43e-41 162 29 17 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain AS9601)
A5G4G3 1.46e-41 162 29 18 509 3 lepA Elongation factor 4 Geotalea uraniireducens (strain Rf4)
Q7N1X3 1.68e-41 162 28 17 506 3 lepA Elongation factor 4 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q823H7 1.82e-41 162 27 18 515 3 lepA Elongation factor 4 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B1JRC5 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667U9 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKE6 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R400 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD74 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pestis
B2KA49 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C557 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT7 1.84e-41 162 27 16 506 3 lepA Elongation factor 4 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6VAK9 1.91e-41 162 28 18 513 3 lepA Elongation factor 4 Pseudomonas aeruginosa (strain PA7)
C0M8H9 2.11e-41 162 29 23 554 3 lepA Elongation factor 4 Streptococcus equi subsp. equi (strain 4047)
Q1QX26 2.12e-41 162 28 18 515 3 lepA Elongation factor 4 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A3PBD8 2.14e-41 161 29 16 506 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9301)
B9M4U5 2.17e-41 161 28 18 509 3 lepA Elongation factor 4 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A1S3X9 2.18e-41 161 28 17 505 3 lepA Elongation factor 4 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5XCD2 2.22e-41 162 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P43729 2.29e-41 161 28 17 483 3 lepA Elongation factor 4 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3J4P0 2.31e-41 161 29 17 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A4G6S1 2.33e-41 161 29 15 507 3 lepA Elongation factor 4 Herminiimonas arsenicoxydans
A5UFI9 2.36e-41 161 29 17 482 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittGG)
A5UBC2 2.36e-41 161 29 17 482 3 lepA Elongation factor 4 Haemophilus influenzae (strain PittEE)
Q4QPM8 2.36e-41 161 29 17 482 3 lepA Elongation factor 4 Haemophilus influenzae (strain 86-028NP)
Q8Y742 2.46e-41 161 30 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE32 2.46e-41 161 30 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZJ1 2.46e-41 161 30 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain F2365)
C1KVC6 2.46e-41 161 30 18 505 3 lepA Elongation factor 4 Listeria monocytogenes serotype 4b (strain CLIP80459)
Q1LKM8 2.65e-41 161 29 18 508 3 lepA Elongation factor 4 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
C0SHD5 2.65e-41 162 28 18 570 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides brasiliensis (strain Pb03)
A7GZW3 2.67e-41 161 27 18 559 3 lepA Elongation factor 4 Campylobacter curvus (strain 525.92)
Q48TU0 2.69e-41 161 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JLY8 2.69e-41 161 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q99ZV8 2.69e-41 161 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M1
A4TKY0 2.99e-41 161 27 16 506 3 lepA Elongation factor 4 Yersinia pestis (strain Pestoides F)
B8AI54 3.02e-41 162 28 17 521 3 OsI_05919 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. indica
B9F2U5 3.05e-41 162 28 17 525 3 Os02g0157700 Translation factor GUF1 homolog, chloroplastic Oryza sativa subsp. japonica
Q820H8 3.07e-41 161 29 19 510 3 lepA Elongation factor 4 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q49Y26 3.15e-41 161 27 23 588 3 lepA Elongation factor 4 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1J6V6 3.26e-41 161 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M4 (strain MGAS10750)
C4L433 3.34e-41 161 28 22 560 3 lepA Elongation factor 4 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q8YDB8 3.44e-41 161 28 19 515 3 lepA Elongation factor 4 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMH8 3.44e-41 161 28 19 515 3 lepA Elongation factor 4 Brucella melitensis biotype 2 (strain ATCC 23457)
A5GRE6 3.52e-41 161 29 17 515 3 lepA Elongation factor 4 Synechococcus sp. (strain RCC307)
Q2IIA6 3.53e-41 161 29 17 474 3 lepA Elongation factor 4 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8K9Q9 3.64e-41 161 27 19 522 3 lepA Elongation factor 4 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5M4M2 3.66e-41 161 28 23 553 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q0AWL9 3.77e-41 161 30 16 479 3 lepA Elongation factor 4 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
C5BRN3 3.84e-41 160 29 18 482 3 lepA Elongation factor 4 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q02Z80 3.94e-41 161 30 20 506 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain SK11)
Q98DV1 4.17e-41 160 28 21 517 3 lepA Elongation factor 4 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1JC06 4.23e-41 161 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q576S5 4.3e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella abortus biovar 1 (strain 9-941)
Q2YJP8 4.3e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella abortus (strain 2308)
B2SC25 4.3e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella abortus (strain S19)
Q03KW7 4.36e-41 160 28 23 553 3 lepA Elongation factor 4 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M008 4.36e-41 160 28 23 553 3 lepA Elongation factor 4 Streptococcus thermophilus (strain CNRZ 1066)
Q8FV17 4.47e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella suis biovar 1 (strain 1330)
A9WW49 4.47e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VVU4 4.47e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MCW5 4.47e-41 160 28 19 515 3 lepA Elongation factor 4 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A2C0M8 4.65e-41 160 28 18 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL1A)
Q9CGI8 4.69e-41 160 30 20 506 3 lepA Elongation factor 4 Lactococcus lactis subsp. lactis (strain IL1403)
Q46GZ6 4.84e-41 160 28 18 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain NATL2A)
Q1IXW5 4.9e-41 160 29 13 501 3 lepA Elongation factor 4 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A4VIX2 4.94e-41 160 27 19 512 3 lepA Elongation factor 4 Stutzerimonas stutzeri (strain A1501)
Q8CP13 5.21e-41 160 28 21 549 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW2 5.21e-41 160 28 21 549 3 lepA Elongation factor 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0AIS8 5.22e-41 160 30 18 505 3 lepA Elongation factor 4 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q89BJ8 5.64e-41 160 28 19 521 3 lepA Elongation factor 4 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B5FAH2 5.69e-41 160 27 20 567 3 lepA Elongation factor 4 Aliivibrio fischeri (strain MJ11)
Q6D217 7.07e-41 160 27 17 560 3 lepA Elongation factor 4 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B9KNH9 7.1e-41 160 28 17 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q2SL35 7.93e-41 160 28 16 482 3 lepA Elongation factor 4 Hahella chejuensis (strain KCTC 2396)
B1X3K4 8.13e-41 160 29 20 521 3 lepA Translation factor GUF1 homolog, organellar chromatophore Paulinella chromatophora
A4SRD4 8.14e-41 160 27 24 625 3 lepA Elongation factor 4 Aeromonas salmonicida (strain A449)
B4U3G9 9.34e-41 160 29 23 554 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B4UDQ7 1.01e-40 159 29 16 474 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain K)
A2RL76 1.01e-40 160 30 20 506 3 lepA Elongation factor 4 Lactococcus lactis subsp. cremoris (strain MG1363)
B4F049 1.02e-40 159 28 20 509 3 lepA Elongation factor 4 Proteus mirabilis (strain HI4320)
A3PHQ9 1.09e-40 159 28 17 509 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1MQF3 1.16e-40 159 28 15 506 3 lepA Elongation factor 4 Lawsonia intracellularis (strain PHE/MN1-00)
Q0C5X0 1.19e-40 159 29 20 512 3 lepA Elongation factor 4 Hyphomonas neptunium (strain ATCC 15444)
A8FSD4 1.21e-40 159 28 17 506 3 lepA Elongation factor 4 Shewanella sediminis (strain HAW-EB3)
B6EKN1 1.24e-40 159 28 16 509 3 lepA Elongation factor 4 Aliivibrio salmonicida (strain LFI1238)
Q3IDL4 1.25e-40 159 28 18 508 3 lepA Elongation factor 4 Pseudoalteromonas translucida (strain TAC 125)
B4RVA8 1.32e-40 159 28 18 509 3 lepA Elongation factor 4 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q0BRZ7 1.37e-40 159 27 18 510 3 lepA Elongation factor 4 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
C0MDV7 1.39e-40 159 29 21 549 3 lepA Elongation factor 4 Streptococcus equi subsp. zooepidemicus (strain H70)
Q7VDF7 1.45e-40 159 29 19 522 3 lepA Elongation factor 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C8VPJ1 1.45e-40 160 28 21 585 3 guf1 Translation factor guf1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B1IC02 1.57e-40 159 30 20 508 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Hungary19A-6)
B1ZC10 1.83e-40 159 28 20 521 3 lepA Elongation factor 4 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
P9WK97 1.91e-40 159 29 17 498 1 lepA Elongation factor 4 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK96 1.91e-40 159 29 17 498 3 lepA Elongation factor 4 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U598 1.91e-40 159 29 17 498 3 lepA Elongation factor 4 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AQW9 1.91e-40 159 29 17 498 3 lepA Elongation factor 4 Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KL96 1.91e-40 159 29 17 498 3 lepA Elongation factor 4 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65270 1.91e-40 159 29 17 498 3 lepA Elongation factor 4 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5HBH4 1.91e-40 159 28 16 504 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Welgevonden)
A4WX88 2.02e-40 159 29 19 508 3 lepA Elongation factor 4 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q608M4 2.07e-40 159 30 13 405 3 lepA Elongation factor 4 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5FHQ1 2.12e-40 159 28 16 504 3 lepA Elongation factor 4 Ehrlichia ruminantium (strain Gardel)
Q6G550 2.59e-40 158 29 20 507 3 lepA Elongation factor 4 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3KHM1 2.73e-40 158 27 18 511 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain Pf0-1)
Q5JFZ3 2.73e-40 160 25 18 554 3 fusA Elongation factor 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A7H311 2.82e-40 158 27 17 505 3 lepA Elongation factor 4 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A9BE39 3.11e-40 158 28 17 520 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9211)
Q4WYV0 3.22e-40 159 27 20 593 3 guf1 Translation factor guf1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q1GRH5 3.29e-40 158 27 20 555 3 lepA Elongation factor 4 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8EH83 3.29e-40 158 26 21 607 3 lepA Elongation factor 4 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8AWG3 3.32e-40 158 29 18 505 3 lepA Elongation factor 4 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q31R08 3.37e-40 158 30 19 518 3 lepA Elongation factor 4 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8UIQ2 3.49e-40 158 28 19 506 3 lepA Elongation factor 4 Agrobacterium fabrum (strain C58 / ATCC 33970)
B9KD01 3.7e-40 158 26 17 507 3 lepA Elongation factor 4 Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q1JH37 4.08e-40 158 30 20 506 3 lepA Elongation factor 4 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q58448 4.58e-40 159 26 12 466 3 fusA Elongation factor 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6F9B9 4.59e-40 158 27 18 512 3 lepA Elongation factor 4 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P60930 4.73e-40 157 28 15 501 3 lepA Elongation factor 4 Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B3E9R0 4.74e-40 157 28 18 509 3 lepA Elongation factor 4 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A8H1C5 4.75e-40 157 29 17 506 3 lepA Elongation factor 4 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1ARG8 4.77e-40 157 29 21 533 3 lepA Elongation factor 4 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
C1GGI6 5.08e-40 158 27 18 570 3 GUF1 Translation factor GUF1, mitochondrial Paracoccidioides brasiliensis (strain Pb18)
C3K6G8 5.21e-40 157 28 17 512 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain SBW25)
B8ENL1 5.38e-40 157 29 19 504 3 lepA Elongation factor 4 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
C6DC02 5.57e-40 157 28 16 506 3 lepA Elongation factor 4 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P57806 5.95e-40 157 29 17 479 3 lepA Elongation factor 4 Pasteurella multocida (strain Pm70)
B6H2S6 6.1e-40 158 26 18 588 3 guf1 Translation factor guf1, mitochondrial Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
C1C7G9 6.32e-40 157 29 18 508 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain 70585)
B5E4T8 6.32e-40 157 29 18 508 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 19F (strain G54)
Q6MTR6 6.33e-40 157 28 22 534 3 lepA Elongation factor 4 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
B8DIZ5 6.4e-40 157 28 12 476 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
O93640 6.9e-40 159 27 11 475 3 fusA Elongation factor 2 Methanosarcina thermophila
Q48EV0 6.91e-40 157 27 17 507 3 lepA Elongation factor 4 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B7VK81 7e-40 157 26 17 564 3 lepA Elongation factor 4 Vibrio atlanticus (strain LGP32)
Q4KHT3 7.44e-40 157 27 17 512 3 lepA Elongation factor 4 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A7HCF3 7.46e-40 157 28 14 473 3 lepA Elongation factor 4 Anaeromyxobacter sp. (strain Fw109-5)
A5ULM6 8.1e-40 158 25 10 463 3 fusA Elongation factor 2 Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B8BYH3 8.45e-40 158 26 17 599 3 THAPSDRAFT_40001 Translation factor GUF1 homolog, mitochondrial Thalassiosira pseudonana
A4VUL8 8.55e-40 157 29 18 504 3 lepA Elongation factor 4 Streptococcus suis (strain 05ZYH33)
A4W0W0 8.55e-40 157 29 18 504 3 lepA Elongation factor 4 Streptococcus suis (strain 98HAH33)
O93637 8.81e-40 158 26 16 519 3 fusA Elongation factor 2 Methanococcoides methylutens
Q47WP3 9.7e-40 157 27 21 567 3 lepA Elongation factor 4 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A0KZN4 1.09e-39 157 25 21 607 3 lepA Elongation factor 4 Shewanella sp. (strain ANA-3)
A5N6L8 1.15e-39 157 27 18 522 3 lepA Elongation factor 4 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q5N390 1.15e-39 157 30 19 518 3 lepA Elongation factor 4 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q4ZPD8 1.17e-39 156 27 17 507 3 lepA Elongation factor 4 Pseudomonas syringae pv. syringae (strain B728a)
Q31CB8 1.19e-39 156 29 17 520 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9312)
Q0HSI9 1.21e-39 156 25 21 607 3 lepA Elongation factor 4 Shewanella sp. (strain MR-7)
Q0HG96 1.21e-39 156 25 21 607 3 lepA Elongation factor 4 Shewanella sp. (strain MR-4)
A2BV79 1.26e-39 156 27 18 526 3 lepA Elongation factor 4 Prochlorococcus marinus (strain MIT 9515)
B0XZZ2 1.32e-39 157 27 20 593 3 guf1 Translation factor guf1, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q0ICF2 1.35e-39 156 28 18 518 3 lepA Elongation factor 4 Synechococcus sp. (strain CC9311)
A9A0N0 1.38e-39 156 29 15 496 3 lepA Elongation factor 4 Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q2NS11 1.46e-39 156 27 20 567 3 lepA Elongation factor 4 Sodalis glossinidius (strain morsitans)
Q2SSF7 1.49e-39 156 28 21 531 3 lepA Elongation factor 4 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A9MGX5 1.5e-39 156 28 18 544 3 lepA Elongation factor 4 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P60791 1.65e-39 157 29 19 493 3 lepA Elongation factor 4 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q0V3J4 1.65e-39 157 28 14 512 3 GUF1 Translation factor GUF1, mitochondrial Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q8Y0I4 1.77e-39 156 28 18 508 3 lepA Elongation factor 4 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0CS42 1.77e-39 157 28 15 508 3 guf1 Translation factor guf1, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q3A445 1.93e-39 156 29 15 505 3 lepA Elongation factor 4 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q1R8G3 2.04e-39 156 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain UTI89 / UPEC)
A1AE99 2.04e-39 156 28 17 506 3 lepA Elongation factor 4 Escherichia coli O1:K1 / APEC
B7MYK1 2.04e-39 156 28 17 506 3 lepA Elongation factor 4 Escherichia coli O81 (strain ED1a)
B7MIQ4 2.04e-39 156 28 17 506 3 lepA Elongation factor 4 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH09 2.04e-39 156 28 17 506 3 lepA Elongation factor 4 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P60788 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Shigella flexneri
Q0T1T6 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Shigella flexneri serotype 5b (strain 8401)
Q31XR8 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Shigella boydii serotype 4 (strain Sb227)
B2TYI0 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LUZ5 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LP82 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain SMS-3-5 / SECEC)
B7N6F7 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60785 2.12e-39 155 28 17 506 1 lepA Elongation factor 4 Escherichia coli (strain K12)
B1IVQ8 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60786 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TER9 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A379 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O9:H4 (strain HS)
B1XB43 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain K12 / DH10B)
C4ZYJ2 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain K12 / MC4100 / BW2952)
B7NRM2 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z143 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60787 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O157:H7
B7LDG2 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli (strain 55989 / EAEC)
A7ZQ13 2.12e-39 155 28 17 506 3 lepA Elongation factor 4 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q12KH9 2.18e-39 155 26 23 609 3 lepA Elongation factor 4 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B3R202 2.2e-39 155 29 18 510 3 lepA Elongation factor 4 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3ZXK4 2.22e-39 156 27 15 521 3 lepA Elongation factor 4 Dehalococcoides mccartyi (strain CBDB1)
A5FR18 2.22e-39 156 27 15 521 3 lepA Elongation factor 4 Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B4U6M2 2.29e-39 155 27 16 507 3 lepA Elongation factor 4 Hydrogenobaculum sp. (strain Y04AAS1)
Q0K8N0 2.31e-39 155 29 18 510 3 lepA Elongation factor 4 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B6I5E3 2.48e-39 155 28 16 505 3 lepA Elongation factor 4 Escherichia coli (strain SE11)
Q5PAX8 2.5e-39 155 27 15 499 3 lepA Elongation factor 4 Anaplasma marginale (strain St. Maries)
B9KIE5 2.5e-39 155 27 15 499 3 lepA Elongation factor 4 Anaplasma marginale (strain Florida)
C5BAI0 2.54e-39 155 27 15 504 3 lepA Elongation factor 4 Edwardsiella ictaluri (strain 93-146)
C1CKU6 2.59e-39 155 29 18 508 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain P1031)
Q97QK5 2.59e-39 155 29 18 508 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5E312 2.69e-39 155 27 19 511 3 lepA Elongation factor 4 Aliivibrio fischeri (strain ATCC 700601 / ES114)
C1CR98 2.78e-39 155 29 18 507 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DPN5 2.78e-39 155 29 18 507 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZQ69 2.78e-39 155 29 18 507 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04KB7 2.78e-39 155 29 18 507 3 lepA Elongation factor 4 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A6H1S4 2.83e-39 155 28 18 513 3 lepA Elongation factor 4 Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
C1CEG3 2.94e-39 155 29 18 507 3 lepA Elongation factor 4 Streptococcus pneumoniae (strain JJA)
B0VCT7 3.36e-39 155 28 18 483 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AYE)
A3M7P5 3.36e-39 155 28 18 483 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWQ2 3.36e-39 155 28 18 483 3 lepA Elongation factor 4 Acinetobacter baumannii (strain ACICU)
B7I580 3.36e-39 155 28 18 483 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB0057)
B7GYS7 3.36e-39 155 28 18 483 3 lepA Elongation factor 4 Acinetobacter baumannii (strain AB307-0294)
Q47EG0 3.59e-39 155 27 18 510 3 lepA Elongation factor 4 Dechloromonas aromatica (strain RCB)
Q72E76 3.64e-39 155 29 13 473 3 lepA Elongation factor 4 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2U3T4 3.82e-39 156 28 15 508 3 guf1 Translation factor guf1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14550
Feature type CDS
Gene typA
Product translational GTPase TypA
Location 140366 - 142186 (strand: 1)
Length 1821 (nucleotides) / 606 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1733
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF00679 Elongation factor G C-terminus
PF03144 Elongation factor Tu domain 2
PF21018 TypA/BipA C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1217 Signal transduction mechanisms (T) T Predicted membrane GTPase TypA/BipA involved in stress response

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06207 GTP-binding protein - -

Protein Sequence

MSIEKLRNIAIIAHVDHGKTTLVDKLLQQSGTFDDRAKPEERVMDSGDLERERGITILAKNTAITWEDYHINIVDTPGHADFGGEVERVMSMVDSVLLLVDAIDGPMPQTRFVTQKAFANGLSPIVVINKIDRPGARPDWVIDQVFDLFVNLGATDEQLDFPIIYASALMGIAGEDYNEMAEDMTPLYKAIVKYVEPPKVDLDGPFQMQISQLDYNNYLGVIGIGRIKRGKVKPNQQITVIDSEGKTRNGKVGKVLSHLGLERIESAEAEAGDIIALTGLGELGISDTICETSCVEALTPLAVDEPTVSMYFCVNTSPFCGKEGKFVTSRQILDRLKKELVHNVALRVEETEDPDAFRVSGRGELHLSVLIENMRREGFELAVSRPRVIFREIDGRKQEPFEQVTLDIEEQHQGDVMRALGERKGELSNMMPDGKGRVRLDYSIPSRGLIGFRTEFMTMTSGTGLLYATFSHYGDVKQGEIGRRQNGVMISNGQGKAVAYALYSLQDRGKLFIGHGTEVYEGQLIGIHSRSNDLTVNCLTGKKLTNMRASGTDEATTLSPFLEKTLEQALEFIDDDELVEVTPKSIRLRKRYLTENDRKRAHRSKD

Flanking regions ( +/- flanking 50bp)

ATGCTATCTGTGACGTAATTCCCATCCATTAACGAAAACGGTACAAGTCTTTGTCTATCGAGAAATTAAGAAATATTGCCATCATCGCTCACGTTGACCATGGCAAAACCACGCTGGTCGATAAATTATTACAGCAGTCCGGTACTTTTGACGATCGTGCAAAACCGGAAGAGCGCGTAATGGACTCCGGCGATCTGGAAAGAGAGCGCGGCATTACTATTTTGGCAAAAAATACCGCGATTACGTGGGAAGACTATCACATCAACATCGTTGACACCCCGGGACACGCCGATTTCGGTGGTGAAGTAGAACGTGTTATGTCCATGGTTGACAGCGTACTGTTGCTGGTTGATGCAATCGATGGTCCGATGCCGCAGACCCGCTTTGTAACGCAGAAAGCGTTTGCAAACGGCCTGAGCCCTATCGTTGTTATTAACAAAATTGACCGTCCGGGCGCACGTCCTGACTGGGTTATCGACCAGGTCTTTGATCTGTTTGTTAACCTTGGTGCTACTGACGAGCAGCTCGACTTCCCGATCATCTACGCATCTGCACTGATGGGTATTGCGGGCGAAGATTACAATGAAATGGCGGAAGACATGACTCCGCTGTACAAAGCCATTGTTAAATATGTTGAACCACCAAAAGTGGATCTCGACGGTCCGTTCCAGATGCAAATCTCCCAGCTTGATTACAACAACTACCTGGGCGTAATCGGGATTGGTCGTATCAAACGCGGTAAAGTGAAGCCTAACCAGCAAATCACAGTGATTGATTCAGAAGGCAAAACCCGTAACGGTAAAGTCGGTAAAGTTCTGAGCCACCTGGGTCTGGAGCGTATTGAATCAGCTGAGGCAGAAGCGGGTGATATCATCGCGCTGACCGGTCTGGGCGAACTGGGTATCTCTGATACCATCTGTGAAACAAGCTGTGTTGAAGCATTAACACCACTGGCTGTTGATGAACCGACCGTAAGCATGTATTTCTGCGTTAACACCTCACCATTCTGCGGTAAAGAAGGTAAGTTTGTAACGTCCCGCCAGATCTTAGACCGTCTGAAAAAAGAACTGGTTCACAACGTGGCACTGCGTGTCGAAGAGACTGAAGACCCGGATGCATTCCGTGTATCAGGCCGTGGTGAACTGCACTTATCTGTTCTGATTGAAAACATGCGCCGTGAAGGTTTTGAGCTGGCGGTATCCCGTCCGCGCGTTATCTTCCGTGAAATCGATGGCCGTAAACAAGAGCCGTTCGAGCAGGTTACTCTGGATATCGAAGAGCAGCATCAGGGCGATGTCATGCGTGCACTCGGTGAGCGTAAAGGCGAACTGAGCAACATGATGCCGGATGGTAAAGGCCGCGTACGTTTAGATTACAGTATTCCGAGCCGTGGTCTGATTGGCTTCCGTACTGAATTTATGACAATGACATCCGGTACAGGTTTACTGTACGCAACATTCAGTCACTACGGTGATGTGAAGCAGGGTGAAATTGGTCGTCGTCAGAACGGCGTAATGATCTCTAACGGTCAGGGTAAAGCAGTTGCATACGCACTGTACAGCCTCCAGGATCGCGGTAAATTATTTATCGGTCACGGTACTGAAGTATATGAAGGTCAGCTCATCGGTATTCACTCACGTTCTAACGACCTGACTGTGAACTGCTTAACCGGTAAAAAACTGACTAACATGCGTGCTTCCGGTACAGATGAAGCAACAACACTGTCACCATTCCTTGAAAAAACGCTGGAACAGGCGTTAGAGTTCATTGATGATGACGAATTAGTGGAAGTAACACCGAAGTCTATCCGTCTTCGTAAGCGTTACCTGACTGAAAACGACCGCAAGCGCGCACACCGCAGCAAAGATTAATCGTCGTTTTTATTCAATGCCACTCAGGGCGCCTTTCGGGCGCCCTGAGC