Homologs in group_1304

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07985 FBDBKF_07985 76.8 Morganella morganii S1 arpD ABC-type protease/lipase transport system, ATPase and permease components
EHELCC_13815 EHELCC_13815 76.8 Morganella morganii S2 arpD ABC-type protease/lipase transport system, ATPase and permease components
NLDBIP_14260 NLDBIP_14260 76.8 Morganella morganii S4 arpD ABC-type protease/lipase transport system, ATPase and permease components
LHKJJB_08590 LHKJJB_08590 76.8 Morganella morganii S3 arpD ABC-type protease/lipase transport system, ATPase and permease components
HKOGLL_08140 HKOGLL_08140 76.8 Morganella morganii S5 arpD ABC-type protease/lipase transport system, ATPase and permease components
PMI_RS01350 PMI_RS01350 64.2 Proteus mirabilis HI4320 - type I secretion system permease/ATPase

Distribution of the homologs in the orthogroup group_1304

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1304

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q03024 0.0 543 51 3 577 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23596 8.31e-153 454 50 4 557 3 prtD Proteases secretion ATP-binding protein PrtD Dickeya chrysanthemi
Q7ANN4 1.42e-124 382 39 1 559 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
P0DKX5 3.63e-54 199 27 11 560 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX6 3.97e-54 199 27 11 560 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
P16532 1.46e-53 197 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C086 3.53e-53 196 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 3.53e-53 196 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH0 3.75e-53 196 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 3.79e-53 196 28 13 570 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 3.98e-53 196 28 13 570 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH3 4.18e-53 196 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FG6 1.12e-52 194 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933E0 1.17e-52 194 28 12 565 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P26760 3.66e-52 193 27 10 563 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q8FDZ8 4.12e-52 193 27 13 569 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q933I3 5.5e-52 192 27 13 570 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
P55122 7.11e-52 192 27 11 566 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
P10089 1.25e-51 192 27 13 569 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q9RCG7 1.41e-51 191 27 10 557 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
P23702 1.83e-51 191 27 16 572 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
Q47258 3.69e-51 190 27 13 569 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q04473 5.68e-51 190 26 10 562 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
P08716 9.71e-51 189 27 13 569 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P11599 5.61e-48 181 27 12 565 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q46717 6.43e-48 181 26 14 569 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
Q9CJB8 2.65e-43 168 26 11 568 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
O53645 7.82e-43 168 34 4 298 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 1.52e-27 122 29 2 278 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P59653 2.15e-42 166 25 12 577 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A1KF14 2.23e-41 164 33 4 298 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 1.67e-27 122 29 2 278 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q2G2M9 3.53e-40 157 28 2 306 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 3.53e-40 157 28 2 306 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 3.53e-40 157 28 2 306 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 3.53e-40 157 28 2 306 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 3.53e-40 157 28 2 306 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 3.53e-40 157 28 2 306 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 3.53e-40 157 28 2 306 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 3.53e-40 157 28 2 306 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q00564 5.75e-40 158 26 10 555 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q03727 5.77e-40 158 24 12 577 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P55469 1.28e-39 156 28 7 376 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2LVL0 2.52e-39 155 23 11 523 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q87R16 4.64e-39 154 29 10 426 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2YU20 7.05e-39 154 27 2 306 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1QX69 1.01e-38 153 31 5 325 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P77265 1.14e-38 153 29 5 336 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
P44407 1.5e-38 153 25 11 539 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45861 1.55e-38 152 24 9 548 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
P54718 1.73e-38 152 39 1 218 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
O31707 3.63e-38 152 30 5 317 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
Q9WYC4 1.35e-37 150 30 5 307 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8K985 1.96e-37 149 30 1 301 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P71082 2.57e-37 149 26 2 354 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
Q5E0F2 3.14e-37 149 28 9 424 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q31FG2 5.17e-37 148 31 3 293 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q21NS8 8.87e-37 148 35 4 256 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
G5EFD4 1.08e-36 149 36 3 222 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q483B6 1.14e-36 147 31 3 306 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A0R6H7 1.27e-36 147 28 10 418 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9NP58 1.51e-36 149 35 2 220 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q10418 1.59e-36 148 24 12 558 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q5B1Q2 1.91e-36 148 31 7 338 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2ULH4 2.73e-36 147 31 5 293 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q4WPP6 5.34e-36 147 32 7 350 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O31708 5.37e-36 145 24 11 570 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
A0A348AXX9 6.65e-36 147 29 10 416 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 1.74e-23 109 24 23 625 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q54W24 8.68e-36 146 30 6 352 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
Q4WLN7 9.26e-36 146 31 5 288 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q54RU1 1.14e-35 145 29 7 337 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
Q02592 1.41e-35 146 32 3 265 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9C7F2 1.82e-35 146 34 2 247 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 1.2e-27 122 31 2 243 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9LZB8 2.7e-35 144 34 3 265 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q9C7F8 3.31e-35 145 33 2 248 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 2.07e-31 134 31 2 242 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q4QPI4 4.97e-35 142 25 11 539 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q4HVU7 5.21e-35 144 31 5 299 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q3J7R8 5.34e-35 142 27 14 531 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
P9WQJ9 5.72e-35 144 38 3 218 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 5.72e-35 144 38 3 218 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 5.72e-35 144 38 3 218 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G7CBF6 6.07e-35 142 29 2 310 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
A0A125QXJ1 7.36e-35 144 27 8 407 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q8T9W2 8.64e-35 143 31 3 267 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q8DAV2 8.79e-35 142 26 9 428 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q7N6C6 1e-34 142 26 9 412 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9DC29 1.07e-34 143 35 2 216 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
Q57538 1.11e-34 141 25 7 455 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1RDU4 1.47e-34 141 24 14 561 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 1.47e-34 141 24 14 561 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 1.47e-34 141 24 14 561 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P54719 1.53e-34 141 33 2 233 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
Q08201 1.75e-34 143 35 2 231 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 1.29e-32 137 36 3 233 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q7MJ07 1.95e-34 141 26 9 428 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q89A97 2.31e-34 140 29 3 308 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9NP78 2.88e-34 142 33 5 302 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
Q4PH16 3.52e-34 141 30 4 296 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q9GTN7 3.67e-34 142 28 2 306 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q6LPK6 4.03e-34 140 29 6 372 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
P06795 4.66e-34 142 36 3 233 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 3.44e-30 130 36 1 196 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q7VR44 4.78e-34 140 31 4 264 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q66CI3 5.06e-34 140 23 12 550 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 5.06e-34 140 23 12 550 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 5.06e-34 140 23 12 550 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 5.06e-34 140 23 12 550 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q12M46 5.32e-34 140 25 14 529 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7NZU6 5.5e-34 139 27 6 382 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5PGH0 5.56e-34 139 24 15 576 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
G7CBF5 6.14e-34 141 36 2 213 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
P63359 7.18e-34 139 24 15 576 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 7.18e-34 139 24 15 576 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 7.18e-34 139 24 15 576 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q2HIE9 7.23e-34 139 30 4 296 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q32E34 7.59e-34 139 24 13 561 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 7.59e-34 139 24 13 561 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 7.59e-34 139 24 13 561 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 7.59e-34 139 24 13 561 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
B2KWH4 7.77e-34 141 37 6 258 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 4.75e-19 95 28 5 270 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q0A4U4 1.02e-33 139 28 5 391 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9CMG7 1.18e-33 139 28 14 437 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q9Y7M7 1.21e-33 140 32 4 295 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q83LP0 1.25e-33 139 24 13 561 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q080T2 1.34e-33 139 24 12 525 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
P36497 1.35e-33 139 30 7 316 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
Q54BU4 1.43e-33 140 31 5 278 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q5RFQ9 1.46e-33 139 28 9 379 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q3Z3K7 1.5e-33 138 24 13 561 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
O70595 1.58e-33 140 27 11 409 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
O14286 2.02e-33 139 28 3 308 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9KQW9 2.06e-33 138 27 11 422 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P21440 2.27e-33 140 36 2 217 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 7.99e-32 135 35 3 233 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q4WSI1 2.37e-33 140 36 4 222 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 6.32e-20 98 32 3 221 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9NUT2 2.55e-33 139 27 10 396 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q2NUA5 3.24e-33 137 31 4 281 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
P21439 3.66e-33 139 36 2 217 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 4.4e-31 132 35 4 240 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q8T9W4 3.72e-33 139 32 4 289 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 4.87e-20 98 32 3 225 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
A0R6H8 4.51e-33 138 37 3 211 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0P9C4 5.6e-33 136 36 4 219 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P9WQJ7 5.66e-33 136 29 8 419 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 5.66e-33 136 29 8 419 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 5.66e-33 136 29 8 419 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9QYJ4 6.38e-33 137 30 4 317 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q9JJ59 6.38e-33 137 29 5 350 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
P23174 7.45e-33 138 36 2 217 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 6.07e-31 132 34 3 233 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q15UY7 7.52e-33 136 31 4 292 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q142P6 8.05e-33 136 32 3 248 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
P43245 9.08e-33 138 35 4 233 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 1.92e-30 130 36 1 196 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
F2RPA4 1.23e-32 137 34 3 229 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 3.39e-16 86 27 4 262 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
P21449 1.3e-32 137 35 3 233 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 2.46e-31 133 37 2 200 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
F2Q5G0 1.41e-32 137 34 3 229 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 3.26e-16 86 27 4 262 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P0CU83 1.5e-32 137 34 3 229 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 1.93e-15 84 26 4 262 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
A0A059JK44 1.54e-32 137 34 3 229 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 3.62e-16 86 27 4 262 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
P57551 1.69e-32 135 27 1 301 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P21448 1.77e-32 137 35 3 233 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 1.64e-31 134 37 2 201 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P0CL93 1.98e-32 136 28 5 339 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CL92 2.01e-32 136 28 5 339 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P21447 3.04e-32 136 35 3 233 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 2.45e-29 127 36 2 201 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P59852 3.46e-32 135 22 12 531 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q5RKI8 3.74e-32 135 27 10 391 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q6CX96 3.92e-32 135 29 8 316 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q7RX59 4.01e-32 135 29 3 306 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q492S9 4.3e-32 134 28 9 383 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q0I4C5 4.61e-32 134 34 3 244 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q5QU36 4.74e-32 134 26 12 430 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8LPQ6 5.05e-32 135 36 3 232 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q59R09 6.6e-32 134 33 2 230 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
J9VWU3 6.61e-32 134 29 3 307 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q83D84 7e-32 133 34 2 229 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O06967 7.27e-32 133 30 6 333 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q6AJW3 7.45e-32 133 23 12 551 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q21WN9 1.14e-31 132 32 3 273 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P08183 1.34e-31 134 34 3 233 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 2.77e-30 130 35 2 217 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q5X498 1.44e-31 132 35 4 230 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q8RY46 1.71e-31 133 34 4 234 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q2UPC0 1.83e-31 133 29 3 254 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9LSJ5 1.89e-31 134 32 3 246 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 6.79e-26 117 29 2 237 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
O07550 2.44e-31 132 30 6 296 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
Q3SFZ6 2.78e-31 131 31 3 293 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q9CXJ4 4.16e-31 132 26 10 390 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
Q56A55 4.51e-31 132 30 7 322 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q4KJB2 4.81e-31 131 27 5 386 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q60AA3 4.81e-31 131 31 6 302 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P36370 5.16e-31 132 32 5 305 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
Q9LSJ2 5.19e-31 132 27 6 352 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 2.03e-26 118 28 5 290 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9HUG8 5.7e-31 131 33 2 236 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9LSJ8 5.83e-31 132 32 3 246 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 1.36e-26 119 27 6 315 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q0HTS8 6.59e-31 130 24 13 515 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 6.59e-31 130 24 13 515 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q3KJ31 6.98e-31 130 30 3 297 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q5ZUH9 7.12e-31 130 38 3 199 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2G506 7.7e-31 130 30 5 304 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q63VX7 8.11e-31 130 30 3 250 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 8.11e-31 130 30 3 250 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 8.11e-31 130 30 3 250 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q57180 8.45e-31 130 28 9 357 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q00449 9.1e-31 132 35 3 226 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 5.37e-28 123 32 5 276 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
B2GUP8 9.11e-31 130 34 4 243 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
P22520 9.71e-31 130 25 9 542 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
P70864 1.37e-30 129 27 6 315 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
Q2SZW0 1.4e-30 129 30 3 250 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q28433 1.43e-30 130 30 5 318 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
A1USS5 1.47e-30 129 27 6 315 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q23868 1.51e-30 131 33 3 229 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q5WVN2 1.6e-30 129 37 4 216 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q9ZR72 1.65e-30 131 31 5 269 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 5.56e-29 126 37 2 205 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q3IGX5 2.03e-30 129 26 13 431 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
P33311 2.04e-30 130 35 5 222 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WD46 2.61e-30 130 35 4 225 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 6.47e-21 101 26 7 379 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P34712 2.79e-30 130 35 4 221 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 2.22e-29 127 33 2 218 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q9LVM1 3.03e-30 129 28 5 298 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
P16875 3.57e-30 130 33 3 232 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 1.56e-28 125 31 5 273 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P40416 4.2e-30 129 27 5 311 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6D437 4.49e-30 128 33 2 225 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0WML0 4.88e-30 128 31 4 263 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
Q5P2S7 5.95e-30 128 25 6 432 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q54BT3 6.61e-30 129 34 2 217 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 2.23e-25 115 32 3 217 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q8D2U8 7.41e-30 127 31 3 254 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
P9WQJ3 8.45e-30 127 33 1 212 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 8.45e-30 127 33 1 212 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 8.45e-30 127 33 1 212 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q03518 8.87e-30 128 29 5 318 1 TAP1 Antigen peptide transporter 1 Homo sapiens
Q46Y89 1.05e-29 127 31 3 247 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P75094 1.11e-29 127 29 4 275 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8EDF0 1.3e-29 127 24 13 515 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q00748 1.45e-29 128 33 2 230 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 3.76e-26 117 34 5 227 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
P47261 1.59e-29 126 28 3 272 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9FUT3 1.86e-29 127 29 7 301 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q9EXN5 2.49e-29 126 31 2 289 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
Q9LSJ6 2.52e-29 127 32 3 238 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 1.43e-25 115 26 4 288 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q47908 2.68e-29 125 23 10 429 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q9M0G9 2.74e-29 126 33 1 203 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q8LPK2 3.53e-29 127 32 4 241 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 4.6e-27 120 36 1 185 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
P54683 3.63e-29 127 32 4 243 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
Q4UMZ3 3.81e-29 125 30 6 319 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6YUU5 4.37e-29 126 32 3 240 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 6.67e-26 117 34 2 232 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
O75027 4.42e-29 126 26 6 330 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
P36619 4.57e-29 126 29 4 275 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 1.29e-21 103 30 4 228 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q61102 5.39e-29 125 26 6 316 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q48P40 5.58e-29 125 35 2 230 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0A1U9YI12 5.65e-29 126 29 5 305 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 1.12e-26 119 30 6 279 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q6C6N0 5.88e-29 125 29 4 294 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q0VQP5 6.12e-29 124 33 3 230 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4WTT9 6.69e-29 126 26 8 406 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 4.99e-27 120 31 4 250 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P16876 7.28e-29 126 34 3 220 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 3.18e-28 124 32 3 232 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P35598 7.33e-29 124 27 4 305 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q6FIK3 7.71e-29 125 26 9 393 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B5X0E4 8.82e-29 125 34 3 225 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 1.38e-28 125 32 2 231 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q9NRK6 8.97e-29 125 34 4 236 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q1LQD3 9.26e-29 124 31 4 248 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BUV6 1.01e-28 124 30 4 280 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q39E73 1.07e-28 124 29 4 286 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q65U21 1.17e-28 124 28 5 381 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87VF3 1.26e-28 124 35 2 237 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q06034 1.41e-28 125 32 2 233 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 1.07e-21 103 33 2 226 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
H6TB12 1.51e-28 125 32 6 250 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 3.02e-24 111 31 4 237 1 mdr Sophorolipid transporter Starmerella bombicola
P94367 1.51e-28 123 34 4 229 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q9Y8G2 1.6e-28 125 32 5 250 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 2.04e-14 80 33 5 192 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G1 1.61e-28 125 32 4 250 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 7.46e-28 123 27 7 352 1 atrD ABC multidrug transporter atrD Emericella nidulans
A0A1U8QG99 1.61e-28 125 32 5 250 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 1.96e-14 80 33 5 192 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P16877 1.63e-28 125 32 3 226 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 4.39e-28 123 31 8 289 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
A0A0D1BUH6 1.71e-28 125 33 3 230 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 9.32e-25 113 34 6 244 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q751N2 1.82e-28 124 28 5 298 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5BAY0 1.9e-28 124 32 4 250 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 9.07e-28 122 27 7 352 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q1MAB5 1.95e-28 123 31 4 266 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q47JR8 2.28e-28 123 30 3 305 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
Q92GP9 2.38e-28 123 30 8 338 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9SGY1 2.55e-28 124 32 2 217 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 3.71e-28 124 34 2 218 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q87EF0 2.56e-28 123 25 12 529 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9ZNB0 2.6e-28 122 28 5 299 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q54NL1 2.6e-28 124 34 5 226 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.23e-11 71 27 3 198 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q5NIG3 2.61e-28 123 23 9 423 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 2.61e-28 123 23 9 423 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q8XXB6 2.63e-28 123 33 4 228 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
F2T1C4 2.73e-28 124 28 4 297 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 3.94e-26 117 28 3 261 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q8P8W4 2.75e-28 122 29 4 306 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 2.75e-28 122 29 4 306 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q3BTC8 2.99e-28 122 29 4 307 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PKS5 3.22e-28 122 29 4 307 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
P34713 3.27e-28 124 31 2 234 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 1.18e-26 119 29 5 278 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
Q08D64 3.29e-28 123 35 2 201 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
A0A059JJ46 3.8e-28 124 28 4 297 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 2.06e-26 118 29 3 261 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q9LJX0 4.44e-28 123 32 2 231 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 8.65e-26 116 31 2 241 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q7VL52 4.45e-28 122 35 2 219 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9LHD1 4.5e-28 123 30 2 242 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 1.07e-24 113 31 5 249 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q2M3G0 4.74e-28 123 35 3 225 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 5.77e-28 123 31 3 240 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q6G2Z5 4.93e-28 122 30 3 241 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1QBW0 5.01e-28 122 29 4 298 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q704E8 5.02e-28 122 26 7 337 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q0BKJ3 5.17e-28 122 23 9 423 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 5.17e-28 122 23 9 423 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q1RJ91 6.1e-28 121 31 6 276 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
P21958 6.71e-28 122 29 4 316 1 Tap1 Antigen peptide transporter 1 Mus musculus
Q6BXD7 7.01e-28 122 28 5 297 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
F2RP52 8.11e-28 122 28 5 298 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 2.21e-26 118 29 3 261 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 8.11e-28 122 28 5 298 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 2.21e-26 118 29 3 261 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q9JI39 8.29e-28 122 34 6 249 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
Q9FHF1 9.56e-28 122 32 3 235 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 5.8e-24 110 31 2 231 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q4FS42 9.61e-28 121 29 4 299 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
O95342 9.66e-28 122 31 3 233 1 ABCB11 Bile salt export pump Homo sapiens
O95342 1.41e-22 106 30 6 294 1 ABCB11 Bile salt export pump Homo sapiens
Q9LHK4 9.87e-28 122 28 2 233 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 2.25e-23 108 33 1 217 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q5H0H0 1e-27 121 29 4 307 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1e-27 121 29 4 307 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P22638 1.09e-27 121 31 2 230 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q12C33 1.2e-27 120 27 5 366 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q6Q876 1.39e-27 122 29 11 360 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 1.48e-26 119 29 4 251 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
G5EG61 1.45e-27 122 31 2 240 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 9.91e-27 119 31 2 232 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q9PEE7 1.54e-27 120 24 12 529 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q88D92 1.54e-27 120 32 2 237 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6FZF2 1.56e-27 120 30 3 242 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q68W42 2.04e-27 120 33 1 207 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q03519 2.05e-27 120 27 4 346 1 TAP2 Antigen peptide transporter 2 Homo sapiens
Q4ZZ16 2.24e-27 120 35 2 230 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q2K342 2.36e-27 120 32 3 234 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3SP57 2.37e-27 120 29 4 297 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
O70127 2.69e-27 121 33 3 221 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 2.33e-21 102 34 2 212 1 Abcb11 Bile salt export pump Rattus norvegicus
J9VF33 2.8e-27 121 32 3 234 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 3.5e-26 117 30 4 242 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
S0EGU4 2.9e-27 121 31 2 218 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 1.9e-06 55 35 3 151 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9V2E4 3.27e-27 114 32 5 210 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q1GZI0 3.47e-27 119 32 2 225 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A0A095C325 4.45e-27 120 32 3 234 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 5.36e-26 117 31 5 248 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
O57872 4.59e-27 113 34 6 210 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8T9W1 4.68e-27 120 31 4 233 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
B8K1W2 4.81e-27 120 33 3 221 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 4.35e-22 105 34 2 212 1 Abcb11e Bile salt export pump Canis lupus familiaris
Q9N0V3 5.69e-27 120 32 3 219 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 2.53e-19 96 33 2 212 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q89UT8 5.94e-27 119 27 18 474 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O80725 6.03e-27 120 28 6 291 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 3.47e-25 114 31 3 230 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q8YH20 8.19e-27 118 28 4 299 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0C529 8.97e-27 118 28 4 299 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 8.97e-27 118 28 4 299 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q2SIN5 1.09e-26 118 32 3 232 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q9QY30 1.2e-26 119 34 3 207 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 3.19e-21 102 34 2 212 1 Abcb11 Bile salt export pump Mus musculus
Q8G0T8 1.69e-26 117 28 4 299 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
E7F6F7 2.16e-26 117 27 6 296 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q89A96 2.23e-26 117 30 3 238 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
H2LNR5 2.85e-26 117 26 5 292 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q9ZCM8 4.21e-26 116 33 1 207 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q9FWX7 5.61e-26 117 31 4 220 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 2.1e-25 115 28 6 282 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9M1Q9 5.65e-26 117 29 2 231 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 6.17e-26 117 32 3 230 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q8U4L3 6.88e-26 110 32 5 211 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
F2SQT8 7.16e-26 116 32 5 235 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 2.02e-25 115 30 3 227 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P12866 8.03e-26 116 26 12 437 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 1.96e-23 109 32 6 219 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9JXR3 8.36e-26 115 27 3 300 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q1QH37 1.09e-25 115 27 4 316 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0D9V6 1.13e-25 111 36 6 216 1 STAR1 Protein STAR1 Oryza sativa subsp. japonica
Q9FNU2 1.22e-25 115 29 4 260 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
Q480N3 1.34e-25 114 29 6 283 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9C9W0 1.45e-25 109 35 4 200 2 ABCI17 ABC transporter I family member 17 Arabidopsis thaliana
Q9FWX8 1.96e-25 115 31 4 220 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 1.73e-21 103 28 2 231 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q20Z38 2.3e-25 114 29 4 302 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q07QX6 3.08e-25 113 25 11 438 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q8LGU1 4.38e-25 114 31 6 262 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 5.48e-17 89 26 7 286 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q4WA92 4.58e-25 114 31 4 225 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 3.74e-23 108 31 5 221 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O07549 5.79e-25 113 26 4 291 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
Q9JW59 6.34e-25 112 26 3 300 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P23886 7.89e-25 112 26 8 360 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q13BH6 9.66e-25 112 26 11 418 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
P36372 1.17e-24 112 28 4 307 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
Q9SYI3 1.28e-24 112 31 3 219 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 1.35e-22 106 32 1 201 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q71ED1 1.28e-24 111 29 4 264 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q6N1Y7 1.48e-24 111 30 4 256 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
K3VYH8 1.73e-24 112 26 14 424 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 2.79e-15 83 26 4 258 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
Q5F4X8 2.06e-24 111 26 3 298 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q50294 2.21e-24 106 33 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P33310 2.57e-24 111 34 1 197 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P68580 3.64e-24 110 28 6 279 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 3.64e-24 110 28 6 279 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
Q2J0F4 3.79e-24 110 32 1 215 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
Q8U3E0 5.8e-24 105 30 6 229 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2KYS6 7.18e-24 109 26 4 293 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
P78966 9.06e-24 110 30 11 303 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.44e-22 106 27 7 310 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6F9X0 9.57e-24 108 29 4 288 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P0A2V1 1.54e-23 108 28 6 322 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 1.54e-23 108 28 6 322 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
P36371 1.63e-23 108 27 3 306 1 Tap2 Antigen peptide transporter 2 Mus musculus
Q6LV32 3.93e-23 102 35 10 230 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q88AS5 4.18e-23 103 32 9 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q80WJ6 4.93e-23 107 33 6 229 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 4.44e-16 85 27 7 234 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q03PY5 5.56e-23 102 31 5 221 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P0AAG5 5.75e-23 106 23 13 517 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 5.75e-23 106 23 13 517 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 5.75e-23 106 23 13 517 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q9M3B9 8.25e-23 107 30 2 236 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 9.66e-19 94 27 6 297 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q8LPT1 1.01e-22 107 29 1 236 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 2.3e-20 99 26 5 301 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q6NJ07 1.04e-22 103 35 7 221 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9YG51 1.07e-22 100 32 9 232 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P18767 1.08e-22 105 31 1 198 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
Q8F6Z1 1.1e-22 103 33 10 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.1e-22 103 33 10 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q04EY5 1.21e-22 101 30 5 236 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q9I6L0 1.25e-22 102 31 10 261 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6Y306 1.41e-22 106 33 6 229 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 1.31e-16 87 27 7 234 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q9M0M2 1.59e-22 106 29 2 231 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 3.24e-22 105 31 3 229 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
P0A4W5 2.07e-22 105 29 5 224 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 2.07e-22 105 29 5 224 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ0 2.21e-22 104 29 5 224 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P26362 2.22e-22 105 33 2 212 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
P26362 2.43e-13 77 28 4 214 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
P97998 2.74e-22 105 28 3 242 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q5YRD1 3.38e-22 101 37 6 206 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q8U4K3 4.09e-22 101 33 8 223 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8E8K8 4.1e-22 101 31 6 228 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1B677 5.33e-22 100 34 8 216 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q9SYI2 5.43e-22 104 30 5 246 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 1.93e-20 99 29 4 220 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9EYM2 5.43e-22 98 36 7 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2K6L3 6.1e-22 100 32 6 219 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q96J65 6.47e-22 104 32 5 219 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 8.62e-18 91 28 7 233 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q983H5 7.07e-22 103 26 6 354 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P94366 8.55e-22 102 29 5 283 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
Q9V1Q4 9.01e-22 99 30 8 241 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q7NWX3 1.11e-21 100 36 7 211 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8RCU0 1.12e-21 97 30 3 215 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RHL0 1.13e-21 98 29 6 257 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5PCG9 1.38e-21 99 35 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7UP21 1.58e-21 98 31 9 230 3 pstB Phosphate import ATP-binding protein PstB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P26363 1.58e-21 103 30 3 238 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
P26363 6.5e-16 85 24 5 273 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
Q54EK2 1.7e-21 103 29 4 225 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q54EK2 3.47e-10 67 29 3 198 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q6D201 1.85e-21 99 33 8 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8ST87 2.57e-21 102 29 4 231 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q8ST87 2.02e-14 80 27 2 208 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q5X627 3.1e-21 99 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5L3R0 3.19e-21 97 32 5 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)
Q8TQ05 3.34e-21 101 31 9 268 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 3.43e-18 92 28 5 226 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q0I3C2 3.36e-21 95 31 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q88CL2 3.55e-21 98 31 10 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1GL85 3.56e-21 96 31 7 230 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q54VJ0 3.67e-21 102 31 1 173 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 1.47e-12 74 30 2 203 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
O31711 3.7e-21 95 28 4 212 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q82VL9 3.7e-21 95 34 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6D4A8 3.75e-21 96 33 6 214 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q54V86 4.37e-21 102 30 1 173 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 1.24e-11 71 29 2 197 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
A1SWH9 4.59e-21 99 31 7 228 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8NSN2 5.49e-21 98 34 7 217 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5ZWE4 5.63e-21 98 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8Z8R5 6.12e-21 97 35 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
P24693 6.24e-21 95 30 6 207 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q6A6X6 6.55e-21 98 36 8 221 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q8FRX8 6.59e-21 98 34 7 217 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8ZR89 6.6e-21 97 35 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57S53 6.6e-21 97 35 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
A0PXX8 6.71e-21 96 31 6 218 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium novyi (strain NT)
Q9Z3R9 6.79e-21 98 31 7 233 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q0I354 7.16e-21 94 35 8 211 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
P77279 7.49e-21 95 32 3 209 1 fetA Probable iron export ATP-binding protein FetA Escherichia coli (strain K12)
Q13LD8 8.21e-21 98 34 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q31ZH4 8.83e-21 95 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q54P13 8.87e-21 100 26 5 280 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 8.74e-19 94 30 2 199 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q1WSB8 9.14e-21 96 30 4 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q0VQQ0 9.15e-21 94 32 7 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
G5EE72 9.24e-21 100 30 4 217 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
G5EE72 5.22e-16 85 29 4 215 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
Q9X2W0 9.54e-21 99 30 3 222 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
Q8T6H8 9.99e-21 100 30 1 175 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q8T6H8 2.61e-11 70 29 2 196 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
O34392 1.06e-20 94 30 8 220 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q58967 1.13e-20 95 29 7 209 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P47425 1.19e-20 95 30 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q830W6 1.27e-20 97 31 8 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q97EK9 1.29e-20 95 31 10 251 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3Z300 1.37e-20 94 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.37e-20 94 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.37e-20 94 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.37e-20 94 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q72GX5 1.42e-20 95 30 7 250 3 pstB Phosphate import ATP-binding protein PstB Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6D2F6 1.45e-20 96 35 8 210 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q58903 1.48e-20 94 32 4 202 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q93DX8 1.52e-20 95 35 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q5WXF0 1.82e-20 97 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5NZT6 2.05e-20 93 33 4 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P54933 2.4e-20 95 31 8 256 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
A3CVD3 2.41e-20 94 31 6 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q5JEB0 2.42e-20 95 32 8 220 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q2K4V4 2.43e-20 96 28 5 225 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8X8E3 2.48e-20 93 35 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q21TG3 2.5e-20 93 31 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q3JHC9 2.57e-20 97 34 6 229 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
P75095 2.7e-20 98 29 5 217 3 MPN_018 Putative ABC transporter ATP-binding protein MG014 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q895C4 2.8e-20 95 30 5 219 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q63NI4 2.88e-20 96 34 6 229 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q32EX7 2.89e-20 93 34 8 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q0IAC3 3.07e-20 94 28 10 265 3 pstB Phosphate import ATP-binding protein PstB Synechococcus sp. (strain CC9311)
P57552 3.11e-20 98 24 3 288 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q62B84 3.18e-20 96 34 6 229 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q7NX01 3.44e-20 95 34 7 216 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A3DJK5 3.55e-20 94 31 9 232 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A1URR2 3.6e-20 95 30 6 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q2IF17 3.97e-20 93 32 7 245 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaeromyxobacter dehalogenans (strain 2CP-C)
Q2NHW1 4.27e-20 93 30 9 250 3 pstB Phosphate import ATP-binding protein PstB Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
O59479 4.35e-20 94 30 9 241 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q7AKE5 4.54e-20 97 36 9 221 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q60350 4.65e-20 93 30 5 220 3 MJ0035 Uncharacterized ABC transporter ATP-binding protein MJ0035 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9CP06 4.67e-20 95 31 9 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
P75957 4.81e-20 92 34 8 217 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q1M8R6 4.87e-20 95 31 6 219 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q97JB8 5.09e-20 94 30 8 230 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9U2G5 5.16e-20 98 34 4 199 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 3.16e-15 83 24 10 333 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q8R9L8 5.26e-20 97 30 7 232 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8R9L8 2.29e-14 79 28 6 220 3 TTE1589 Putative ABC transporter ATP-binding protein TTE1589 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9C8G9 5.64e-20 98 30 12 297 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 6.25e-15 82 29 4 208 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q98K23 5.7e-20 95 31 7 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q63TY1 5.92e-20 95 34 7 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 6.03e-20 95 34 7 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q7N6Z2 6.14e-20 95 31 8 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8T6H3 6.31e-20 98 31 2 174 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q8T6H3 1.39e-08 62 27 3 194 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q1IGZ0 6.67e-20 94 29 8 250 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q20ZS6 6.73e-20 92 30 7 212 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q2K1C8 7.25e-20 94 29 6 231 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1CJG3 7.29e-20 92 34 6 208 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13000
Feature type CDS
Gene -
Product type I secretion system permease/ATPase
Location 213123 - 214883 (strand: -1)
Length 1761 (nucleotides) / 586 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1304
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4618 Intracellular trafficking, secretion, and vesicular transport (U) U ABC-type protease/lipase transport system, ATPase and permease components

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12536 ATP-binding cassette, subfamily C, type I secretion system permease/ATPase ABC transporters -

Protein Sequence

MFSGKTRNEITAFITTRKKLFTTLALFTALINLLMLVPSVYMLQVYDRVLPSGNDMTLLMLTLIMIGLFILMGGLDFLRNLLVIRMSNQFDMALNTRIYTAAFQAKLNRSPGITPSAALTDLMLLRRFITGNGIFAFFDLPWFPVYLLVIALFNPWLGLFALCGALLLLFLAIINERFSGPPLTAANQFATTAQLMQSSHFEHTQPADAMGMQHHLRQRWLNNHLCCLEAQTQASDIAAKMMSLTKTTRIALQSLMLGLGGWLALDNTITPGMMIAGSILMGRALAPIEQVIGVWKSAKESRLAYQRLKTLLAAHPSPPEKIALPVPKGNLSVSVMQAGYPHSNVPLLHNLHFSLAAGEVLGVIGPSGAGKSTLAKLLAGLWPATRGAVRLDGADISQQDKAEIGQYIGYLPQEIALFTGTIADNIARFDPQADTDNIICAAKMAQIHELILQLPQGYETLTGPNGEGLSGGQRQRIALARALYGSPALIILDEPNSNLDDAGILALVSAINTLKEQKKTVILITHHKQLLSVTDKLLLLIDGHTKLSGPTAQVIAELNHSPKNDPPENNTQAGNSQGNRAEHHDK

Flanking regions ( +/- flanking 50bp)

TATATCAATAACAAGACTCCTGAGCTATGACTCAGGCGGAGCACCTGTTTATGTTTTCCGGGAAAACCAGAAACGAAATCACCGCGTTTATCACCACACGAAAAAAACTGTTTACCACTCTCGCATTATTCACTGCACTGATTAATCTGCTTATGTTAGTGCCGTCCGTGTATATGTTGCAGGTCTACGACCGCGTTTTACCTTCCGGTAATGACATGACATTACTGATGCTGACACTCATTATGATCGGGCTGTTTATCCTGATGGGCGGGTTGGATTTCCTGCGTAATCTGCTGGTTATCCGTATGAGCAATCAATTTGATATGGCACTGAATACCCGTATTTACACGGCTGCATTTCAGGCGAAACTAAACCGCAGCCCGGGTATTACACCATCAGCGGCACTGACCGATCTGATGCTGCTGCGCCGTTTTATTACCGGCAACGGTATTTTTGCCTTCTTTGATTTGCCCTGGTTCCCGGTTTATCTGCTGGTTATTGCGCTGTTTAACCCATGGCTGGGATTGTTTGCATTATGCGGGGCATTGCTCCTGCTGTTTCTTGCCATTATCAACGAGCGTTTTTCCGGACCACCGCTGACGGCAGCGAATCAGTTTGCCACCACCGCGCAACTGATGCAGAGCAGCCATTTTGAGCACACACAGCCCGCTGACGCGATGGGAATGCAGCATCACCTGCGTCAGCGCTGGCTCAATAACCACCTTTGCTGTCTTGAGGCGCAGACTCAGGCAAGTGATATTGCCGCTAAAATGATGTCGCTGACCAAAACCACGCGTATAGCCCTGCAATCCCTGATGCTCGGGTTGGGTGGCTGGCTGGCGCTGGATAATACCATTACGCCCGGCATGATGATTGCGGGATCTATTCTGATGGGGCGTGCACTTGCGCCGATTGAACAGGTTATCGGCGTATGGAAAAGCGCGAAAGAGAGCCGGCTGGCCTATCAGCGTCTGAAAACCTTGCTGGCAGCACACCCGTCACCTCCGGAGAAAATTGCGCTGCCGGTGCCAAAGGGAAACCTGTCTGTATCCGTTATGCAGGCGGGGTATCCTCACAGTAATGTGCCGCTGTTGCATAATCTGCATTTCAGTCTGGCGGCGGGAGAGGTGCTGGGGGTGATTGGTCCGAGTGGTGCCGGTAAATCGACCCTGGCAAAACTGCTTGCCGGGCTGTGGCCTGCAACGCGGGGTGCTGTCCGGTTGGATGGCGCGGATATCAGTCAGCAGGACAAAGCGGAGATTGGTCAGTACATCGGCTATCTTCCGCAGGAAATTGCGCTTTTTACCGGCACAATTGCCGACAATATTGCCAGGTTCGATCCTCAGGCTGATACAGATAATATTATTTGTGCCGCAAAAATGGCGCAAATTCATGAATTGATCCTGCAACTGCCGCAGGGATATGAAACGCTGACCGGACCCAACGGAGAAGGGCTTTCCGGCGGACAGCGCCAGCGTATTGCACTTGCCCGCGCACTGTATGGTTCACCTGCACTGATTATTTTAGACGAACCAAACTCTAATCTGGATGATGCGGGGATACTCGCGCTGGTCAGTGCTATTAACACACTGAAAGAACAGAAAAAAACCGTCATTCTGATCACTCACCATAAACAACTGCTGTCTGTCACAGACAAACTGTTACTCCTGATTGACGGACATACAAAGCTGTCCGGACCCACTGCTCAGGTTATCGCAGAACTGAATCATTCACCGAAAAACGATCCACCAGAAAACAATACACAGGCGGGTAACTCACAGGGAAACCGGGCAGAACATCATGATAAATAAACATAAAAAAACAAAATCAGACGCTGTGAATGTGCCGGTGGACACCCAGC