Homologs in group_2377

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18805 FBDBKF_18805 69.6 Morganella morganii S1 htpX Zn-dependent protease with chaperone function
EHELCC_17000 EHELCC_17000 69.6 Morganella morganii S2 htpX Zn-dependent protease with chaperone function
NLDBIP_18380 NLDBIP_18380 69.6 Morganella morganii S4 htpX Zn-dependent protease with chaperone function
LHKJJB_09245 LHKJJB_09245 69.6 Morganella morganii S3 htpX Zn-dependent protease with chaperone function
HKOGLL_08795 HKOGLL_08795 69.6 Morganella morganii S5 htpX Zn-dependent protease with chaperone function
F4V73_RS13790 F4V73_RS13790 70.4 Morganella psychrotolerans - M48 family metallopeptidase

Distribution of the homologs in the orthogroup group_2377

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2377

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P25894 2.62e-115 333 63 1 249 1 loiP Metalloprotease LoiP Escherichia coli (strain K12)
P43674 3.37e-110 320 61 2 250 1 ycaL Metalloprotease YcaL Escherichia coli (strain K12)
Q8ZCC3 4.7e-12 68 28 8 221 3 bepA Beta-barrel assembly-enhancing protease Yersinia pestis
Q9KQ40 1.03e-08 58 24 8 258 3 VC_2164 Putative beta-barrel assembly-enhancing protease Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P66949 1.48e-08 58 25 7 189 3 bepA Beta-barrel assembly-enhancing protease Shigella flexneri
P66948 1.48e-08 58 25 7 189 1 bepA Beta-barrel assembly-enhancing protease Escherichia coli (strain K12)
Q8XAD2 2.39e-08 57 25 7 189 3 bepA Beta-barrel assembly-enhancing protease Escherichia coli O157:H7
Q48V70 4.64e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RGB7 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J8D6 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JII1 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JND2 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q8P2K0 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q9A1D5 5.1e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M1
B5XJV3 5.29e-08 56 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M49 (strain NZ131)
P0DD31 5.45e-08 55 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD30 5.45e-08 55 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5XDS0 6.69e-08 55 25 6 204 3 htpX Protease HtpX homolog Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
E9QBI7 1.6e-07 55 22 5 179 3 oma1 Metalloendopeptidase OMA1, mitochondrial Danio rerio
Q4QMJ9 1.82e-07 54 26 8 198 3 htpX Protease HtpX Haemophilus influenzae (strain 86-028NP)
P44840 1.98e-07 54 26 8 198 3 htpX Protease HtpX Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHK2 1.98e-07 54 26 8 198 3 htpX Protease HtpX Haemophilus influenzae (strain PittGG)
A5UE05 2.11e-07 54 26 8 198 3 htpX Protease HtpX Haemophilus influenzae (strain PittEE)
Q7VNX2 2.82e-07 53 27 9 203 3 htpX Protease HtpX Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8DY66 2.91e-07 53 25 7 202 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZQ9 2.91e-07 53 25 7 202 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E3T2 3.05e-07 53 25 7 202 3 htpX Protease HtpX homolog Streptococcus agalactiae serotype III (strain NEM316)
P66950 5.91e-07 53 25 6 170 3 bepA Beta-barrel assembly-enhancing protease Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66951 5.91e-07 53 25 6 170 3 bepA Beta-barrel assembly-enhancing protease Salmonella typhi
B0UUC9 6.64e-07 52 27 8 196 3 htpX Protease HtpX Histophilus somni (strain 2336)
Q9FLI5 6.9e-07 53 29 5 145 2 OMA1 Mitochondrial metalloendopeptidase OMA1 Arabidopsis thaliana
O30795 7.49e-07 52 26 7 202 2 htpX Protease HtpX homolog Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B0BPX8 9.25e-07 52 26 7 195 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1S0 9.25e-07 52 26 7 195 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N147 9.25e-07 52 26 7 195 3 htpX Protease HtpX Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F543 1.19e-06 52 26 8 198 3 htpX Protease HtpX Glaesserella parasuis serovar 5 (strain SH0165)
A3CLJ7 2.89e-06 50 25 6 204 3 htpX Protease HtpX homolog Streptococcus sanguinis (strain SK36)
Q8DPH5 3.3e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B1IC73 3.3e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain Hungary19A-6)
Q04K41 3.3e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CEN8 3.53e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain JJA)
B8ZJU7 3.53e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7R3 3.53e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain 70585)
B5E520 3.53e-06 50 24 6 205 3 htpX Protease HtpX homolog Streptococcus pneumoniae serotype 19F (strain G54)
A1VSW7 3.56e-06 50 27 5 168 3 htpX Protease HtpX homolog Polaromonas naphthalenivorans (strain CJ2)
Q3SZN3 4.14e-06 50 23 6 180 2 OMA1 Metalloendopeptidase OMA1, mitochondrial Bos taurus
Q97QD6 4.2e-06 50 25 6 204 3 htpX Protease HtpX homolog Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9PA93 4.29e-06 50 27 7 194 2 htpX Protease HtpX Xylella fastidiosa (strain 9a5c)
D3ZS74 4.35e-06 50 24 6 179 1 Oma1 Metalloendopeptidase OMA1, mitochondrial Rattus norvegicus
Q21ST3 4.52e-06 50 28 7 167 3 htpX Protease HtpX homolog Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
C1CR23 5.76e-06 50 24 6 204 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain Taiwan19F-14)
B9DTP5 6.63e-06 49 27 7 202 3 htpX Protease HtpX homolog Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A1WYI3 7.69e-06 49 26 10 234 3 htpX Protease HtpX Halorhodospira halophila (strain DSM 244 / SL1)
C0MG49 7.76e-06 49 24 7 203 3 htpX Protease HtpX homolog Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4T2 7.76e-06 49 24 7 203 3 htpX Protease HtpX homolog Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B4SQB7 8.72e-06 49 28 7 192 3 htpX Protease HtpX Stenotrophomonas maltophilia (strain R551-3)
B2FN30 8.8e-06 49 28 7 192 3 htpX Protease HtpX Stenotrophomonas maltophilia (strain K279a)
Q5ZZ31 9.72e-06 49 33 8 154 3 htpX Protease HtpX Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A6SXH1 1.08e-05 49 29 9 181 3 htpX Protease HtpX homolog Janthinobacterium sp. (strain Marseille)
A0LHQ9 1.32e-05 48 25 7 203 3 htpX Protease HtpX homolog Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B0U5X0 1.36e-05 48 27 7 194 3 htpX Protease HtpX Xylella fastidiosa (strain M12)
Q87A36 1.61e-05 48 27 7 194 3 htpX Protease HtpX Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA62 1.61e-05 48 27 7 194 3 htpX Protease HtpX Xylella fastidiosa (strain M23)
C1CL18 1.73e-05 48 23 6 208 3 htpX Protease HtpX homolog Streptococcus pneumoniae (strain P1031)
Q3JE43 2.81e-05 47 28 10 194 3 htpX Protease HtpX Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A9ITD6 3.06e-05 47 31 6 160 3 htpX Protease HtpX homolog Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q04WP4 4.41e-05 47 28 8 191 3 htpX Protease HtpX homolog Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04NG2 4.41e-05 47 28 8 191 3 htpX Protease HtpX homolog Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
C0M819 4.82e-05 47 24 7 203 3 htpX Protease HtpX homolog Streptococcus equi subsp. equi (strain 4047)
Q9P7G4 5.38e-05 47 23 7 216 3 oma1 Mitochondrial metalloendopeptidase OMA1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93D93 5.88e-05 47 26 7 199 3 htpX Protease HtpX homolog Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8EXN4 0.000102 46 28 7 187 3 htpX Protease HtpX homolog Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q75FP1 0.000102 46 28 7 187 3 htpX Protease HtpX homolog Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q83IG0 0.000103 46 28 5 171 3 htpX Protease HtpX homolog Tropheryma whipplei (strain TW08/27)
P57846 0.000111 46 25 8 212 3 htpX Protease HtpX Pasteurella multocida (strain Pm70)
Q9D8H7 0.000113 46 27 3 114 1 Oma1 Metalloendopeptidase OMA1, mitochondrial Mus musculus
C5A5K3 0.00012 45 26 7 177 3 htpX Protease HtpX homolog Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
C5CML1 0.000127 45 27 5 168 3 htpX Protease HtpX homolog Variovorax paradoxus (strain S110)
Q5QZ20 0.00013 45 28 9 198 3 htpX Protease HtpX Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q88Z48 0.000145 45 26 8 204 3 htpX Protease HtpX homolog Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B8FG65 0.000163 45 25 6 203 3 htpX Protease HtpX homolog Desulfatibacillum aliphaticivorans
Q65TG9 0.000179 45 26 6 182 3 htpX Protease HtpX Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C6A335 0.000269 45 23 7 225 3 htpX Protease HtpX homolog Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q83H47 0.00032 44 28 5 171 3 htpX Protease HtpX homolog Tropheryma whipplei (strain Twist)
Q5JEZ8 0.000328 44 25 7 178 3 htpX Protease HtpX homolog Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q96E52 0.000358 45 23 4 117 1 OMA1 Metalloendopeptidase OMA1, mitochondrial Homo sapiens
B8GTV4 0.000371 44 27 9 214 3 htpX Protease HtpX Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A8FX04 0.000646 43 28 7 191 3 htpX Protease HtpX Shewanella sediminis (strain HAW-EB3)
Q38V59 0.00068 43 25 8 203 3 htpX Protease HtpX homolog Latilactobacillus sakei subsp. sakei (strain 23K)
Q3SFQ0 0.000836 43 23 8 265 3 htpX Protease HtpX homolog Thiobacillus denitrificans (strain ATCC 25259)
O31657 0.000876 43 28 7 179 3 htpX Protease HtpX homolog Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17980
Feature type CDS
Gene -
Product M48 family metallopeptidase
Location 3950433 - 3951185 (strand: -1)
Length 753 (nucleotides) / 250 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2377
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01435 Peptidase family M48

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0501 Posttranslational modification, protein turnover, chaperones (O) O Zn-dependent protease with chaperone function

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07387 metalloprotease [EC:3.4.24.-] - -

Protein Sequence

MKIKLLATVMVSAALLSGCKNLDTSMLAQSGTQLFQAATLSDDDVKALTNDACKEMDAKNKIAPANSNYTKRLNNIAKALGNEVNGTPVNYKVYLTKDVNAWAMANGCVRVYSGLMDIMTDNEVEGVLGHEMGHVALGHTRKAIQVAHATVAARTAASSAGGVAAQLSSSQLAEMGEKLVNAQFSQHQETQADNFSYDLLKKRGVNTSGLVTGFEKLAKLGGSDSSMFDSHPPSKERADNIRNRIAEDKK

Flanking regions ( +/- flanking 50bp)

TGTGCAACTAATAATATTAAACTGCTAAGCAGAAAAGGACTTAATTGATAATGAAAATAAAACTACTTGCGACAGTGATGGTATCCGCGGCATTACTCTCTGGCTGTAAAAATCTTGATACTTCTATGTTAGCGCAATCAGGTACACAACTTTTCCAAGCGGCAACATTAAGTGATGACGATGTCAAAGCGCTAACTAATGATGCATGTAAAGAAATGGATGCTAAAAACAAAATTGCACCTGCAAATAGTAACTACACTAAACGCTTAAATAATATCGCGAAAGCGTTAGGTAATGAAGTTAATGGTACTCCAGTAAACTATAAAGTTTATCTCACTAAAGATGTCAATGCATGGGCGATGGCAAACGGCTGTGTGCGTGTTTATAGCGGTTTAATGGACATCATGACTGACAACGAAGTGGAAGGTGTATTGGGTCATGAAATGGGACATGTAGCATTAGGCCATACACGTAAAGCAATCCAAGTAGCACATGCCACCGTTGCGGCACGTACCGCAGCCTCTTCAGCGGGGGGAGTAGCAGCACAATTAAGTAGTTCCCAGTTAGCAGAAATGGGTGAAAAACTGGTTAATGCCCAGTTCTCTCAACACCAAGAAACACAAGCTGATAACTTCTCTTACGATCTGCTGAAAAAACGCGGTGTCAATACTTCAGGCTTAGTGACTGGCTTTGAAAAATTAGCTAAATTAGGTGGTAGTGATTCAAGCATGTTTGATTCTCACCCACCATCAAAAGAGCGTGCTGACAATATTCGTAACCGCATTGCCGAAGATAAAAAATAAACTTTATCGCCCCTATATTTAACCATATGGGGGTTTTCTTTATGCTTTTT