Homologs in group_2850

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10630 FBDBKF_10630 91.9 Morganella morganii S1 rocR RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains
EHELCC_14965 EHELCC_14965 91.9 Morganella morganii S2 rocR RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains
NLDBIP_14795 NLDBIP_14795 91.9 Morganella morganii S4 rocR RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains
LHKJJB_14550 LHKJJB_14550 91.9 Morganella morganii S3 rocR RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains
HKOGLL_13170 HKOGLL_13170 91.9 Morganella morganii S5 rocR RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Distribution of the homologs in the orthogroup group_2850

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2850

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P26047 8.24e-96 307 44 4 358 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P54529 3.84e-87 286 38 8 458 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P54529 9.91e-05 48 28 4 146 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q9ZIB7 1.72e-85 277 31 11 537 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P0A2D7 3.74e-85 276 33 12 528 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 3.74e-85 276 33 12 528 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
Q06065 7.72e-85 273 43 7 349 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
O54426 4.77e-82 268 33 12 528 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P07604 6.32e-82 268 32 11 535 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P38022 2.92e-77 254 35 11 447 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q46802 7.14e-76 254 33 6 459 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P71229 1.79e-75 254 47 3 272 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
D5ARW9 2.07e-74 249 47 1 262 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54930 2.37e-74 248 52 2 243 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P0CY94 2.6e-74 249 47 1 262 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
Q43965 1.12e-73 247 38 9 387 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P09133 1.53e-73 248 52 1 242 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q01265 2.82e-73 238 46 0 243 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P56266 3.22e-73 245 42 5 335 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03027 3.81e-73 245 42 5 335 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P05407 5.13e-73 246 51 1 242 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P54929 1.77e-72 246 49 2 253 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
E1WAA4 2.9e-72 246 42 6 322 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CL46 3.71e-72 246 41 6 322 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P30667 4.07e-72 244 49 2 253 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54931 8.96e-72 243 48 1 248 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P09570 5.36e-71 239 49 2 244 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P24426 1.41e-70 233 47 1 243 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P19323 1.56e-70 242 41 6 324 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P27713 1.72e-70 238 47 4 270 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P12626 2.99e-70 237 52 2 238 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q9APD9 8.79e-70 234 39 4 317 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P29267 8.96e-70 234 41 8 346 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P17899 1.06e-69 234 40 6 322 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0AFU5 1.51e-69 233 48 2 239 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.51e-69 233 48 2 239 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P12627 5.2e-69 234 41 6 331 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q53206 7.25e-69 235 47 1 248 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3K999 2.75e-68 227 48 2 235 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q9K4U8 8.95e-68 231 42 5 326 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O85057 1.2e-67 231 34 8 456 1 None Limonene hydroxylase Geobacillus stearothermophilus
G3XCV0 1.47e-67 229 44 8 314 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFB8 2.38e-67 228 39 7 350 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 2.38e-67 228 39 7 350 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P25852 2.58e-67 227 39 7 320 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28787 5.91e-67 227 39 7 342 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q8Z333 1.17e-66 225 39 5 317 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q845S7 1.65e-66 223 48 2 235 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P09828 3.43e-66 226 46 1 259 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P14375 4.51e-66 224 38 6 318 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P03028 4.57e-66 226 48 2 259 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
Q8X613 1.05e-65 223 39 5 317 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q6D8R9 1.78e-65 224 39 5 331 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P03029 1.88e-65 223 40 7 335 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P41789 1.9e-65 223 39 8 351 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5FSZ0 2.5e-65 224 48 5 266 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
O25408 2.7e-65 220 50 4 234 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P06519 2.86e-65 225 48 5 244 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
A6TCX4 6.54e-65 223 47 3 251 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P31908 7.88e-65 222 39 8 366 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
C0PWN2 8.23e-65 222 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5F363 1.94e-64 221 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
B7N6T9 3.15e-64 221 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TF23 3.66e-64 221 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B7MZ04 3.68e-64 221 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
A9MFX7 5.33e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5RDG4 5.62e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z4C6 5.73e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 5.73e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 5.73e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 5.73e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
A8ANR6 5.98e-64 220 49 4 239 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7UHC1 6.75e-64 220 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEN6 6.82e-64 220 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5PF20 7.21e-64 220 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7NSI9 7.81e-64 219 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A4WDR5 8.94e-64 219 47 3 249 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B5Z370 1.17e-63 219 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.17e-63 219 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P45671 1.42e-63 218 45 2 247 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
B5XVA2 1.45e-63 219 47 3 248 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
A7ZQD8 1.55e-63 219 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
B4T3B0 1.64e-63 219 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
P37013 1.82e-63 219 48 4 257 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.82e-63 219 48 4 257 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.82e-63 219 48 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q0TEH1 2.06e-63 218 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q00934 2.22e-63 217 45 2 245 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZMJ8 2.25e-63 218 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 2.25e-63 218 47 4 265 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q9I4N3 2.69e-63 217 46 2 236 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B6I695 2.7e-63 218 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
A8GG93 2.8e-63 218 41 3 325 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B7M9E6 3.13e-63 218 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B1LQ27 4.64e-63 218 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q1R7Z1 6.62e-63 217 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 6.62e-63 217 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 6.62e-63 217 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3YYF5 9.53e-63 217 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
O87455 9.79e-63 217 49 2 230 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
O31551 9.83e-63 219 45 1 240 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
B7LW25 9.94e-63 217 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8A3I6 1.13e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 1.26e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 1.33e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
P59402 1.57e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 1.57e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q32CL9 1.57e-62 216 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
Q9K4V0 3.45e-62 216 43 6 321 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9HU19 3.73e-62 214 40 7 326 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7LEC0 3.81e-62 215 47 4 257 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
P28614 4.55e-62 219 41 8 314 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P77743 1.26e-61 214 48 2 220 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P10577 1.33e-61 213 45 1 231 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q9KT84 2.47e-61 212 45 5 253 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74839 2.62e-61 214 38 8 339 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5E3W8 5.75e-61 212 42 6 312 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MM78 1.02e-60 210 39 3 288 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.02e-60 210 39 3 288 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q8D4F9 2.87e-60 210 40 7 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P0C5S5 3e-60 209 40 3 284 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 3e-60 209 40 3 284 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q04848 3.97e-60 209 44 1 231 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q87MX7 5.06e-60 208 39 3 284 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4STH5 5.86e-60 209 48 2 234 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q7MFY9 1.39e-59 208 40 7 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P44694 1.75e-59 202 36 5 336 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88RJ6 2.17e-59 206 42 2 256 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9KN48 9.6e-59 207 37 6 331 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0KEJ0 1.71e-58 206 47 2 234 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P10576 2.69e-58 204 41 1 258 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q88AQ2 2.96e-58 203 36 4 325 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P37344 4.45e-58 199 36 5 316 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P23747 3.35e-56 198 44 2 231 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13632 2.93e-54 193 41 4 246 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P36219 4.5e-52 183 36 7 308 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P10046 2.37e-51 185 35 6 338 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P37931 6.77e-51 179 41 3 226 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
Q04849 6.82e-48 176 38 6 286 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P26316 1.03e-46 168 40 4 233 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P45512 4.39e-46 174 27 4 367 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 7.46e-46 174 28 5 389 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P37930 1.75e-45 165 38 4 221 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P26408 5.16e-42 160 32 8 337 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q68WH4 4.25e-37 146 33 6 275 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 8.9e-37 145 33 6 275 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 4.12e-36 144 33 7 275 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RJS1 5.72e-36 143 33 6 275 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P54156 9.79e-34 134 34 6 247 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
Q92HC2 5.5e-32 132 32 7 275 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P38035 1.22e-31 131 31 4 265 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P55610 1.35e-27 120 26 11 410 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P09432 3.73e-27 117 30 5 260 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P23914 4.14e-17 88 34 10 236 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
D0ZLR9 9.16e-13 74 26 11 295 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14340
Feature type CDS
Gene -
Product sigma 54-interacting transcriptional regulator
Location 91790 - 93427 (strand: 1)
Length 1638 (nucleotides) / 545 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2850
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF00989 PAS fold
PF18024 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03721 transcriptional regulator of aroF, aroG, tyrA and aromatic amino acid transport - -

Protein Sequence

MSAYRWLINTIDRVAMVEEVINEFSVSEISINSMEVFPCKIYVKFNAECERDVKLLLSKLLLNPDVISITRSKLQPYERKEKELQAILESTTDGIIGINNQGNISYFNKVAEEFFSVSRENIVGINISKILSTKNQEVITKLLGGNSFDHYQMVTGTAKGELYYICSGRPILSEESQVMGAVITFKSLRSVQQMASSVNKSLPFSFDDIICESEIMINLIDFAKKISISPYTVLIRGETGTGKELFARAIHNASDRNGHPFAPINCAALPENLIESELFGYEGGAFSGASKGGKMGLFESANHGTVFLDEFGELSLILQSKLLRVLQEGVIRRVGGHKEVPVDVRIIVATNRNLEEMIENKSFREDLYYRINVIPINIPPLKERKNDIPLLLQRFISKYTEELNKRLSLSQDAYHQLMAYSWPGNVRELQNVILRAIHLASGAEITVKDLWLPHEDVMAAPVRQQPVNRAESISAQDSPQEEYSLKESIARQEKNLLEDYLRRYGSARKVSREIGMSHTTVLNKARYYDLEHLLTYRSVRRQAHK

Flanking regions ( +/- flanking 50bp)

TGGACAAAAGTTTAAGCACTACATACCACTAACCGGGAGTGGCTAAACACATGTCTGCATATAGATGGTTGATTAATACCATTGACCGCGTCGCCATGGTGGAAGAAGTCATCAATGAGTTTTCCGTGTCTGAAATCAGCATTAATTCCATGGAAGTATTTCCATGCAAAATTTATGTCAAATTCAATGCGGAATGTGAGCGCGACGTCAAACTCCTGCTGAGTAAACTCCTTCTTAATCCTGATGTTATCAGCATCACCCGCTCTAAACTGCAACCCTACGAACGCAAAGAAAAAGAGCTTCAGGCGATACTTGAATCCACCACTGACGGCATCATCGGGATCAACAATCAGGGCAATATCAGTTACTTTAATAAAGTCGCTGAAGAATTTTTCTCTGTATCAAGAGAAAATATTGTCGGGATAAATATCAGTAAAATTCTCAGCACTAAAAATCAGGAAGTTATCACCAAGCTTCTTGGTGGTAACAGTTTTGATCACTATCAGATGGTCACCGGCACAGCAAAAGGTGAGCTTTACTATATTTGTTCGGGACGACCTATTCTCAGTGAAGAATCTCAGGTGATGGGCGCGGTGATTACCTTTAAAAGCCTGCGCTCTGTTCAGCAGATGGCATCATCGGTAAATAAAAGCCTGCCATTCAGTTTTGACGATATTATCTGTGAAAGTGAAATCATGATCAATCTGATTGATTTTGCTAAGAAAATATCAATAAGCCCGTACACGGTGCTGATCCGGGGTGAAACCGGAACCGGTAAAGAACTGTTTGCCCGCGCAATTCACAATGCCAGTGACCGTAATGGTCATCCGTTTGCGCCGATAAACTGTGCGGCACTGCCGGAAAATCTGATTGAAAGTGAGCTGTTCGGCTATGAAGGCGGTGCCTTCAGCGGAGCAAGTAAAGGCGGGAAAATGGGATTATTTGAATCCGCCAATCACGGTACTGTTTTTCTGGATGAATTCGGCGAGCTTTCTCTTATCCTGCAAAGTAAATTACTGCGTGTATTGCAGGAGGGCGTGATCCGCCGGGTCGGCGGGCACAAAGAGGTGCCTGTGGATGTGCGGATTATCGTGGCGACGAACCGGAACCTGGAAGAGATGATTGAGAATAAATCGTTCCGTGAAGATCTCTATTACCGGATTAACGTGATCCCGATAAATATCCCGCCGCTGAAAGAACGAAAAAATGATATCCCACTGTTATTACAGCGTTTTATCAGTAAATATACGGAGGAACTGAATAAGCGGCTCAGTTTGTCTCAGGATGCCTATCATCAGCTGATGGCGTATTCATGGCCGGGAAATGTCCGCGAATTACAGAATGTTATCCTGCGGGCTATTCATCTGGCATCCGGGGCAGAAATTACCGTCAAAGACTTATGGCTGCCTCATGAAGACGTGATGGCTGCACCTGTGCGCCAACAGCCGGTAAACCGGGCTGAGAGTATATCCGCGCAAGATTCACCGCAGGAGGAATACAGCCTGAAAGAGTCTATTGCCCGGCAGGAAAAGAATCTGCTGGAAGATTACCTGCGCCGTTACGGCTCGGCCCGCAAAGTGTCACGTGAAATCGGAATGTCTCATACCACAGTACTGAACAAAGCCCGTTATTACGATCTGGAACACTTGCTGACCTACCGTTCTGTGCGGCGGCAGGCACATAAATAGGTAATTACCGCCCGTCATCTTTTATTGCAGTGTGGCGGGCCGTTTCGTAG