Homologs in group_2360

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19040 FBDBKF_19040 86.4 Morganella morganii S1 yafD endonuclease/exonuclease/phosphatase family protein
EHELCC_18785 EHELCC_18785 86.4 Morganella morganii S2 yafD endonuclease/exonuclease/phosphatase family protein
NLDBIP_18520 NLDBIP_18520 86.4 Morganella morganii S4 yafD endonuclease/exonuclease/phosphatase family protein
LHKJJB_18655 LHKJJB_18655 86.4 Morganella morganii S3 yafD endonuclease/exonuclease/phosphatase family protein
HKOGLL_18390 HKOGLL_18390 86.4 Morganella morganii S5 yafD endonuclease/exonuclease/phosphatase family protein
PMI_RS11120 PMI_RS11120 63.8 Proteus mirabilis HI4320 - endonuclease/exonuclease/phosphatase family protein

Distribution of the homologs in the orthogroup group_2360

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2360

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8M0 2.75e-121 349 64 0 257 3 plu0699 UPF0294 protein plu0699 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JKA7 1.34e-111 325 60 1 258 3 YE0917 UPF0294 protein YE0917 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZH34 1.32e-110 322 60 1 258 3 YPO1077 UPF0294 protein YPO1077/y3099/YP_2772 Yersinia pestis
A7FFK3 1.32e-110 322 60 1 258 3 YpsIP31758_1050 UPF0294 protein YpsIP31758_1050 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q32JQ4 1.08e-107 315 58 2 259 3 yafD UPF0294 protein YafD Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z5F4 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Shigella sonnei (strain Ss046)
P0A8U5 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Shigella flexneri
Q0T805 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Shigella flexneri serotype 5b (strain 8401)
Q325T7 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Shigella boydii serotype 4 (strain Sb227)
B7LW84 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LHL8 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain SMS-3-5 / SECEC)
B7N871 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8U2 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12)
B1IPU9 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8U3 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1XD73 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12 / DH10B)
C4ZRU6 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12 / MC4100 / BW2952)
B7M208 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O8 (strain IAI1)
B7MP64 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O81 (strain ED1a)
B7NKW9 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0I3 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8U4 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O157:H7
B7LHB5 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli (strain 55989 / EAEC)
B7MBI5 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJA5 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHU5 2e-107 314 58 2 259 3 yafD UPF0294 protein YafD Escherichia coli O139:H28 (strain E24377A / ETEC)
B5FJ53 8.85e-107 312 57 2 259 3 yafD UPF0294 protein YafD Salmonella dublin (strain CT_02021853)
B4TYG5 1.34e-106 312 57 2 259 3 yafD UPF0294 protein YafD Salmonella schwarzengrund (strain CVM19633)
B4TK80 1.34e-106 312 57 2 259 3 yafD UPF0294 protein YafD Salmonella heidelberg (strain SL476)
Q57T01 1.34e-106 312 57 2 259 3 yafD UPF0294 protein YafD Salmonella choleraesuis (strain SC-B67)
B5F8W7 1.34e-106 312 57 2 259 3 yafD UPF0294 protein YafD Salmonella agona (strain SL483)
A4W6U9 1.56e-106 312 56 2 260 3 Ent638_0743 UPF0294 protein Ent638_0743 Enterobacter sp. (strain 638)
Q8ZRM4 2.05e-106 311 57 2 259 3 yafD UPF0294 protein YafD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SV34 2.05e-106 311 57 2 259 3 yafD UPF0294 protein YafD Salmonella newport (strain SL254)
B5Y1G7 3.04e-106 311 58 2 260 3 KPK_4510 UPF0294 protein KPK_4510 Klebsiella pneumoniae (strain 342)
C0Q6M7 6.26e-106 310 57 2 259 3 yafD UPF0294 protein YafD Salmonella paratyphi C (strain RKS4594)
Q8Z985 6.76e-106 310 57 2 259 3 yafD UPF0294 protein YafD Salmonella typhi
B2VIE6 1.81e-102 301 55 2 259 3 ETA_26410 UPF0294 protein ETA_26410 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7MY11 5.97e-58 189 41 1 217 3 VIBHAR_03217 UPF0294 protein VIBHAR_03217 Vibrio campbellii (strain ATCC BAA-1116)
Q87MF7 5.37e-57 186 42 1 217 3 VP2298 UPF0294 protein VP2298 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MII1 1.46e-55 182 41 1 217 3 VV2535 UPF0294 protein VV2535 Vibrio vulnificus (strain YJ016)
Q8DBE1 3.38e-54 179 41 1 217 3 VV1_1880 UPF0294 protein VV1_1880 Vibrio vulnificus (strain CMCP6)
A5F637 1.3e-52 175 42 3 220 3 VC0395_A1830 UPF0294 protein VC0395_A1830/VC395_2354 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KPX4 1.3e-52 175 42 3 220 3 VC_2238 UPF0294 protein VC_2238 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LPP2 1.3e-52 175 42 3 220 3 VCM66_2161 UPF0294 protein VCM66_2161 Vibrio cholerae serotype O1 (strain M66-2)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13945
Feature type CDS
Gene -
Product endonuclease/exonuclease/phosphatase family protein
Location 424487 - 425272 (strand: -1)
Length 786 (nucleotides) / 261 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2360
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03372 Endonuclease/Exonuclease/phosphatase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3021 General function prediction only (R) R Uncharacterized conserved protein YafD, endonuclease/exonuclease/phosphatase (EEP) superfamily

Protein Sequence

MNKKKTWSVRYVAGLPAQQIPPMSADMLGSRLPVGLPISTPAQPIRVVVWNIYKQQRPDWQKTLDKLLCDTQLALLQEAQPSPGLVNLSAKHQLIADQVPALRFQQHPSGVMTLATSHPIYCCPLQQKEPLLRLAKSALITVYPLPDGRQLMVINVHAINFSFGVDVYRRQLNTIGSQIRCHIGPVIMGGDFNAWSRQRINILKRFARTLRLKEVIFPVDIRTRVFGHPLDYLFYRGFKLIQSDVMLTDASDHHPLIAEFQ

Flanking regions ( +/- flanking 50bp)

GATAACAGACACAGATAACGGGTATATACCCAAATAGCCTGAGGGTCGTATTGAACAAGAAAAAAACCTGGTCAGTCCGCTATGTTGCGGGGCTTCCGGCTCAGCAAATTCCACCTATGTCAGCAGATATGTTGGGATCCCGGCTTCCGGTAGGTTTACCTATCTCCACACCGGCGCAACCTATTCGTGTTGTCGTCTGGAATATCTATAAGCAGCAGCGCCCAGACTGGCAGAAGACGCTTGATAAACTCCTGTGTGACACACAACTTGCGTTATTACAGGAAGCTCAGCCATCACCGGGATTGGTTAATCTCTCGGCAAAACATCAGCTTATTGCTGATCAGGTTCCTGCGCTCCGCTTTCAGCAGCACCCTTCAGGTGTAATGACACTTGCAACTTCGCATCCTATCTATTGCTGTCCGCTACAGCAAAAAGAGCCATTATTACGTCTGGCAAAATCGGCCCTGATTACGGTTTATCCGTTACCGGATGGTCGCCAACTGATGGTAATAAATGTCCATGCAATTAATTTTAGTTTTGGTGTGGATGTGTACCGCCGCCAGTTAAATACGATTGGTTCGCAGATCCGTTGTCATATCGGACCGGTTATTATGGGTGGGGATTTTAATGCCTGGAGCAGGCAGCGAATAAATATATTGAAAAGGTTCGCCCGTACCCTGCGTCTGAAAGAAGTTATTTTCCCTGTTGATATCCGCACCAGGGTATTCGGGCATCCGCTGGACTATTTATTTTATCGCGGATTCAAATTGATACAGTCAGATGTCATGCTGACTGATGCGTCGGACCATCATCCTTTGATTGCAGAATTTCAATAATAAGAACCACATCATATAAATGATATATTAATATAAATTATGTAAGTAAA