Homologs in group_2604

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03460 FBDBKF_03460 94.0 Morganella morganii S1 livF high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF
EHELCC_07075 EHELCC_07075 94.0 Morganella morganii S2 livF high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF
NLDBIP_07400 NLDBIP_07400 94.0 Morganella morganii S4 livF high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF
LHKJJB_06935 LHKJJB_06935 94.0 Morganella morganii S3 livF high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF
HKOGLL_03995 HKOGLL_03995 94.0 Morganella morganii S5 livF high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF

Distribution of the homologs in the orthogroup group_2604

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2604

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P22731 3.02e-133 377 79 0 233 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
P0A191 5.69e-132 374 78 0 233 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 5.69e-132 374 78 0 233 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
P21630 7.63e-117 335 74 0 233 3 braG High-affinity branched-chain amino acid transport ATP-binding protein BraG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q58664 6.04e-58 186 40 1 233 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O28882 4.11e-47 158 37 1 233 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58663 5.15e-37 133 30 4 250 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45073 5.32e-37 132 32 1 234 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O28881 2.84e-35 129 31 2 245 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P33982 2.95e-35 129 32 2 228 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10346 1.29e-33 124 31 2 226 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P0A9V4 8.85e-33 122 32 1 233 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 8.85e-33 122 32 1 233 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 8.85e-33 122 32 1 233 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 8.85e-33 122 32 1 233 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P24693 2.68e-32 120 34 3 210 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P21629 2.21e-31 118 32 4 250 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P25885 3.69e-31 118 31 2 228 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q39GT7 3.7e-31 119 33 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BWI2 1.07e-30 118 33 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q3MGT2 1.12e-30 116 32 7 246 3 phnC Phosphonates import ATP-binding protein PhnC Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6MCV4 1.96e-30 119 32 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
O34677 1.79e-29 113 30 2 226 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q04G50 1.99e-29 115 32 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8YUI9 4.46e-29 112 31 7 246 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9KUI0 6.9e-29 114 31 5 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q13VD7 8.48e-29 114 34 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q18C09 1.35e-28 112 31 5 229 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
P23703 1.88e-28 112 34 3 222 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P72335 1.93e-28 112 32 3 226 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P63374 2.03e-28 110 33 6 234 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P63373 2.03e-28 110 33 6 234 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7VM95 2.55e-28 112 30 5 238 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O31339 3.07e-28 112 32 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P0A193 4.35e-28 110 32 5 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 4.35e-28 110 32 5 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q6HFB5 4.79e-28 110 32 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Bacillus thuringiensis subsp. konkukian (strain 97-27)
P0A9S9 5.49e-28 109 32 5 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 5.49e-28 109 32 5 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 5.49e-28 109 32 5 250 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
Q73EL7 5.73e-28 111 33 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81ZF5 6.1e-28 111 33 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q8KLG1 6.18e-28 111 33 3 222 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q160M2 6.25e-28 112 35 6 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6HP89 6.56e-28 111 33 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63GR8 6.77e-28 111 33 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q5ZWE4 7.1e-28 112 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P45769 7.14e-28 109 29 3 226 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P55476 7.85e-28 111 33 2 221 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q733D6 1.14e-27 108 32 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Bacillus cereus (strain ATCC 10987 / NRS 248)
P94440 1.2e-27 110 33 4 214 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q88ZJ6 1.21e-27 111 31 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q81IN8 1.21e-27 110 33 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q13ZJ1 1.23e-27 110 36 3 225 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q637E2 1.55e-27 108 32 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Bacillus cereus (strain ZK / E33L)
Q52815 1.7e-27 108 28 3 225 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q83J33 2.28e-27 112 32 4 221 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 1.16e-15 79 28 5 210 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q0SY86 2.28e-27 112 32 4 221 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 1.99e-15 78 28 5 210 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q8DU24 2.7e-27 107 34 9 229 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5WXF0 3.37e-27 110 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q1MMZ3 3.37e-27 108 31 7 249 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q52666 3.48e-27 107 27 3 225 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q7VNG4 3.64e-27 110 31 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q03PF2 4.19e-27 109 31 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P45092 4.45e-27 107 33 4 217 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P56344 5.51e-27 106 32 4 218 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
A0LUE6 5.53e-27 109 35 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A0PY57 6.35e-27 108 32 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
P0DTT6 6.61e-27 107 26 4 230 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A0A0H2ZLL3 6.78e-27 106 33 5 217 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q81VM2 8.7e-27 108 32 4 231 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q81Y10 9.18e-27 106 32 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Bacillus anthracis
Q9HY19 1.12e-26 108 35 6 217 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R79 1.14e-26 108 35 6 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q63H29 1.16e-26 108 31 4 231 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q63S19 1.41e-26 108 34 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 1.41e-26 108 34 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 1.41e-26 108 34 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
A1VZQ5 1.43e-26 105 27 2 234 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q1QE80 1.49e-26 108 31 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q32JQ8 1.8e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q325U1 1.84e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q0TLD2 1.88e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0P9X7 1.95e-26 105 27 2 234 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3Z5F8 2.06e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 2.06e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 2.06e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 2.06e-26 107 31 5 225 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q57T09 2.08e-26 107 30 5 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q6D1C4 2.11e-26 107 31 5 225 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q81A96 2.18e-26 105 32 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8ZRM9 2.24e-26 107 30 5 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9CP06 2.33e-26 107 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
P30750 2.36e-26 107 31 5 225 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q31V51 2.4e-26 109 31 4 216 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 1.4e-15 78 28 5 210 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 2.4e-26 109 31 4 216 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 1.4e-15 78 28 5 210 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8GNH6 2.46e-26 107 32 3 222 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q1R528 2.47e-26 109 31 4 216 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 1.14e-15 79 28 5 210 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q9A502 2.5e-26 107 33 5 217 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8FCE2 2.67e-26 109 31 4 216 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 6.98e-16 79 28 5 210 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 2.67e-26 109 31 4 216 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 6.98e-16 79 28 5 210 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P54537 2.7e-26 105 29 2 215 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P0AAF9 2.7e-26 105 32 3 218 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 2.7e-26 105 32 3 218 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 2.7e-26 105 32 3 218 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 2.7e-26 105 32 3 218 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
P46342 2.83e-26 105 31 7 235 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus subtilis (strain 168)
Q3A9G5 2.96e-26 107 32 7 226 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q81GU1 3.08e-26 107 31 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2K204 3.36e-26 108 32 7 240 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 2.17e-09 60 27 5 225 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P27675 3.37e-26 104 27 4 230 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q2SVP3 3.69e-26 106 31 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5X627 4.4e-26 107 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q4QMH4 4.75e-26 106 30 6 246 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q5PID0 4.81e-26 106 30 5 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5LBT4 4.82e-26 108 32 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64SQ6 5.02e-26 108 32 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q92V71 5.09e-26 105 31 5 232 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
Q663Y5 5.3e-26 108 29 4 221 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q663Y5 8.94e-15 76 26 6 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 5.3e-26 108 29 4 221 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDC0 8.94e-15 76 26 6 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 5.3e-26 108 29 4 221 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q7CFR2 8.94e-15 76 26 6 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 5.3e-26 108 29 4 221 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0D5 8.94e-15 76 26 6 228 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q8X5Q4 5.72e-26 108 32 2 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q8X5Q4 2.93e-15 77 29 4 220 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q38VW6 6.14e-26 106 31 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q10V16 6.22e-26 104 32 6 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Trichodesmium erythraeum (strain IMS101)
O52618 6.3e-26 106 32 3 222 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q0SFY5 7.31e-26 105 33 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q98HF7 8.05e-26 106 33 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7N2D9 8.14e-26 107 27 2 215 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N2D9 4.41e-19 88 27 3 220 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2KDV1 8.65e-26 104 30 6 248 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P74548 9.19e-26 105 31 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P44785 1.02e-25 105 30 6 246 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37388 1.03e-25 107 31 4 216 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 1.52e-15 78 28 5 210 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q3JSQ0 1.14e-25 104 31 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 1.14e-25 104 31 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 1.16e-25 104 31 2 224 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q3M5J9 1.27e-25 103 32 5 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5HIL5 1.47e-25 105 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 1.47e-25 105 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 1.47e-25 105 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
P36947 1.51e-25 107 30 2 216 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 3.84e-15 77 28 4 206 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q8A883 1.61e-25 106 32 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q609Q1 1.64e-25 105 32 5 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8RQL7 1.8e-25 102 28 5 242 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q1M360 2.02e-25 106 31 7 241 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 5.85e-15 76 26 5 227 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8E8K8 2.04e-25 105 31 4 216 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q83MC5 2.08e-25 104 30 5 225 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 2.08e-25 104 30 5 225 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q73F11 2.12e-25 104 31 7 239 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8Z990 2.14e-25 104 30 5 225 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q5WC31 2.17e-25 106 30 2 220 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 3.39e-14 74 24 3 221 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
P94374 2.18e-25 103 31 4 213 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q8XXY9 2.38e-25 104 30 3 226 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9G4F5 2.39e-25 104 31 4 216 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8EBC3 2.48e-25 105 29 4 236 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8U4K3 2.56e-25 104 32 5 215 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O34900 2.7e-25 102 29 4 233 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q1GMA8 2.82e-25 102 30 7 239 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q1LKJ2 2.9e-25 103 32 3 226 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1WVI7 3.19e-25 104 29 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q7MJ01 3.42e-25 101 31 4 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain YJ016)
Q8DAV6 3.42e-25 101 31 4 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain CMCP6)
Q8ELQ6 3.44e-25 104 30 5 221 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6GJL2 3.66e-25 104 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q8NQU4 3.72e-25 102 29 4 237 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0BH79 3.86e-25 104 32 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2SY12 3.94e-25 103 33 5 223 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1TAI4 4.19e-25 104 31 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q55EH8 4.52e-25 106 29 8 221 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
Q8NY21 4.59e-25 103 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 4.59e-25 103 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q7NQN5 4.59e-25 104 34 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q21XJ9 4.63e-25 102 31 4 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8ELA5 4.86e-25 103 31 5 238 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P45171 4.98e-25 104 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77795 5e-25 103 31 5 222 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q9JUX4 5.08e-25 103 32 6 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7NWX3 5.43e-25 103 34 5 218 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q81IZ6 5.47e-25 103 31 5 235 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2JB14 5.48e-25 102 31 4 246 3 phnC Phosphonates import ATP-binding protein PhnC Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q0KDG3 5.71e-25 103 32 6 229 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q578K3 5.9e-25 103 33 6 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5.9e-25 103 33 6 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q5XCA4 6.11e-25 104 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A1B9Q7 6.21e-25 103 31 6 236 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q3AAA4 6.49e-25 101 30 8 250 3 pstB Phosphate import ATP-binding protein PstB Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q6WB51 6.52e-25 102 32 7 227 3 pstB Phosphate import ATP-binding protein PstB Alcaligenes faecalis
Q8FV85 6.64e-25 103 31 4 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 6.64e-25 103 31 4 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 6.64e-25 103 31 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 6.64e-25 103 31 4 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q18AM3 6.88e-25 103 31 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q8YCG3 6.88e-25 103 33 6 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q65VG9 6.9e-25 103 28 6 246 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q82WT5 7.08e-25 103 30 4 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P0CZ35 7.12e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 7.12e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 7.12e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q03AH0 7.15e-25 103 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q9X196 7.26e-25 103 30 4 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9JZW0 7.27e-25 103 32 6 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P37774 7.52e-25 101 30 5 233 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q4QK57 7.56e-25 103 31 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
P37009 7.89e-25 103 29 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P26050 7.94e-25 102 32 2 221 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q32EX7 7.99e-25 100 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q5M4F2 8e-25 101 29 8 238 3 pstB2 Phosphate import ATP-binding protein PstB 2 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZU2 8e-25 101 29 8 238 3 pstB2 Phosphate import ATP-binding protein PstB 2 Streptococcus thermophilus (strain CNRZ 1066)
Q7A7E3 8.08e-25 103 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 8.08e-25 103 30 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8FVV5 8.19e-25 103 33 6 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q63TY1 8.48e-25 103 32 7 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q9HMZ4 8.51e-25 100 33 4 216 3 VNG_2317G Putative ABC transporter ATP-binding protein VNG_2317G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8CUY0 8.69e-25 101 29 7 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q62K82 9.02e-25 103 32 7 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q47T99 9.18e-25 103 34 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q1J6Q6 9.46e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 9.46e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 9.46e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 9.46e-25 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q9K8N1 9.62e-25 101 31 7 229 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KHT9 9.98e-25 103 31 4 229 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 9.98e-25 103 31 4 229 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q3KBH4 1.12e-24 103 33 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q0I3Y9 1.12e-24 103 30 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q12R52 1.18e-24 100 31 6 238 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5E4V6 1.19e-24 104 29 3 220 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 8.97e-22 96 33 5 206 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q664G2 1.2e-24 104 32 2 231 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664G2 2.99e-17 83 29 4 210 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDJ0 1.21e-24 104 32 2 231 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 3.07e-17 83 29 4 210 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 1.21e-24 104 32 2 231 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 3.07e-17 83 29 4 210 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 1.21e-24 104 32 2 231 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 3.07e-17 83 29 4 210 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q329G7 1.23e-24 104 31 2 231 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q329G7 8e-15 76 28 3 213 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q97KS6 1.27e-24 102 32 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7CN92 1.28e-24 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 1.28e-24 103 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q830W6 1.29e-24 103 31 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
P63368 1.37e-24 100 31 9 237 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63367 1.37e-24 100 31 9 237 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype III (strain NEM316)
Q3K199 1.37e-24 100 31 9 237 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1MQ44 1.4e-24 103 33 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q3IM24 1.49e-24 101 30 5 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P48243 1.54e-24 100 29 4 223 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8ZPK4 1.6e-24 103 32 8 240 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1M7W6 1.6e-24 102 31 3 225 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O57896 1.63e-24 102 32 5 215 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q3Z300 1.69e-24 100 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.69e-24 100 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.69e-24 100 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.69e-24 100 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3MB44 1.8e-24 104 32 2 217 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MB44 2.15e-14 75 27 3 224 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P33360 1.86e-24 101 30 6 244 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q5WET7 1.89e-24 100 29 7 237 3 pstB2 Phosphate import ATP-binding protein PstB 2 Shouchella clausii (strain KSM-K16)
Q73P71 1.9e-24 100 30 7 235 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P50332 1.92e-24 102 31 3 228 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q02ME3 2.06e-24 102 31 5 217 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7AH43 2.07e-24 102 28 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
O34814 2.33e-24 99 26 5 221 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
Q7WID6 2.54e-24 102 30 6 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P44871 2.62e-24 99 33 4 214 3 ftsE Cell division ATP-binding protein FtsE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CQS7 2.83e-24 101 29 5 221 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 2.83e-24 101 29 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7VYN2 2.84e-24 102 30 6 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q65F80 2.86e-24 101 30 5 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9MUN1 2.9e-24 102 30 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9X051 2.92e-24 103 27 3 236 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 8.38e-16 79 28 4 208 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q3K6R9 3.05e-24 100 30 5 241 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
Q1MCN6 3.06e-24 102 31 4 213 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2YVT7 3.07e-24 101 29 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9CL63 3.1e-24 103 30 2 218 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 1.06e-13 73 27 3 217 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q31ZH4 3.24e-24 99 31 4 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q5L222 3.3e-24 101 30 3 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q65UE1 3.35e-24 102 30 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1BY14 3.47e-24 101 31 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 3.47e-24 101 31 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q4JTG9 3.56e-24 102 31 4 222 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q83HT1 3.57e-24 99 30 5 222 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain TW08/27)
O85818 3.66e-24 102 30 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q1B8V9 3.89e-24 102 30 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 3.89e-24 102 30 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q63E84 4.02e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 4.02e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 4.02e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q9V2C0 4.05e-24 101 32 5 215 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q81TH8 4.11e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q87R20 4.26e-24 99 31 4 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5YZY9 4.27e-24 101 30 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q39IE7 4.31e-24 101 31 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6HLQ9 4.37e-24 100 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P75957 4.4e-24 99 30 5 223 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q8X8E3 4.4e-24 99 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q30V33 4.45e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q4KC87 4.68e-24 101 31 4 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9KS33 4.8e-24 101 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0K998 4.96e-24 101 30 7 241 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5YRD1 5.04e-24 100 33 6 220 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q5WCI1 5.1e-24 99 33 5 214 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q9KFN9 5.14e-24 99 28 5 236 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P32010 5.22e-24 100 33 3 217 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q45460 5.4e-24 101 31 5 232 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q9WYI7 5.48e-24 99 32 5 207 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q92EZ6 5.56e-24 100 29 5 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q98K23 6.02e-24 100 32 5 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6D201 6.15e-24 100 29 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N6Z2 6.41e-24 101 29 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q4QP85 6.43e-24 100 31 6 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q2K4V4 6.5e-24 101 31 4 213 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q81GC1 7.08e-24 100 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88AS5 7.35e-24 100 31 7 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q92W56 7.51e-24 102 34 5 223 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q92W56 1.8e-15 78 28 3 206 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q92WD6 7.76e-24 100 32 4 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q9V1Q4 8.52e-24 99 31 7 237 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q1AS06 8.57e-24 100 31 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q9KAG5 8.84e-24 102 26 2 235 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 4.73e-16 80 28 4 214 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q46Y69 9.38e-24 100 32 5 223 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q83GE8 9.43e-24 98 30 5 222 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain Twist)
P44513 9.6e-24 100 30 6 233 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P63354 9.67e-24 100 30 4 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 9.67e-24 100 30 4 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q74KF9 9.89e-24 99 31 7 224 3 pstB1 Phosphate import ATP-binding protein PstB 1 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q6D734 1.04e-23 100 28 5 237 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8UH62 1.05e-23 100 31 6 218 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98GF5 1.06e-23 99 31 7 247 3 phnC Phosphonates import ATP-binding protein PhnC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q74LQ3 1.07e-23 98 28 8 240 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2K8C8 1.12e-23 100 32 5 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8UIW7 1.19e-23 99 29 4 235 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
P63363 1.23e-23 98 30 9 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WT3 1.23e-23 98 30 9 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria monocytogenes serotype 4b (strain F2365)
P63364 1.23e-23 98 30 9 250 3 pstB1 Phosphate import ATP-binding protein PstB 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6HG98 1.25e-23 102 31 7 230 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 1.7e-17 84 28 5 246 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8ELR4 1.26e-23 100 31 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8YA75 1.29e-23 100 29 5 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7W6G5 1.31e-23 100 30 6 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5JEB0 1.37e-23 99 33 5 215 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8DPC2 1.37e-23 100 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.37e-23 100 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.37e-23 100 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q92UV5 1.38e-23 100 32 4 200 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q8K449 1.39e-23 102 32 5 217 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8K449 4.76e-10 62 26 5 200 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
P9WQM1 1.41e-23 100 32 4 209 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.41e-23 100 32 4 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.41e-23 100 32 4 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1TXH7 1.42e-23 100 31 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9TKX3 1.48e-23 99 32 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9K876 1.51e-23 100 31 4 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8L1U3 1.61e-23 98 31 6 247 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 1.61e-23 98 31 6 247 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q50966 1.65e-23 99 34 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q2NRN5 1.66e-23 99 30 5 225 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q724C0 1.73e-23 99 29 5 224 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q46ZM0 1.8e-23 100 30 7 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9I1C8 1.81e-23 100 31 5 217 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5FA19 1.86e-23 99 35 6 218 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9A7X1 1.97e-23 99 30 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q0VT01 1.97e-23 101 28 5 221 3 macB Macrolide export ATP-binding/permease protein MacB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q88J90 1.97e-23 101 31 1 219 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88J90 6.53e-16 79 28 4 214 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0A8P9 2.1e-23 97 32 5 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9KN37 2.13e-23 100 30 4 229 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 8.71e-20 90 26 5 227 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1B677 2.13e-23 99 31 5 219 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q6VMN4 2.13e-23 100 27 5 236 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 2.91e-21 95 30 5 209 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q3JYY5 2.15e-23 97 31 7 228 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q2YUY7 2.15e-23 97 29 7 249 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain bovine RF122 / ET3-1)
P57066 2.17e-23 97 31 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q93KD4 2.24e-23 96 33 5 210 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
P61482 2.29e-23 97 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 2.29e-23 97 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 2.29e-23 97 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q12NL5 2.44e-23 97 31 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8RGC8 2.52e-23 99 27 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P63372 2.56e-23 97 31 7 228 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63371 2.56e-23 97 31 7 228 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype III (strain NEM316)
Q0AU85 2.56e-23 99 31 5 221 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q5PMK1 2.69e-23 99 30 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7N8B9 2.79e-23 99 29 5 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P40790 2.8e-23 99 30 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.8e-23 99 30 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q65HB9 2.83e-23 97 29 8 248 3 pstB2 Phosphate import ATP-binding protein PstB 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Z7H7 2.83e-23 99 30 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q5LX21 2.85e-23 99 31 5 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P08720 2.86e-23 98 31 3 225 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q5FM18 2.87e-23 97 31 9 235 3 pstB1 Phosphate import ATP-binding protein PstB 1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q0K9I2 2.94e-23 98 31 4 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2KVK2 2.95e-23 99 31 5 221 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
A3PRY1 2.96e-23 99 32 4 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1LNM0 2.97e-23 98 31 3 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5YTW4 3e-23 97 31 6 238 3 phnC Phosphonates import ATP-binding protein PhnC Nocardia farcinica (strain IFM 10152)
Q9CM80 3.05e-23 99 30 5 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q329I3 3.14e-23 97 27 8 255 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q5WET8 3.18e-23 97 31 9 241 3 pstB1 Phosphate import ATP-binding protein PstB 1 Shouchella clausii (strain KSM-K16)
Q65E55 3.21e-23 100 28 2 218 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 7.75e-15 76 28 3 210 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9AB70 3.23e-23 97 31 6 231 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3A558 3.23e-23 96 31 6 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q65WJ1 3.24e-23 100 27 2 236 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65WJ1 1.9e-13 72 29 5 206 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Y0X3 3.25e-23 99 31 5 222 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88CL2 3.33e-23 98 30 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8PY27 3.46e-23 97 31 7 238 3 MM_1037 Putative ABC transporter ATP-binding protein MM_1037 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q57QD7 3.48e-23 96 30 5 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q1GAN9 3.5e-23 99 30 7 231 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q58488 3.59e-23 97 30 7 223 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6MU19 3.64e-23 99 30 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q47Y12 3.7e-23 97 31 7 225 3 pstB Phosphate import ATP-binding protein PstB Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q81N53 3.73e-23 100 31 7 230 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 4.11e-17 83 28 5 246 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q7A1Z1 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain MW2)
Q6GCY2 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain MSSA476)
Q7A848 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain N315)
Q99X73 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJM6 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain COL)
Q2G1L8 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKB7 3.74e-23 97 30 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain USA300)
Q6D664 3.78e-23 96 32 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92WJ0 3.85e-23 99 30 5 233 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
A3CMQ7 3.89e-23 99 31 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q8DQH4 3.95e-23 96 28 4 221 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM82 3.95e-23 96 28 4 221 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P31134 3.95e-23 99 31 5 216 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q04B25 4.03e-23 99 29 6 227 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
O32169 4.17e-23 98 30 5 223 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
P46341 4.18e-23 97 32 7 226 3 pstB2 Phosphate import ATP-binding protein PstB 2 Bacillus subtilis (strain 168)
Q7WGW1 4.88e-23 98 31 4 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q87FK7 4.91e-23 100 31 3 215 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87FK7 2.55e-18 86 30 3 225 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5WDP1 5.08e-23 98 29 5 221 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q9Z3R9 5.1e-23 98 31 6 217 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q9Z3I3 5.2e-23 97 31 2 221 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q8YCB1 5.2e-23 98 33 5 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2SSS4 5.2e-23 98 30 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2PBM0 5.21e-23 100 26 2 215 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q2PBM0 1.93e-18 87 27 3 220 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q8FAV1 5.34e-23 97 29 8 252 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q49WM4 5.39e-23 98 28 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1GKZ0 5.78e-23 97 29 4 231 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Ruegeria sp. (strain TM1040)
Q3ILC5 5.85e-23 97 30 7 225 3 pstB Phosphate import ATP-binding protein PstB Pseudoalteromonas translucida (strain TAC 125)
Q8UA73 6.09e-23 98 30 4 219 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7W9U5 6.1e-23 98 31 4 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8DIA0 6.31e-23 98 31 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q46ZU5 6.37e-23 97 30 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q74K65 6.65e-23 98 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8DZJ0 6.7e-23 98 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 6.7e-23 98 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 6.7e-23 98 29 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7VZ66 6.7e-23 96 31 7 216 3 pstB Phosphate import ATP-binding protein PstB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0AAG3 6.71e-23 96 30 2 226 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli (strain K12)
P0AAG4 6.71e-23 96 30 2 226 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli O157:H7
Q03ZQ0 6.97e-23 98 27 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q15TB1 7.02e-23 95 33 4 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9HNI8 7.09e-23 97 31 4 219 3 phnC Phosphonates import ATP-binding protein PhnC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q02QM1 7.29e-23 96 28 6 242 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7W8Q6 7.51e-23 96 31 7 216 3 pstB Phosphate import ATP-binding protein PstB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMC3 7.51e-23 96 31 7 216 3 pstB Phosphate import ATP-binding protein PstB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q14Q07 7.56e-23 98 29 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q5XBY7 7.59e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1LQF6 7.61e-23 97 31 5 221 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3YUN6 7.61e-23 96 29 7 240 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q1LJ08 7.73e-23 96 31 7 242 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5KX47 7.74e-23 96 30 8 239 3 pstB Phosphate import ATP-binding protein PstB Geobacillus kaustophilus (strain HTA426)
Q48TC3 7.74e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J6D2 7.74e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGL3 7.74e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7N9U4 7.92e-23 96 30 8 230 3 pstB Phosphate import ATP-binding protein PstB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q73P93 7.98e-23 99 32 5 223 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 4.79e-11 65 25 7 214 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7N8M2 7.98e-23 97 29 5 221 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1JLH7 7.99e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBJ5 7.99e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0CZ37 8.08e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P63377 8.08e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ36 8.08e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P63375 8.08e-23 96 32 8 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus pyogenes serotype M1
Q8R9I2 8.12e-23 96 30 4 222 3 pstB2 Phosphate import ATP-binding protein PstB 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5E715 8.25e-23 97 31 5 200 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2L0H5 8.46e-23 98 29 6 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q3IX40 8.53e-23 97 32 5 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q0I2Z4 8.88e-23 97 29 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q64Z80 9.18e-23 95 27 3 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q5LI72 9.18e-23 95 27 3 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8Z0H0 9.75e-23 97 31 4 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7VV72 9.77e-23 97 31 5 221 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 9.77e-23 97 31 5 221 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 9.77e-23 97 31 5 221 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9CK97 9.81e-23 97 28 6 246 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q667L9 9.89e-23 97 28 5 225 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1MIJ4 1.02e-22 95 31 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q73YZ5 1.1e-22 95 33 5 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 1.1e-22 95 33 5 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q38WL5 1.11e-22 97 31 5 230 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q0T9T7 1.12e-22 95 29 7 240 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XZX8 1.12e-22 97 30 5 238 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6GKG3 1.13e-22 95 29 8 250 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus aureus (strain MRSA252)
Q8DUF7 1.17e-22 97 30 6 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9AML4 1.19e-22 95 30 8 236 3 pstB Phosphate import ATP-binding protein PstB Edwardsiella tarda
Q5KVK2 1.22e-22 97 31 5 221 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q6LH11 1.24e-22 99 28 3 221 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q6LH11 1.67e-21 95 29 3 206 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q9HYL7 1.25e-22 96 28 6 242 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
E9Q876 1.26e-22 99 34 6 213 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
E9Q876 2.79e-13 72 28 4 202 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
Q2RPB4 1.28e-22 99 33 5 210 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q92VJ2 1.29e-22 97 33 8 218 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q6LUY1 1.29e-22 99 28 4 216 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 2.48e-14 75 28 6 228 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q987E7 1.29e-22 99 29 3 227 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q987E7 1.98e-14 75 29 6 213 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8FFB3 1.3e-22 97 28 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O51236 1.38e-22 95 29 7 237 3 pstB Phosphate import ATP-binding protein PstB Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P16676 1.38e-22 97 28 4 232 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 1.38e-22 97 28 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
O59479 1.43e-22 96 31 9 236 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q1QTX6 1.43e-22 97 32 6 239 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11435
Feature type CDS
Gene livF
Product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF
Location 430227 - 430928 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2604
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0410 Amino acid transport and metabolism (E) E ABC-type branched-chain amino acid transport system, ATPase component LivF

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01996 branched-chain amino acid transport system ATP-binding protein ABC transporters
Quorum sensing		 -

Protein Sequence

MLEFNNVSAQYGKIQALHQVSLSVSKGEIVTLIGANGAGKTTLLSTLCGEPRATEGEIRYNGEAITSLPTAQIMRKDIALVPEGRRVFGRMTVEENLAMGGFFATKPQYQMRLAQVYELFPRLEERRHQRAGTMSGGEQQMLAIGRALMSSPKLLLLDEPSLGLAPIIIMQIFDTIRDLRDAGMTIFLVEQNANQALKLADRGYVLENGRVVLEDTGQALLANEAVRSAYLGG

Flanking regions ( +/- flanking 50bp)

ATTCGTAATCATCCTGATGTGATCCGCGCGTATTTAGGGGAGGCGTATTAATGCTGGAATTTAATAATGTCAGCGCACAATACGGCAAAATTCAGGCGCTGCATCAGGTCAGTCTGTCAGTCAGTAAAGGGGAAATCGTCACCCTGATCGGCGCTAACGGCGCCGGGAAAACGACACTGCTCAGTACCTTGTGTGGCGAGCCAAGGGCAACCGAAGGTGAGATCCGTTATAACGGAGAAGCGATTACCTCACTGCCGACAGCACAGATTATGCGCAAAGATATTGCGCTGGTGCCGGAAGGGCGGCGGGTTTTCGGGCGTATGACAGTGGAAGAGAACCTGGCGATGGGTGGTTTTTTTGCCACTAAACCTCAATATCAGATGCGTCTTGCACAGGTTTATGAACTCTTCCCGCGCCTTGAGGAGCGCCGCCATCAGCGGGCGGGAACCATGTCCGGCGGTGAACAGCAGATGCTGGCGATAGGGCGCGCACTGATGAGCAGCCCGAAGTTACTGTTGCTGGATGAACCGTCTCTGGGGCTTGCACCCATCATTATCATGCAGATTTTTGACACTATCCGCGACCTGCGGGACGCCGGGATGACGATTTTCCTGGTGGAGCAAAATGCAAACCAGGCGCTGAAACTGGCAGACAGAGGCTACGTGCTTGAAAACGGGCGGGTGGTGCTGGAAGATACCGGTCAGGCGCTGCTGGCGAACGAAGCCGTAAGAAGCGCCTATCTGGGTGGTTAACTGACTTATTTCACAGAAAAAATCTGACGGAATTTATCGCCGTCTTCTGT