Homologs in group_1304

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07985 FBDBKF_07985 100.0 Morganella morganii S1 arpD ABC-type protease/lipase transport system, ATPase and permease components
NLDBIP_14260 NLDBIP_14260 100.0 Morganella morganii S4 arpD ABC-type protease/lipase transport system, ATPase and permease components
LHKJJB_08590 LHKJJB_08590 100.0 Morganella morganii S3 arpD ABC-type protease/lipase transport system, ATPase and permease components
HKOGLL_08140 HKOGLL_08140 100.0 Morganella morganii S5 arpD ABC-type protease/lipase transport system, ATPase and permease components
F4V73_RS13000 F4V73_RS13000 76.8 Morganella psychrotolerans - type I secretion system permease/ATPase
PMI_RS01350 PMI_RS01350 59.6 Proteus mirabilis HI4320 - type I secretion system permease/ATPase

Distribution of the homologs in the orthogroup group_1304

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1304

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q03024 2.24e-177 516 49 2 560 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23596 5e-153 454 52 4 550 3 prtD Proteases secretion ATP-binding protein PrtD Dickeya chrysanthemi
Q7ANN4 3.52e-122 375 39 1 556 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
P16532 5.48e-54 198 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 8.08e-54 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 8.33e-54 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933I3 8.84e-54 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q93FH0 9.02e-54 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C086 1.1e-53 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 1.1e-53 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH3 1.17e-53 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933E0 1.25e-53 197 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P55122 2.08e-53 196 28 12 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
Q93FG6 3.42e-53 196 27 10 568 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P26760 4.7e-53 195 26 8 551 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q8FDZ8 7.2e-53 195 26 12 571 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DKX5 8.12e-53 194 27 10 569 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX6 8.62e-53 194 27 10 569 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
P10089 2.17e-52 193 26 12 571 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q9RCG7 4.29e-52 192 26 8 562 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
Q47258 5.46e-52 192 26 12 571 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P08716 1.22e-51 191 26 12 571 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q04473 1.17e-50 189 26 10 569 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
P23702 3.83e-50 187 26 13 564 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
P11599 4e-49 184 27 13 564 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q46717 1.9e-46 177 26 11 564 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
O53645 1.28e-43 170 31 5 393 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 4.5e-26 117 27 7 373 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8K985 2.11e-43 166 29 2 353 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P59653 1.89e-42 165 25 12 571 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q9CJB8 3.24e-42 164 27 10 545 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
O31707 5.15e-42 162 30 3 307 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
A1KF14 6.63e-42 165 30 5 393 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 4.19e-26 117 27 7 373 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q03727 2.43e-41 162 24 12 571 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P77265 1.43e-40 158 32 4 315 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q00564 2.05e-39 156 27 10 545 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
P71082 2.94e-39 154 26 4 376 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
Q87R16 5.54e-39 154 28 12 413 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q89A97 6.69e-39 153 26 4 389 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q21NS8 1.06e-38 153 36 3 234 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
G7CBF6 1.31e-38 152 30 7 401 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
Q54W24 3.59e-38 153 29 6 372 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
Q4QPI4 5.15e-38 151 25 16 537 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q1QX69 7.36e-38 150 27 17 519 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7NZU6 7.48e-38 150 30 4 348 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P54718 8.53e-38 150 41 3 208 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
Q2G2M9 1.65e-37 149 25 9 435 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 1.65e-37 149 25 9 435 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 1.65e-37 149 25 9 435 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 1.65e-37 149 25 9 435 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 1.65e-37 149 25 9 435 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 1.65e-37 149 25 9 435 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 1.65e-37 149 25 9 435 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 1.65e-37 149 25 9 435 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
P45861 2.38e-37 149 24 11 552 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q483B6 2.79e-37 149 31 4 311 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q2LVL0 2.84e-37 149 29 2 297 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
A0R6H7 4.76e-37 148 30 8 407 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2YU20 6.94e-37 147 24 2 368 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3KJ31 1.11e-36 147 30 6 366 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
P55469 1.13e-36 147 28 4 346 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P44407 1.15e-36 147 25 15 539 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q02592 1.72e-36 148 31 3 273 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8DAV2 2.14e-36 146 28 12 425 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q57538 3.45e-36 145 25 10 489 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O31708 4.01e-36 145 25 11 528 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
Q7MJ07 4.02e-36 145 28 12 425 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q12M46 6e-36 145 25 12 536 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P57551 8.09e-36 145 29 1 301 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9KQW9 8.16e-36 144 28 12 411 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4KJB2 1.17e-35 144 30 6 360 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q31FG2 1.43e-35 144 27 4 338 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9HUG8 1.69e-35 144 27 6 414 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WYC4 2.21e-35 144 28 6 340 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q10418 3.18e-35 144 24 14 569 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
G5EFD4 6.26e-35 144 25 6 403 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q8T9W2 1.39e-34 142 29 4 292 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q9DC29 1.78e-34 142 24 13 509 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
Q9NP58 2.14e-34 142 23 9 501 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
A0A0D1BUH6 2.27e-34 142 30 6 326 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 3.01e-24 111 33 3 209 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q0P9C4 2.38e-34 140 35 3 216 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3J7R8 2.42e-34 140 31 4 316 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q080T2 4.58e-34 140 30 6 289 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
Q54RU1 5.66e-34 140 24 14 562 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
Q0HTS8 6.73e-34 139 32 4 275 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 6.73e-34 139 32 4 275 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
A0A059JK44 7.67e-34 141 36 3 221 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 4.87e-17 89 29 5 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q6LPK6 8.06e-34 139 27 9 379 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
F2Q5G0 8.4e-34 140 36 3 221 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 4.82e-17 89 29 5 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q66CI3 8.88e-34 139 31 4 264 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 8.88e-34 139 31 4 264 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 8.88e-34 139 31 4 264 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 8.88e-34 139 31 4 264 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q2NUA5 1.11e-33 138 31 3 273 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
A0A125QXJ1 1.2e-33 140 24 12 508 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q9CMG7 1.3e-33 138 27 11 429 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q2ULH4 1.33e-33 139 34 2 229 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q8D2U8 1.69e-33 138 30 3 274 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q6AJW3 1.73e-33 138 22 11 548 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0R6H8 2.08e-33 139 37 2 213 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q15UY7 2.09e-33 137 31 5 281 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P0CU83 2.15e-33 139 35 3 221 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 1.41e-16 87 29 4 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q2SIN5 2.53e-33 137 31 9 358 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q5RFQ9 3e-33 138 33 5 258 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
B2GUP8 3.91e-33 137 34 4 247 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q9NUT2 4.05e-33 138 30 10 357 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q5E0F2 4.07e-33 137 30 5 285 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B2KWH4 4.8e-33 138 35 6 251 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 8.25e-19 94 27 5 277 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q5P2S7 4.96e-33 137 29 6 360 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5RKI8 5.33e-33 137 33 4 258 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q0A4U4 5.5e-33 136 28 7 390 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
F2RPA4 6.56e-33 138 35 3 221 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 4.11e-17 89 29 5 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
P36497 6.77e-33 137 24 19 567 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
Q9QYJ4 8.03e-33 137 27 10 448 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q8T9W4 8.2e-33 138 33 2 240 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 5.84e-21 101 31 2 229 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q3SFZ6 8.35e-33 136 31 3 281 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
A0A348AXX9 1.01e-32 137 31 4 277 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 1.57e-18 93 23 20 606 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q9JJ59 1.04e-32 137 27 10 452 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q5QU36 1.24e-32 135 30 4 275 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9GTN7 1.26e-32 137 27 3 304 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q83D84 1.42e-32 135 29 8 357 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q54BU4 1.58e-32 136 31 3 238 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q4WLN7 1.86e-32 136 34 2 229 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O70595 1.92e-32 136 25 16 515 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
Q65U21 2.38e-32 134 28 11 440 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O07550 2.59e-32 134 28 3 292 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
P06795 2.64e-32 136 33 3 231 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 4.72e-29 126 33 2 216 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q5X498 2.8e-32 134 36 1 209 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q8EDF0 2.84e-32 134 32 4 275 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5B1Q2 3.19e-32 135 32 3 242 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7N6C6 3.55e-32 134 31 3 263 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q28433 3.69e-32 135 30 7 333 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
Q492S9 5.14e-32 134 31 3 261 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q9NP78 5.68e-32 134 27 11 459 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
P9WQJ9 8.34e-32 134 35 5 242 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 8.34e-32 134 35 5 242 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 8.34e-32 134 35 5 242 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0I4C5 8.48e-32 133 30 3 273 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q9EXN5 8.62e-32 134 26 12 554 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
Q2UPC0 9.01e-32 134 34 1 210 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5ZUH9 9.56e-32 133 36 1 209 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P9WQJ7 1.04e-31 132 32 3 287 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 1.04e-31 132 32 3 287 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 1.04e-31 132 32 3 287 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P22520 1.17e-31 133 30 4 354 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
P43245 1.17e-31 134 34 4 231 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 1.54e-28 124 32 2 229 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q6D437 1.27e-31 132 31 3 263 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PGH0 1.46e-31 132 30 3 261 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q4FS42 1.64e-31 132 26 8 395 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1RDU4 1.74e-31 132 29 3 274 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 1.74e-31 132 29 3 274 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 1.74e-31 132 29 3 274 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P63359 1.79e-31 132 30 3 261 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 1.79e-31 132 30 3 261 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 1.79e-31 132 30 3 261 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q00449 1.85e-31 134 34 2 229 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 1.14e-27 122 32 6 276 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q83LP0 1.97e-31 132 29 3 274 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q32E34 2.01e-31 132 29 3 274 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 2.01e-31 132 29 3 274 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 2.01e-31 132 29 3 274 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 2.01e-31 132 29 3 274 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q03518 2.56e-31 132 30 7 333 1 TAP1 Antigen peptide transporter 1 Homo sapiens
Q56A55 2.74e-31 132 31 8 309 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
P08183 2.98e-31 133 33 3 231 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 3.06e-28 124 28 12 394 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
O06967 3.07e-31 131 30 5 297 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q3Z3K7 3.09e-31 131 29 3 274 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q1QBW0 3.49e-31 131 29 4 311 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P59852 4.7e-31 131 24 8 425 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
P75094 5.32e-31 131 28 4 274 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q142P6 5.52e-31 130 31 5 266 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
P35598 6.32e-31 130 27 4 310 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P21449 6.65e-31 132 33 3 231 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 4.31e-29 126 32 2 229 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
Q0WML0 6.93e-31 130 28 11 356 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
P21448 7.02e-31 132 33 3 231 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 1.13e-29 128 33 2 229 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q5WVN2 8.11e-31 130 35 1 209 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q4WSI1 8.21e-31 132 35 3 216 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 2.22e-20 99 34 6 213 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q08201 9.05e-31 131 35 2 201 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 1.12e-30 131 33 6 253 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q2HIE9 1.02e-30 130 27 4 308 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P21447 1.08e-30 131 33 3 231 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 3.09e-29 127 34 2 217 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
F2T1C4 1.57e-30 130 28 5 293 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 4.78e-26 117 28 3 262 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q21WN9 1.77e-30 129 33 3 263 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8RY46 1.88e-30 130 26 12 449 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q63VX7 1.91e-30 129 32 7 278 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 1.91e-30 129 32 7 278 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 1.91e-30 129 32 7 278 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
P54719 1.91e-30 129 27 4 306 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
A0A059JJ46 1.95e-30 130 28 5 293 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 2.49e-26 118 28 3 262 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
G7CBF5 2.04e-30 130 34 2 210 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
F2RP52 2.24e-30 130 28 5 293 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 2.68e-26 117 28 3 262 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 2.24e-30 130 28 5 293 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 2.68e-26 117 28 3 262 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q9C7F8 2.32e-30 130 31 2 245 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 7.56e-30 129 32 1 227 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9LZB8 2.37e-30 129 32 5 269 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q2SZW0 2.43e-30 129 30 5 276 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q4WD46 2.54e-30 130 32 4 237 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 9.29e-19 94 26 10 399 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P23174 2.58e-30 130 30 9 335 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 3.51e-29 127 32 6 253 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
A1USS5 2.67e-30 129 25 9 404 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P70864 2.69e-30 129 25 9 404 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
Q87VF3 2.89e-30 129 29 6 360 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q39E73 3.85e-30 128 30 4 274 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P21440 4.67e-30 129 30 9 335 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 5.85e-30 129 32 6 253 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q9CXJ4 5.21e-30 128 31 5 258 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
Q8LPK2 5.68e-30 129 32 2 229 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 1.27e-29 128 35 4 218 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
P16875 5.91e-30 129 32 3 233 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 4.33e-28 123 31 5 274 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q4PH16 7.04e-30 128 31 3 241 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
H6TB12 7.06e-30 129 32 3 234 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 1.59e-21 103 28 5 245 1 mdr Sophorolipid transporter Starmerella bombicola
Q7VR44 7.3e-30 127 28 4 266 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
B8K1W2 7.4e-30 129 31 6 279 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 5.65e-22 104 32 2 230 1 Abcb11e Bile salt export pump Canis lupus familiaris
Q1BUV6 7.44e-30 127 29 4 274 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q60AA3 8.19e-30 127 30 3 284 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9C7F2 9.48e-30 128 33 1 227 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 7.99e-26 116 31 3 230 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q88D92 1.01e-29 127 26 7 415 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48P40 1.18e-29 127 28 6 360 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P21439 1.31e-29 128 34 2 201 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 5.23e-29 126 32 5 238 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q9Y8G1 1.4e-29 128 29 3 236 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 9.14e-26 116 29 4 239 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q5BAY0 1.5e-29 128 29 3 236 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 9.62e-26 116 29 4 239 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WTT9 1.88e-29 127 30 3 231 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 8.29e-26 116 29 4 251 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5H0H0 1.94e-29 126 33 3 260 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.94e-29 126 33 3 260 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9LSJ5 2.02e-29 127 33 3 232 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 1.17e-27 122 30 2 239 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q8P8W4 2.03e-29 126 31 3 270 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 2.03e-29 126 31 3 270 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q6CX96 2.03e-29 127 26 7 378 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9NRK6 2.37e-29 126 34 4 236 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
P36619 2.5e-29 127 36 2 197 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 3.27e-21 102 33 4 205 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P34712 2.53e-29 127 35 3 198 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 1.9e-28 124 32 2 219 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q9Y7M7 2.71e-29 126 29 4 305 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14286 3.76e-29 125 27 3 306 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59R09 3.76e-29 126 33 2 218 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2G506 4.4e-29 125 29 4 302 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q46Y89 4.52e-29 125 30 4 276 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6YUU5 4.62e-29 126 32 2 229 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 1.61e-25 115 30 4 287 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q9SGY1 4.75e-29 126 34 2 217 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 1.34e-27 122 30 2 238 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9ZR72 5.57e-29 126 34 2 222 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 5.67e-29 126 34 3 215 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
S0EGU4 6.24e-29 126 31 2 207 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 2.01e-10 67 24 14 493 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q57180 8.11e-29 124 30 4 255 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q23868 8.76e-29 125 31 3 241 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q3BTC8 8.97e-29 124 32 3 260 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q9JI39 9.21e-29 124 32 5 258 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
P33311 9.36e-29 125 30 5 310 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2M3G0 9.43e-29 125 32 2 217 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 2.22e-26 118 32 3 231 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
O95342 9.49e-29 125 32 3 231 1 ABCB11 Bile salt export pump Homo sapiens
O95342 4.33e-22 104 29 6 316 1 ABCB11 Bile salt export pump Homo sapiens
Q54BT3 1.04e-28 125 32 2 217 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 2.03e-25 115 31 3 225 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q9LSJ2 1.05e-28 125 29 5 292 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 5.22e-28 123 32 3 234 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q8PKS5 1.1e-28 124 32 3 260 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q47JR8 1.48e-28 123 32 3 267 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
G5EG61 1.53e-28 124 29 6 316 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 3.31e-26 117 32 2 226 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q9LVM1 1.56e-28 124 31 2 223 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q8XXB6 1.63e-28 123 31 6 280 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6F9X0 1.87e-28 123 26 5 338 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P40416 1.98e-28 123 25 4 367 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16877 2.05e-28 124 33 3 222 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 4.97e-28 123 31 3 233 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q9N0V3 2.05e-28 124 32 3 231 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 2.66e-21 102 32 2 230 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q89UT8 2.27e-28 123 28 13 440 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P22638 2.44e-28 123 24 8 405 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7RX59 2.94e-28 123 27 4 303 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O70127 2.94e-28 124 32 3 231 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 8.1e-22 103 33 2 230 1 Abcb11 Bile salt export pump Rattus norvegicus
Q0VQP5 3.12e-28 122 33 3 229 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4HVU7 3.36e-28 123 32 1 214 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q03519 3.76e-28 122 29 3 311 1 TAP2 Antigen peptide transporter 2 Homo sapiens
P16876 3.77e-28 123 33 3 221 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 2.09e-27 121 31 3 233 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P47261 3.98e-28 122 26 3 271 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q4WPP6 4.04e-28 123 35 2 211 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q08D64 4.14e-28 123 23 14 519 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q9LSJ6 4.88e-28 123 30 3 245 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 5.94e-26 117 26 4 290 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
P36370 5.16e-28 122 30 9 347 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
Q00748 5.52e-28 123 35 5 215 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 5.57e-28 123 34 2 207 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
B5X0E4 6.66e-28 122 32 3 231 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 8.64e-28 122 31 2 217 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
P34713 6.76e-28 122 32 4 225 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 1.57e-26 118 28 5 292 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
Q87EF0 6.78e-28 121 30 3 294 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P21958 7.53e-28 122 31 8 345 1 Tap1 Antigen peptide transporter 1 Mus musculus
P94367 7.58e-28 121 35 2 208 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q1GZI0 7.59e-28 121 29 3 273 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1LQD3 8.07e-28 121 30 5 276 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9QY30 8.1e-28 122 32 3 232 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 7.92e-21 100 32 2 230 1 Abcb11 Bile salt export pump Mus musculus
Q480N3 8.29e-28 121 28 6 285 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9LSJ8 8.62e-28 122 28 4 285 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 9.83e-27 119 30 3 234 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q3SP57 9.21e-28 121 31 6 275 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
F2SQT8 9.25e-28 122 32 5 236 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 5.41e-25 114 30 3 240 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q6Q876 1.06e-27 122 27 9 358 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 3.34e-25 114 29 4 238 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q9LHD1 1.38e-27 122 28 3 261 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 1.26e-23 109 31 3 233 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9PEE7 1.56e-27 120 30 3 294 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q61102 1.76e-27 120 33 3 200 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q9M0G9 1.85e-27 120 30 2 219 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q9ZNB0 1.89e-27 120 26 11 471 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6C6N0 2.46e-27 120 27 6 371 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q20Z38 2.84e-27 119 31 7 280 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q6N1Y7 3.07e-27 119 33 1 210 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q4ZZ16 4.2e-27 119 35 2 218 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q6FZF2 5.64e-27 119 24 6 402 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q704E8 6.31e-27 119 30 4 221 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q9FHF1 7.12e-27 119 28 4 312 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 4.61e-24 110 34 6 232 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FUT3 7.13e-27 119 30 2 223 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q9M1Q9 8.22e-27 119 32 4 220 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 3.59e-23 108 30 5 246 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
H2LNR5 8.86e-27 119 30 1 210 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q1RJ91 9.99e-27 117 29 4 271 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q9FNU2 1.1e-26 118 27 6 284 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
Q8LPQ6 1.17e-26 118 33 3 230 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
P9WQJ3 1.19e-26 118 33 2 205 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 1.19e-26 118 33 2 205 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 1.19e-26 118 33 2 205 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6G2Z5 1.25e-26 117 24 6 400 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A0A1U9YI12 1.76e-26 118 33 4 209 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 9.6e-26 116 31 4 247 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
O75027 1.87e-26 117 32 3 200 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q1QH37 1.9e-26 117 33 2 218 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
E7F6F7 2.05e-26 117 30 1 210 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q2KYS6 2.34e-26 117 26 4 282 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q6BXD7 2.34e-26 117 27 5 308 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5NIG3 2.63e-26 117 26 3 273 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 2.63e-26 117 26 3 273 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q9LHK4 2.71e-26 117 28 3 235 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 5.98e-21 101 32 2 221 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
P54683 2.74e-26 118 34 4 210 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
Q7VL52 3.93e-26 116 31 2 229 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P97998 4.21e-26 116 29 4 243 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q8T9W1 4.41e-26 117 33 4 209 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q07QX6 4.95e-26 115 31 3 264 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q2K342 5.29e-26 115 31 2 230 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q68W42 5.69e-26 115 31 2 218 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P36372 6.58e-26 115 28 7 351 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
Q06034 7.27e-26 116 30 6 270 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 5.3e-20 98 34 1 195 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
P0CL93 7.46e-26 115 28 4 307 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CL92 7.66e-26 115 28 4 307 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q9LJX0 9.23e-26 116 32 2 219 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 9.92e-26 116 32 2 229 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q4UMZ3 1.08e-25 114 29 2 243 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O80725 1.47e-25 115 33 5 221 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 4.14e-22 104 29 5 234 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
P36371 1.73e-25 114 28 8 360 1 Tap2 Antigen peptide transporter 2 Mus musculus
J9VWU3 1.76e-25 114 32 1 213 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q92GP9 2.23e-25 114 27 5 297 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q0BKJ3 2.4e-25 114 26 3 273 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 2.4e-25 114 26 3 273 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
A0A1U8QG99 2.51e-25 115 32 3 218 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 9.64e-18 91 29 6 258 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q3IGX5 2.62e-25 113 24 12 413 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
Q6FIK3 2.65e-25 114 33 2 223 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9Y8G2 2.72e-25 114 32 3 218 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 1.02e-17 90 29 6 258 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q47908 3.11e-25 113 25 3 273 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
P33310 3.16e-25 114 33 3 220 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9FWX7 3.51e-25 114 32 4 220 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 2.81e-23 108 30 3 233 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9ZCM8 3.91e-25 113 31 2 216 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q8U4L3 5.07e-25 107 31 6 215 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O07549 5.09e-25 113 24 9 393 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
P94366 6.51e-25 112 31 4 296 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
Q5F4X8 6.62e-25 112 24 4 344 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9M0M2 8.87e-25 113 32 4 231 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 1.29e-20 100 30 2 214 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q751N2 1.09e-24 112 32 1 203 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q4WA92 1.14e-24 112 31 5 221 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 1.66e-22 106 24 7 368 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2J0F4 1.14e-24 111 34 1 200 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
A0A095C325 1.23e-24 112 30 5 246 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 8.12e-24 110 31 2 212 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q89A96 1.41e-24 111 25 3 277 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
J9VF33 1.49e-24 112 32 2 212 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 1.95e-24 112 29 4 228 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P78966 1.67e-24 112 35 4 209 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.67e-19 96 26 8 305 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1MAB5 1.77e-24 111 31 2 230 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8YH20 1.98e-24 111 26 6 309 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
O57872 2.7e-24 105 32 7 215 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P0C529 3.31e-24 110 26 6 309 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 3.31e-24 110 26 6 309 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q8G0T8 3.86e-24 110 26 6 309 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
Q9JXR3 3.95e-24 110 24 3 328 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q82WT5 4.06e-24 107 35 7 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q98K23 4.79e-24 107 33 8 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9CHL8 5.15e-24 109 28 7 317 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
Q71ED1 7.14e-24 109 30 3 240 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q54NL1 8.11e-24 110 29 4 234 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.11e-11 71 26 3 200 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q9SYI3 8.66e-24 110 33 4 220 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 1.17e-22 106 30 2 214 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q6D2F6 9.57e-24 106 36 7 208 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q12C33 1.43e-23 108 25 5 329 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9V2E4 2.07e-23 103 32 7 214 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
K3VYH8 2.16e-23 108 26 11 375 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 1.72e-18 93 27 7 274 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
P12866 2.35e-23 108 32 6 239 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 2.14e-22 105 30 5 244 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P68580 2.64e-23 108 21 11 556 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 2.64e-23 108 21 11 556 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
Q9M3B9 3.17e-23 108 29 1 232 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 1.48e-16 87 24 13 436 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q8UH62 3.34e-23 104 34 9 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P57552 3.4e-23 107 25 3 286 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q0D9V6 3.5e-23 104 37 6 198 1 STAR1 Protein STAR1 Oryza sativa subsp. japonica
Q9JW59 3.69e-23 107 24 4 337 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8LPT1 4.21e-23 108 28 3 264 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 3.58e-17 89 25 6 308 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q9K876 4.57e-23 104 33 8 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P97046 5.2e-23 106 27 7 317 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
Q9FWX8 5.8e-23 107 30 3 233 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 7.3e-23 107 31 4 220 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q7VWD8 6.23e-23 106 27 6 280 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9N7 6.23e-23 106 27 6 280 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 6.23e-23 106 27 6 280 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NWX3 8.53e-23 103 37 9 213 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P63354 8.58e-23 103 34 8 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 8.58e-23 103 34 8 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P9WQJ0 9.13e-23 105 26 10 365 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9C9W0 9.29e-23 101 34 8 212 2 ABCI17 ABC transporter I family member 17 Arabidopsis thaliana
P0A4W5 1.06e-22 105 26 10 365 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 1.06e-22 105 26 10 365 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5FA19 1.13e-22 103 37 7 215 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8U3E0 1.21e-22 101 32 7 229 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q50294 1.59e-22 100 30 5 221 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O31711 1.95e-22 99 30 5 212 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q9X2W0 2.09e-22 104 25 14 457 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
Q88AS5 2.41e-22 101 33 7 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q80WJ6 2.68e-22 105 32 4 220 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 1.56e-14 80 24 5 272 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q8U4K3 2.78e-22 101 32 7 220 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9SYI2 2.98e-22 105 33 4 220 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 4.61e-20 98 30 3 215 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q6Y306 3.46e-22 105 32 4 220 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 7.2e-15 82 24 5 272 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q8E8K8 3.47e-22 101 32 7 234 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P0AAG5 3.55e-22 103 28 3 277 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 3.55e-22 103 28 3 277 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 3.55e-22 103 28 3 277 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q13BH6 5.09e-22 103 27 11 443 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
Q8FRX8 5.46e-22 101 33 8 230 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O31339 5.73e-22 101 31 6 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6LV32 6e-22 98 32 7 217 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
P0A2V1 9.16e-22 102 27 6 326 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 9.16e-22 102 27 6 326 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9VL32 1e-21 103 31 7 239 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q9VL32 4.54e-13 76 27 5 217 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
P26362 1.28e-21 103 35 3 205 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
P26362 7.07e-13 75 27 4 229 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
P23886 1.45e-21 102 25 8 348 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q9P5N0 1.91e-21 102 25 5 293 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N0 3.26e-15 83 25 8 298 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q96J65 2.28e-21 102 32 3 209 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 5.97e-17 88 25 3 231 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
O34979 2.59e-21 96 30 4 208 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
P18767 2.85e-21 101 29 2 219 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
Q9LYS2 2.93e-21 102 29 6 267 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LYS2 5.35e-16 85 24 4 270 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q0I3Y9 3.41e-21 99 30 8 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q8NSN2 3.73e-21 98 30 8 263 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6D4E2 3.89e-21 99 28 9 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 4.42e-21 97 36 9 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P91660 5.18e-21 101 32 5 225 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
P91660 4.82e-20 98 28 4 230 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
Q9KS33 6.16e-21 98 29 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q983H5 6.4e-21 100 28 6 303 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9JUX4 6.58e-21 97 33 8 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P26363 6.87e-21 101 30 4 233 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
P26363 4.7e-15 82 23 6 285 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
Q81GU1 6.9e-21 97 31 6 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q830W6 8.13e-21 97 31 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q722B1 8.42e-21 97 30 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
P56344 9.26e-21 94 34 7 210 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
F9X9V4 9.78e-21 100 34 3 203 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
F9X9V4 3.14e-11 70 25 6 259 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q9JZW0 9.83e-21 97 33 8 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8RCU0 1.18e-20 94 30 2 185 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q4W575 1.22e-20 97 35 7 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.22e-20 97 35 7 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9KUI0 1.22e-20 97 31 7 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RHL0 1.23e-20 95 31 6 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9I6L0 1.28e-20 96 33 8 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P47425 1.41e-20 95 30 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q21TG3 1.54e-20 94 33 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8Y8T6 1.71e-20 97 29 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q87PH3 2.12e-20 96 30 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0S0Z3 2.33e-20 96 33 9 222 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q4K681 2.4e-20 96 31 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
F1M3J4 2.96e-20 99 30 8 281 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
F1M3J4 9.01e-15 81 30 3 190 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
P45171 3e-20 96 30 7 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P27675 3.19e-20 93 29 6 224 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q9C8G9 4.12e-20 98 29 7 255 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 1.35e-15 84 29 3 212 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
P74548 4.14e-20 95 31 7 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54U44 4.16e-20 98 26 10 318 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 1.07e-14 81 23 16 503 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q92DL6 4.17e-20 95 29 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O85818 4.43e-20 95 30 7 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
P33116 4.51e-20 97 25 9 366 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
Q8TI15 4.52e-20 94 31 7 234 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9CP06 4.84e-20 95 30 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q42093 4.91e-20 98 27 7 283 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q42093 2.4e-17 90 27 4 286 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q1QE80 5.13e-20 95 31 8 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4QK57 5.24e-20 95 30 7 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
P10346 5.75e-20 92 32 4 206 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q4KC87 5.82e-20 95 36 6 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q65UE1 5.98e-20 95 30 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8LGU1 6.03e-20 98 32 5 217 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 3.28e-14 79 23 3 263 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
O15439 6.57e-20 97 32 5 207 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
O15439 6.05e-15 82 31 3 190 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
Q5JEB0 6.6e-20 94 32 7 218 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A1SWH9 6.87e-20 95 29 8 228 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q2K4V4 7.33e-20 95 31 5 212 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q93DX8 7.61e-20 92 34 8 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q5ZWE4 8.95e-20 94 27 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8PY26 1.01e-19 93 30 7 238 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
D3GE74 1.04e-19 97 31 9 238 1 STR ABC transporter G family member STR Medicago truncatula
Q5X627 1.04e-19 94 28 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
A1B9K8 1.2e-19 92 33 7 208 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q81J16 1.26e-19 92 34 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7NIW1 1.29e-19 94 35 9 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q89UD2 1.4e-19 94 35 11 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A0AGP9 1.44e-19 94 29 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8F6Z1 1.56e-19 94 33 7 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.56e-19 94 33 7 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P33982 1.91e-19 92 28 6 232 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q03203 1.98e-19 95 28 5 234 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q6MCV4 2.03e-19 94 32 8 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q1RD28 2.08e-19 94 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 2.08e-19 94 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q7MKU3 2.1e-19 94 29 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 2.1e-19 94 29 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8RQL7 2.11e-19 91 30 6 206 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q32EY4 2.16e-19 93 29 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q9C8H1 2.18e-19 96 24 9 333 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9C8H1 1.08e-14 81 29 3 202 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
O07016 2.23e-19 92 30 6 203 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
P69877 2.28e-19 93 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 2.28e-19 93 29 7 219 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 2.28e-19 93 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 2.28e-19 93 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 2.28e-19 93 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q7GB25 2.31e-19 96 28 6 252 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q7GB25 1.56e-15 84 28 2 209 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q65F80 2.31e-19 93 32 6 212 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9KHT9 2.35e-19 94 29 6 217 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 2.35e-19 94 29 6 217 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q0T5R2 2.44e-19 93 29 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
P44513 2.47e-19 93 32 5 203 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6NJ07 2.5e-19 92 33 7 214 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A3DJK5 2.67e-19 91 30 8 226 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_13815
Feature type CDS
Gene arpD
Product ABC-type protease/lipase transport system, ATPase and permease components
Location 102425 - 104131 (strand: 1)
Length 1707 (nucleotides) / 568 (amino acids)

Contig

Accession ZDB_223
Length 138954 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1304
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4618 Intracellular trafficking, secretion, and vesicular transport (U) U ABC-type protease/lipase transport system, ATPase and permease components

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12536 ATP-binding cassette, subfamily C, type I secretion system permease/ATPase ABC transporters -

Protein Sequence

MLSGKTRNDITAFIAARKSLFTSLALFSGLINLLMLVPSVYMLQVYDRVLPSGNEMTLLMLTLIMAGLLALTGGLDYLRNMLVIRMSNQLDLALNTRVYDAAFQAKLHRTPGHLPLQAQTDLMILRRFITGNGIFAFLDLPWFPLYLLVIALFNPWLGLFACGGAVVLIALALLNERLSGPPLTAANRSSAAAQGMQGSHFAHTEPAEAMGMQQYLRQRWLNRHCDSLKKQTQASDYSAKIMTITKTIRLILQSLMLGLGGWLALDNTISPGMMIAGSILLGRALSPVEQVTGVWKSAKESRLAYQRITALLAAHPQPPQKLALPVPQGNLSVSVMQAGYPGADTPQLHNLHFSLVPGEVLGIIGPSGAGKSALAKLLAGLWPATRGAVRLDRADLCQQDKAVSGKYIGYLPQEIALFPGTIADNIARFDPDADPENIIRAAQLAQVHELILQLPQGYETLTGADGTGLSGGQRQRIALARALYGSPALIILDEPNAALDDAGLSALLAAMDTLKKQGKTIVLITHHKPLLSVTDKLLLLTGGRMQLFGPAEKVIETLNNQAGKNNDH

Flanking regions ( +/- flanking 50bp)

GTGAACAATATTATCAATCCCGGCAGACATGCCGGGCGGAGTCCCTGTATATGCTTTCCGGGAAAACCAGAAATGATATTACGGCATTTATTGCCGCCCGCAAGTCCCTGTTTACCTCACTGGCATTATTCAGCGGGCTGATTAATCTGCTGATGCTCGTGCCGTCTGTGTATATGTTGCAGGTGTACGACCGCGTTCTGCCCTCCGGCAATGAAATGACGCTGCTGATGCTGACGCTGATAATGGCCGGATTACTGGCACTGACCGGCGGTCTCGATTATCTGCGCAATATGCTGGTGATCCGCATGAGTAACCAGTTAGATCTGGCGCTGAATACCCGTGTTTATGACGCGGCGTTTCAGGCAAAACTGCACCGTACGCCGGGGCATCTGCCGTTACAGGCACAGACCGATCTGATGATCCTGCGCCGTTTTATCACCGGCAACGGTATTTTTGCTTTTCTCGATCTGCCCTGGTTCCCGCTTTATCTGCTGGTGATCGCCCTGTTTAATCCGTGGCTGGGATTGTTTGCCTGTGGCGGTGCCGTCGTGCTGATCGCGCTTGCGCTGCTCAATGAACGGCTTTCCGGGCCGCCGCTGACCGCTGCAAACCGCTCTTCCGCCGCCGCACAGGGCATGCAGGGCAGCCATTTTGCCCATACTGAACCCGCAGAGGCGATGGGAATGCAGCAGTATTTGCGTCAGCGCTGGCTGAACCGGCACTGCGACAGCCTGAAGAAACAGACACAGGCCAGTGATTATTCAGCAAAAATCATGACAATCACCAAAACCATCCGCCTGATCCTGCAATCCCTGATGCTGGGGCTGGGCGGCTGGCTGGCGCTGGATAATACCATCTCGCCGGGCATGATGATTGCCGGGTCGATTCTGCTGGGACGCGCGCTGTCACCGGTCGAACAGGTCACAGGCGTATGGAAAAGTGCCAAAGAGAGCAGGCTGGCGTATCAGCGGATTACTGCGTTGCTGGCGGCTCACCCGCAACCACCGCAGAAGCTGGCACTGCCGGTTCCGCAGGGTAATTTGTCCGTCTCCGTGATGCAGGCGGGTTATCCCGGCGCTGACACACCGCAGCTGCACAATTTGCATTTCAGCCTTGTACCGGGGGAGGTGCTGGGGATCATCGGTCCGTCAGGTGCCGGAAAATCGGCACTGGCAAAACTGCTCGCCGGGTTATGGCCTGCAACACGCGGGGCTGTCCGGCTGGACAGGGCCGATCTCTGTCAGCAGGACAAAGCGGTGTCCGGCAAATATATCGGTTATCTTCCCCAGGAAATTGCACTTTTTCCCGGCACAATCGCCGATAATATCGCCCGTTTCGATCCTGATGCTGATCCGGAAAATATCATCCGTGCGGCGCAACTGGCACAGGTACATGAATTGATCCTGCAACTGCCGCAGGGCTATGAAACCCTGACCGGGGCAGACGGTACCGGCCTTTCCGGCGGTCAGCGGCAGCGGATCGCCCTGGCGCGGGCACTGTACGGCTCACCGGCACTGATCATTCTGGATGAACCCAATGCCGCGCTGGATGATGCCGGGCTCAGTGCGCTGTTAGCTGCCATGGATACGCTGAAAAAACAGGGAAAAACCATTGTGCTTATTACTCACCATAAACCGCTGCTGTCCGTGACGGACAAGCTGTTGCTGCTTACAGGCGGACGGATGCAGCTTTTTGGTCCGGCGGAGAAGGTCATTGAAACACTTAATAATCAGGCGGGTAAAAATAATGATCACTAAATGGTTGTCTGCGGCGCCGGGGGTAAAAACCGATACCGGCGGGTATCAGC