Homologs in group_377

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18770 FBDBKF_18770 69.5 Morganella morganii S1 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
FBDBKF_20460 FBDBKF_20460 45.2 Morganella morganii S1 tetC tetracyline resistance-associated transcriptional repressor TetC
EHELCC_16965 EHELCC_16965 69.5 Morganella morganii S2 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
NLDBIP_18345 NLDBIP_18345 69.5 Morganella morganii S4 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
LHKJJB_09280 LHKJJB_09280 69.5 Morganella morganii S3 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
HKOGLL_08830 HKOGLL_08830 69.5 Morganella morganii S5 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
PMI_RS05690 PMI_RS05690 40.7 Proteus mirabilis HI4320 - TetR family transcriptional regulator

Distribution of the homologs in the orthogroup group_377

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_377

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P28815 3.34e-54 174 45 0 195 1 tetC Transposon Tn10 TetC protein Escherichia coli
Q3J6K8 3.37e-07 52 39 2 71 1 acuR Transcriptional regulator AcuR Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9RAJ1 4.45e-07 51 36 5 99 4 dhaR HTH-type transcriptional repressor DhaR Mycobacterium sp. (strain GP1)
O34643 3.01e-06 49 26 6 161 4 yvkB Uncharacterized HTH-type transcriptional regulator YvkB Bacillus subtilis (strain 168)
P96676 3.71e-06 48 34 2 81 4 ydeS Uncharacterized HTH-type transcriptional regulator YdeS Bacillus subtilis (strain 168)
A0R666 1.66e-05 47 28 1 89 1 ethR HTH-type transcriptional regulator EthR Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0ACT1 2.94e-05 46 37 0 59 3 acrR HTH-type transcriptional regulator AcrR Shigella flexneri
P0ACS9 2.94e-05 46 37 0 59 1 acrR HTH-type transcriptional regulator AcrR Escherichia coli (strain K12)
P0ACT0 2.94e-05 46 37 0 59 3 acrR HTH-type transcriptional regulator AcrR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39897 3.97e-05 46 32 3 102 1 mtrR HTH-type transcriptional regulator MtrR Neisseria gonorrhoeae
P39601 5e-05 45 40 0 52 4 ywcC Uncharacterized HTH-type transcriptional regulator YwcC Bacillus subtilis (strain 168)
Q8G2M8 5.57e-05 45 43 0 51 1 bepR HTH-type transcriptional repressor BepR Brucella suis biovar 1 (strain 1330)
P40950 5.57e-05 46 42 0 45 4 yuxN Uncharacterized HTH-type transcriptional regulator YuxN Bacillus subtilis (strain 168)
O31500 0.000182 44 38 0 49 4 yerO Uncharacterized HTH-type transcriptional regulator YerO Bacillus subtilis (strain 168)
Q93PU7 0.000277 42 39 0 48 1 ttgW Uncharacterized HTH-type transcriptional regulator TtgW Pseudomonas putida (strain DOT-T1E)
Q9R9T9 0.000305 43 39 0 48 1 srpR HTH-type transcriptional regulator SrpR Pseudomonas putida
O33453 0.000321 43 31 2 97 2 cymR HTH-type transcriptional regulator CymR Pseudomonas putida
P94548 0.000343 43 25 1 97 1 fadR Fatty acid metabolism regulator protein Bacillus subtilis (strain 168)
P32398 0.000656 42 28 0 71 4 yhgD Uncharacterized HTH-type transcriptional regulator YhgD Bacillus subtilis (strain 168)
P9WMB9 0.000809 42 30 2 93 1 kstR2 HTH-type transcriptional repressor KstR2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMB8 0.000809 42 30 2 93 3 kstR2 HTH-type transcriptional repressor KstR2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13820
Feature type CDS
Gene -
Product TetR/AcrR family transcriptional regulator
Location 398406 - 399005 (strand: -1)
Length 600 (nucleotides) / 199 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_377
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19047 TetR/AcrR family transcriptional regulator, repressor of tetCD - -

Protein Sequence

MNTLTGQQESSARTRLALLNSAHQLFIEKSYQAVSVDEIARDARVTKGAFYHHFKNKRDVLLHCYEAQLQRISARLDAIVPPADKWQELEDIVSCFIDYLQGHYRGLIPIQEVMPVLGWYEFEHINQCYISGRVDSILSELKAERCIKNYNIDLLCSLIHGFMSHITLNIKNLVDYPGFKENFIEIYNNFLQTLRKTPG

Flanking regions ( +/- flanking 50bp)

TACTGTGATACGATTACATACCAGCGGTATGTAACAGGGTTATATTTACCATGAACACATTGACCGGGCAACAGGAAAGTTCAGCGCGAACGCGCCTGGCATTGCTCAATTCGGCTCATCAGCTTTTTATTGAAAAGAGCTATCAGGCGGTTTCTGTTGATGAAATTGCCCGTGATGCCCGGGTAACAAAGGGCGCTTTTTATCATCACTTTAAAAATAAACGTGATGTGTTACTGCACTGCTATGAAGCACAATTACAGCGGATAAGCGCCCGGCTTGATGCCATTGTGCCGCCGGCGGATAAATGGCAGGAACTGGAAGACATTGTCAGTTGTTTTATTGATTACCTGCAGGGGCATTACCGCGGGCTTATTCCGATTCAGGAAGTTATGCCTGTGCTCGGCTGGTATGAATTTGAACATATTAACCAGTGTTATATCAGCGGGCGGGTTGATAGTATTCTCAGTGAGCTGAAAGCAGAGCGCTGTATTAAAAATTATAACATCGATCTGCTGTGCAGCTTAATTCACGGCTTTATGAGCCATATAACGCTCAATATTAAAAATCTGGTCGATTATCCGGGTTTTAAAGAAAATTTCATTGAAATTTATAACAATTTTCTGCAAACACTAAGGAAAACCCCCGGCTAAGAGGGATTTTTAAATGTCATATGAAGTATTTTCAGCCCGACCATTCCGAG