Homologs in group_2394

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19040 FBDBKF_19040 65.8 Morganella morganii S1 yafD endonuclease/exonuclease/phosphatase family protein
EHELCC_18785 EHELCC_18785 65.8 Morganella morganii S2 yafD endonuclease/exonuclease/phosphatase family protein
NLDBIP_18520 NLDBIP_18520 65.8 Morganella morganii S4 yafD endonuclease/exonuclease/phosphatase family protein
LHKJJB_18655 LHKJJB_18655 65.8 Morganella morganii S3 yafD endonuclease/exonuclease/phosphatase family protein
HKOGLL_18390 HKOGLL_18390 65.8 Morganella morganii S5 yafD endonuclease/exonuclease/phosphatase family protein
F4V73_RS13945 F4V73_RS13945 63.8 Morganella psychrotolerans - endonuclease/exonuclease/phosphatase family protein

Distribution of the homologs in the orthogroup group_2394

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2394

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5FJ53 4.11e-120 346 61 0 259 3 yafD UPF0294 protein YafD Salmonella dublin (strain CT_02021853)
B5Y1G7 7.08e-120 345 60 0 259 3 KPK_4510 UPF0294 protein KPK_4510 Klebsiella pneumoniae (strain 342)
B4TYG5 8.18e-120 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella schwarzengrund (strain CVM19633)
B4TK80 8.18e-120 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella heidelberg (strain SL476)
Q57T01 8.18e-120 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella choleraesuis (strain SC-B67)
B5F8W7 8.18e-120 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella agona (strain SL483)
Q8Z985 1.02e-119 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella typhi
Q8ZRM4 1.12e-119 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SV34 1.12e-119 345 61 0 259 3 yafD UPF0294 protein YafD Salmonella newport (strain SL254)
Q7N8M0 1.44e-119 345 63 3 261 3 plu0699 UPF0294 protein plu0699 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C0Q6M7 3.54e-119 344 61 0 259 3 yafD UPF0294 protein YafD Salmonella paratyphi C (strain RKS4594)
A4W6U9 8.79e-119 343 59 0 259 3 Ent638_0743 UPF0294 protein Ent638_0743 Enterobacter sp. (strain 638)
Q32JQ4 2.93e-118 342 61 0 259 3 yafD UPF0294 protein YafD Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z5F4 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Shigella sonnei (strain Ss046)
P0A8U5 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Shigella flexneri
Q0T805 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Shigella flexneri serotype 5b (strain 8401)
Q325T7 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Shigella boydii serotype 4 (strain Sb227)
B7LW84 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LHL8 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain SMS-3-5 / SECEC)
B7N871 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8U2 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12)
B1IPU9 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8U3 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1XD73 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12 / DH10B)
C4ZRU6 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain K12 / MC4100 / BW2952)
B7M208 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O8 (strain IAI1)
B7MP64 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O81 (strain ED1a)
B7NKW9 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0I3 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8U4 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O157:H7
B7LHB5 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli (strain 55989 / EAEC)
B7MBI5 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJA5 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZHU5 4.95e-118 341 61 0 259 3 yafD UPF0294 protein YafD Escherichia coli O139:H28 (strain E24377A / ETEC)
A1JKA7 3.71e-117 338 62 1 257 3 YE0917 UPF0294 protein YE0917 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZH34 5.53e-116 335 60 1 257 3 YPO1077 UPF0294 protein YPO1077/y3099/YP_2772 Yersinia pestis
A7FFK3 5.53e-116 335 60 1 257 3 YpsIP31758_1050 UPF0294 protein YpsIP31758_1050 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VIE6 5.34e-113 328 58 0 259 3 ETA_26410 UPF0294 protein ETA_26410 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q87MF7 1.24e-66 211 46 1 224 3 VP2298 UPF0294 protein VP2298 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MY11 1.63e-66 211 45 1 224 3 VIBHAR_03217 UPF0294 protein VIBHAR_03217 Vibrio campbellii (strain ATCC BAA-1116)
Q7MII1 1.21e-62 201 45 1 221 3 VV2535 UPF0294 protein VV2535 Vibrio vulnificus (strain YJ016)
Q8DBE1 1.23e-61 198 44 1 221 3 VV1_1880 UPF0294 protein VV1_1880 Vibrio vulnificus (strain CMCP6)
A5F637 2.03e-59 192 46 3 222 3 VC0395_A1830 UPF0294 protein VC0395_A1830/VC395_2354 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KPX4 2.03e-59 192 46 3 222 3 VC_2238 UPF0294 protein VC_2238 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LPP2 2.03e-59 192 46 3 222 3 VCM66_2161 UPF0294 protein VCM66_2161 Vibrio cholerae serotype O1 (strain M66-2)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11120
Feature type CDS
Gene -
Product endonuclease/exonuclease/phosphatase family protein
Location 2447528 - 2448313 (strand: -1)
Length 786 (nucleotides) / 261 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2394
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03372 Endonuclease/Exonuclease/phosphatase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3021 General function prediction only (R) R Uncharacterized conserved protein YafD, endonuclease/exonuclease/phosphatase (EEP) superfamily

Protein Sequence

MAKKPTYSVRFVAGQPVERIEPSLPLGQIEEMLPIGMPLYTEGTLKIAVWNIYKQQRVNWRSMLETLATDTQLLLLQEAQTTPELVRFAGKNHLIADQVPALAFQQHPAGVMTLSSSHPIYCCPLREKEPFLRLAKSALITVYPLITGEHLMVINVHAINFSFGVDVYQRQLNSLSTHIIDHKGPVILAGDFNAWSRPRVNVLKRFARRLKLKEVIFEKDLRTRAFGKPLDYIFYRGLSLNKAEILITDASDHNPLVATFS

Flanking regions ( +/- flanking 50bp)

GTATACTAGATAGGTAGCAAGAGATCCTATTGGTTATCTGAGGTTGCTTAATGGCGAAAAAACCGACTTATTCAGTACGTTTTGTAGCAGGTCAACCTGTAGAAAGGATTGAACCTAGTCTACCTTTAGGCCAAATAGAAGAGATGCTACCGATTGGGATGCCACTATATACAGAAGGCACTTTAAAAATTGCTGTTTGGAATATTTACAAACAGCAACGGGTCAATTGGCGTAGTATGCTGGAAACGCTTGCCACCGATACTCAACTATTACTTTTACAAGAAGCGCAAACAACACCTGAATTAGTTCGTTTTGCGGGTAAAAACCATTTAATTGCTGATCAAGTTCCTGCTTTAGCCTTTCAACAGCACCCTGCGGGTGTTATGACCTTATCAAGTTCTCATCCTATCTATTGTTGCCCATTAAGAGAAAAAGAGCCTTTTTTAAGGCTTGCTAAATCTGCATTAATTACGGTTTATCCACTTATTACTGGTGAGCATTTAATGGTGATAAATGTACACGCGATCAATTTTAGTTTCGGTGTTGATGTTTATCAAAGACAATTAAACAGCTTATCGACTCATATCATCGATCATAAAGGGCCTGTTATTTTGGCGGGGGATTTTAACGCTTGGAGTCGTCCAAGAGTTAATGTGTTAAAGCGTTTTGCTAGAAGATTAAAACTTAAAGAAGTGATCTTTGAAAAGGATTTACGCACTCGCGCTTTTGGTAAGCCACTTGATTATATATTTTATCGTGGATTATCACTAAATAAAGCGGAAATCTTAATCACAGATGCATCTGATCATAATCCTTTGGTGGCGACCTTTTCTTAACTCGTGATAATAACATTCGTTAATATTAAAATATAAATATTTTAATATAA