Homologs in group_2343

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18805 FBDBKF_18805 82.0 Morganella morganii S1 htpX Zn-dependent protease with chaperone function
EHELCC_17000 EHELCC_17000 82.0 Morganella morganii S2 htpX Zn-dependent protease with chaperone function
NLDBIP_18380 NLDBIP_18380 82.0 Morganella morganii S4 htpX Zn-dependent protease with chaperone function
LHKJJB_09245 LHKJJB_09245 82.0 Morganella morganii S3 htpX Zn-dependent protease with chaperone function
HKOGLL_08795 HKOGLL_08795 82.0 Morganella morganii S5 htpX Zn-dependent protease with chaperone function
PMI_RS17980 PMI_RS17980 70.4 Proteus mirabilis HI4320 - M48 family metallopeptidase

Distribution of the homologs in the orthogroup group_2343

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2343

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P25894 8.7e-110 319 60 1 249 1 loiP Metalloprotease LoiP Escherichia coli (strain K12)
P43674 9.97e-103 301 59 2 250 1 ycaL Metalloprotease YcaL Escherichia coli (strain K12)
Q8ZCC3 5.29e-10 62 26 10 225 3 bepA Beta-barrel assembly-enhancing protease Yersinia pestis
P66949 5.1e-08 56 25 8 191 3 bepA Beta-barrel assembly-enhancing protease Shigella flexneri
P66948 5.1e-08 56 25 8 191 1 bepA Beta-barrel assembly-enhancing protease Escherichia coli (strain K12)
P44840 5.56e-08 55 29 7 189 3 htpX Protease HtpX Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHK2 5.56e-08 55 29 7 189 3 htpX Protease HtpX Haemophilus influenzae (strain PittGG)
Q4QMJ9 5.72e-08 55 29 7 189 3 htpX Protease HtpX Haemophilus influenzae (strain 86-028NP)
Q48V70 6.33e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0DD31 6.45e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD30 6.45e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A5UE05 6.71e-08 55 29 7 189 3 htpX Protease HtpX Haemophilus influenzae (strain PittEE)
B5XJV3 7.08e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M49 (strain NZ131)
A2RGB7 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J8D6 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JII1 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JND2 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q8P2K0 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9A1D5 7.21e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M1
Q5XDS0 7.42e-08 55 25 8 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8XAD2 8.79e-08 55 25 8 191 3 bepA Beta-barrel assembly-enhancing protease Escherichia coli O157:H7
B0UUC9 9.84e-08 55 29 8 185 3 htpX Protease HtpX Histophilus somni (strain 2336)
Q8DY66 3.92e-07 53 26 9 203 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZQ9 3.92e-07 53 26 9 203 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E3T2 4.43e-07 53 26 9 203 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype III (strain NEM316)
Q3SZN3 8.79e-07 52 24 8 186 2 OMA1 Metalloendopeptidase OMA1, mitochondrial Bos taurus
Q9PA93 1.25e-06 52 26 6 188 2 htpX Protease HtpX Xylella fastidiosa (strain 9a5c)
B9DTP5 1.56e-06 51 26 9 203 3 htpX Protease HtpX homolog Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q12MB4 2.22e-06 51 29 8 191 3 htpX Protease HtpX Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q3JE43 2.38e-06 51 25 7 192 3 htpX Protease HtpX Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B0U5X0 2.93e-06 50 26 6 188 3 htpX Protease HtpX Xylella fastidiosa (strain M12)
Q87A36 3.07e-06 50 26 6 188 3 htpX Protease HtpX Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA62 3.07e-06 50 26 6 188 3 htpX Protease HtpX Xylella fastidiosa (strain M23)
D3ZS74 3.43e-06 51 22 9 215 1 Oma1 Metalloendopeptidase OMA1, mitochondrial Rattus norvegicus
A1JM73 6.36e-06 49 27 8 192 3 htpX Protease HtpX Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JIC9 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669V7 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLG5 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pestis (strain Pestoides F)
Q1CIC7 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pestis bv. Antiqua (strain Nepal516)
A9R0E2 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFJ7 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pestis
B2K6A2 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6Z1 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHC3 6.54e-06 49 30 9 192 3 htpX Protease HtpX Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2FN30 7.87e-06 49 27 5 185 3 htpX Protease HtpX Stenotrophomonas maltophilia (strain K279a)
B4SQB7 8.8e-06 49 27 5 185 3 htpX Protease HtpX Stenotrophomonas maltophilia (strain R551-3)
B8F543 9.65e-06 49 27 9 190 3 htpX Protease HtpX Glaesserella parasuis serovar 5 (strain SH0165)
B0BPX8 1.1e-05 49 25 6 186 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1S0 1.1e-05 49 25 6 186 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N147 1.1e-05 49 25 6 186 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A4WBI8 1.22e-05 48 26 6 192 3 htpX Protease HtpX Enterobacter sp. (strain 638)
Q7VNX2 1.43e-05 48 26 8 191 3 htpX Protease HtpX Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A8FX04 1.64e-05 48 29 9 190 3 htpX Protease HtpX Shewanella sediminis (strain HAW-EB3)
A8AFM2 1.89e-05 48 27 8 192 3 htpX Protease HtpX Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P23894 2.2e-05 48 27 8 192 1 htpX Protease HtpX Escherichia coli (strain K12)
B1XH97 2.2e-05 48 27 8 192 3 htpX Protease HtpX Escherichia coli (strain K12 / DH10B)
C4ZZI6 2.2e-05 48 27 8 192 3 htpX Protease HtpX Escherichia coli (strain K12 / MC4100 / BW2952)
B7USK6 2.36e-05 48 27 8 192 3 htpX Protease HtpX Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C0MG49 2.44e-05 48 25 9 204 3 htpX Protease HtpX homolog Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4T2 2.44e-05 48 25 9 204 3 htpX Protease HtpX homolog Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q3Z2G8 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella sonnei (strain Ss046)
P65814 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella flexneri
Q0T522 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella flexneri serotype 5b (strain 8401)
Q32F28 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella dysenteriae serotype 1 (strain Sd197)
Q321Y6 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella boydii serotype 4 (strain Sb227)
B2U471 2.64e-05 48 27 7 192 3 htpX Protease HtpX Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RAV8 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli (strain UTI89 / UPEC)
B1LD43 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli (strain SMS-3-5 / SECEC)
B6IBQ7 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli (strain SE11)
B7NBH7 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1J0Q9 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P65812 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TH03 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABZ5 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O1:K1 / APEC
A8A127 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O9:H4 (strain HS)
B7M2A5 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O8 (strain IAI1)
B7MVV9 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O81 (strain ED1a)
B7NS90 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQX2 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O157:H7 (strain EC4115 / EHEC)
P65813 2.64e-05 48 27 7 192 2 htpX Protease HtpX Escherichia coli O157:H7
B7L7N1 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli (strain 55989 / EAEC)
B7MBN6 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZMV2 2.64e-05 48 27 7 192 3 htpX Protease HtpX Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LPL6 2.66e-05 48 26 8 194 3 htpX Protease HtpX Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O31657 2.71e-05 48 27 7 184 3 htpX Protease HtpX homolog Bacillus subtilis (strain 168)
A3QDP2 3.44e-05 47 28 8 188 3 htpX Protease HtpX Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9D8H7 3.59e-05 48 27 4 126 1 Oma1 Metalloendopeptidase OMA1, mitochondrial Mus musculus
B5XQ41 3.83e-05 47 27 9 195 3 htpX Protease HtpX Klebsiella pneumoniae (strain 342)
A8GDN1 4.02e-05 47 26 7 191 3 htpX Protease HtpX Serratia proteamaculans (strain 568)
A9L578 5.21e-05 47 28 8 190 3 htpX Protease HtpX Shewanella baltica (strain OS195)
A3D5N7 5.21e-05 47 28 8 190 3 htpX Protease HtpX Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E719 5.21e-05 47 28 8 190 3 htpX Protease HtpX Shewanella baltica (strain OS223)
Q96E52 5.37e-05 47 22 7 181 1 OMA1 Metalloendopeptidase OMA1, mitochondrial Homo sapiens
Q083Z6 5.82e-05 47 28 8 191 3 htpX Protease HtpX Shewanella frigidimarina (strain NCIMB 400)
A6WPJ1 6.27e-05 47 28 8 190 3 htpX Protease HtpX Shewanella baltica (strain OS185)
A6SXH1 6.75e-05 46 26 5 170 3 htpX Protease HtpX homolog Janthinobacterium sp. (strain Marseille)
Q9K9E6 8.3e-05 46 32 5 128 3 htpX Protease HtpX homolog Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1LTF8 9.35e-05 46 26 5 188 3 htpX Protease HtpX Baumannia cicadellinicola subsp. Homalodisca coagulata
Q8EDL5 9.49e-05 46 28 8 192 3 htpX Protease HtpX Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2NTD3 9.67e-05 46 25 6 192 3 htpX Protease HtpX Sodalis glossinidius (strain morsitans)
A8FCF7 0.00011 46 26 5 184 3 htpX Protease HtpX homolog Bacillus pumilus (strain SAFR-032)
Q65TG9 0.000118 45 28 7 182 3 htpX Protease HtpX Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P65817 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65818 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella typhi
B4TY12 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella schwarzengrund (strain CVM19633)
B5BHB2 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella paratyphi A (strain AKU_12601)
C0Q2Z1 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella paratyphi C (strain RKS4594)
Q5PHN9 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SV83 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella newport (strain SL254)
B4TKH4 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella heidelberg (strain SL476)
B5R8V8 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2S7 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella enteritidis PT4 (strain P125109)
B5FTJ0 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella dublin (strain CT_02021853)
Q57NG5 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella choleraesuis (strain SC-B67)
A9MNI0 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F3P9 0.000127 45 26 8 194 3 htpX Protease HtpX Salmonella agona (strain SL483)
Q9KQ40 0.000133 46 22 6 197 3 VC_2164 Putative beta-barrel assembly-enhancing protease Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0KY72 0.000141 45 27 8 192 3 htpX Protease HtpX Shewanella sp. (strain ANA-3)
A7MKG5 0.000144 45 26 9 194 3 htpX Protease HtpX Cronobacter sakazakii (strain ATCC BAA-894)
Q04WP4 0.00016 45 22 8 216 3 htpX Protease HtpX homolog Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04NG2 0.00016 45 22 8 216 3 htpX Protease HtpX homolog Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q0HTZ7 0.000169 45 27 8 192 3 htpX Protease HtpX Shewanella sp. (strain MR-7)
Q0HHP5 0.000169 45 27 8 192 3 htpX Protease HtpX Shewanella sp. (strain MR-4)
A7Z3W3 0.000174 45 28 7 183 3 htpX Protease HtpX homolog Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P57846 0.000175 45 26 7 180 3 htpX Protease HtpX Pasteurella multocida (strain Pm70)
B8GTV4 0.000203 45 25 6 187 3 htpX Protease HtpX Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1WYI3 0.000211 45 26 8 190 3 htpX Protease HtpX Halorhodospira halophila (strain DSM 244 / SL1)
Q7N3N4 0.000222 45 27 7 192 3 htpX Protease HtpX Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VJ57 0.000236 45 28 8 192 3 htpX Protease HtpX Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6TB00 0.000257 45 26 9 195 3 htpX Protease HtpX Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8H3J1 0.000265 45 28 9 190 3 htpX Protease HtpX Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8P8F0 0.000287 45 25 7 187 3 htpX Protease HtpX Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RS04 0.000287 45 25 7 187 3 htpX Protease HtpX Xanthomonas campestris pv. campestris (strain B100)
Q4UVN7 0.000287 45 25 7 187 3 htpX Protease HtpX Xanthomonas campestris pv. campestris (strain 8004)
B4ETJ0 0.000324 44 25 6 190 3 htpX Protease HtpX Proteus mirabilis (strain HI4320)
A1RIL6 0.000343 44 27 8 192 3 htpX Protease HtpX Shewanella sp. (strain W3-18-1)
A4Y7X2 0.000343 44 27 8 192 3 htpX Protease HtpX Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8PJX8 0.000348 44 26 6 187 3 htpX Protease HtpX Xanthomonas axonopodis pv. citri (strain 306)
B8FG65 0.000372 44 25 6 197 3 htpX Protease HtpX homolog Desulfatibacillum aliphaticivorans
Q8EXN4 0.000403 44 23 8 222 3 htpX Protease HtpX homolog Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q75FP1 0.000403 44 23 8 222 3 htpX Protease HtpX homolog Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q83IG0 0.000624 43 28 3 125 3 htpX Protease HtpX homolog Tropheryma whipplei (strain TW08/27)
Q93D93 0.000626 43 25 10 203 3 htpX Protease HtpX homolog Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A7GZM4 0.000774 43 35 4 91 3 htpX Protease HtpX homolog Campylobacter curvus (strain 525.92)
B2SHQ4 0.00078 43 26 6 187 3 htpX Protease HtpX Xanthomonas oryzae pv. oryzae (strain PXO99A)
C6DFY1 0.000782 43 25 8 191 3 htpX Protease HtpX Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q5GZ91 0.000794 43 26 6 187 3 htpX Protease HtpX Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P2A1 0.000794 43 26 6 187 3 htpX Protease HtpX Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5QZ20 0.000827 43 28 8 187 3 htpX Protease HtpX Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A6Q7D4 0.000893 43 41 1 55 3 htpX Protease HtpX homolog Sulfurovum sp. (strain NBC37-1)
A8EV91 0.001 43 33 4 90 3 htpX Protease HtpX homolog Aliarcobacter butzleri (strain RM4018)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13790
Feature type CDS
Gene -
Product M48 family metallopeptidase
Location 390909 - 391661 (strand: -1)
Length 753 (nucleotides) / 250 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2343
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01435 Peptidase family M48

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0501 Posttranslational modification, protein turnover, chaperones (O) O Zn-dependent protease with chaperone function

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07387 metalloprotease [EC:3.4.24.-] - -

Protein Sequence

MKLKTALAIALTTTVLAGCQNMNYDALAQSGGQLFQAATLTDADMVKLTDGACKEMDAQNKIAPASSKYTARMNKIAKSLGSNIDGTNVNYKVYMTEDVNAWAMANGCVRVYSGLMDMMTDNEIEGVLGHEIGHVSLGHSRKAMQVAYGTVAAKTAAGSAGGVASQLSNSQFADMGVKLVNSQFSQHQESEADNYSYDLLKKRNISTEGLATGFEKFAALDKGKSSMFDSHPPSTERAENIRNRIAKDKK

Flanking regions ( +/- flanking 50bp)

TTTCTGAGAGGTTACATAAAGCTAATTAATAATAAATGGATAGGGAAATGATGAAACTGAAAACAGCTCTGGCTATTGCATTAACAACAACAGTACTTGCAGGGTGCCAGAACATGAATTATGACGCGCTGGCGCAATCCGGCGGACAGTTATTTCAGGCCGCAACATTAACGGATGCGGATATGGTGAAACTGACTGACGGCGCCTGTAAAGAAATGGATGCGCAGAACAAGATTGCACCGGCATCAAGTAAATACACTGCCCGTATGAATAAAATTGCCAAATCATTAGGCTCTAATATTGATGGCACCAATGTTAACTATAAAGTGTATATGACAGAAGATGTGAATGCCTGGGCAATGGCAAATGGCTGTGTGCGCGTATACAGCGGCCTGATGGACATGATGACTGACAATGAAATTGAAGGTGTTCTGGGTCATGAAATCGGTCACGTTTCCCTTGGTCACTCCCGTAAAGCGATGCAGGTTGCTTACGGCACCGTTGCAGCAAAAACAGCGGCAGGCTCTGCCGGTGGTGTTGCGTCACAGCTGAGCAACTCTCAGTTTGCTGATATGGGTGTGAAGTTAGTGAATTCGCAGTTCTCTCAGCATCAGGAATCAGAAGCGGATAATTACTCTTACGATCTGCTGAAAAAACGCAATATTTCTACTGAAGGGCTGGCAACCGGGTTTGAAAAATTTGCCGCTCTGGATAAAGGCAAGAGCAGCATGTTTGACTCTCACCCGCCATCAACTGAGCGCGCTGAGAATATCCGCAACAGAATTGCGAAAGATAAAAAATAAGTATCAGCGTCTTTGATGTAAAAAGAAATGATGCAAAAGAAAAAGTGATA