Homologs in group_1450

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09220 FBDBKF_09220 89.9 Morganella morganii S1 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
EHELCC_10190 EHELCC_10190 89.9 Morganella morganii S2 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
NLDBIP_10535 NLDBIP_10535 89.9 Morganella morganii S4 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
LHKJJB_10820 LHKJJB_10820 89.9 Morganella morganii S3 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
HKOGLL_13880 HKOGLL_13880 89.9 Morganella morganii S5 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
PMI_RS13190 PMI_RS13190 56.6 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1450

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1450

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57243 2.28e-80 245 50 0 253 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57399 3.25e-52 173 35 6 266 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P49938 1.63e-43 151 32 1 242 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P15031 7.38e-41 144 32 0 238 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q4K5Z7 9.54e-41 144 37 4 240 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6D645 1.41e-40 143 36 4 246 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92AF9 3.23e-40 142 33 2 211 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8L1U3 1.31e-39 140 38 4 243 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 1.31e-39 140 38 4 243 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q47087 1.6e-39 140 33 1 236 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q8Y651 2.45e-39 139 34 2 206 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q12R52 2.62e-39 140 35 4 247 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q93SS1 2.63e-39 140 36 3 248 3 hmuV Hemin import ATP-binding protein HmuV Plesiomonas shigelloides
Q3K6R9 6.07e-39 139 35 4 240 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
P23878 8.02e-39 139 31 1 229 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
O34338 8.45e-39 138 37 2 207 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q58283 8.61e-39 139 30 1 243 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9KD30 1.52e-38 137 33 4 240 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q81V82 1.65e-38 138 31 1 240 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
P96117 3.82e-38 137 34 2 207 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q7NN36 1.36e-37 136 37 3 234 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
O34510 1.5e-37 135 34 1 208 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
Q1I4Q5 1.94e-37 135 37 3 241 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas entomophila (strain L48)
P07821 2.1e-37 135 34 1 233 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
Q2SB47 2.54e-37 135 34 2 231 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q88DY1 2.7e-37 134 35 3 241 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q659V4 3.5e-37 134 33 2 238 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q70GD4 5.36e-37 134 33 2 238 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q2RZ08 9.88e-37 134 34 3 241 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
P44662 1.73e-36 134 33 4 218 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q47MA5 2.88e-36 133 33 1 242 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q57554 3.26e-36 132 32 5 241 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O70014 4.62e-36 131 34 4 241 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q1LC89 4.9e-36 131 33 6 270 3 hmuV Hemin import ATP-binding protein HmuV Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q32AY3 5.19e-36 131 34 4 241 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q1R597 7.87e-36 131 34 4 241 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q8FCJ1 8.57e-36 130 34 4 241 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 8.57e-36 130 34 4 241 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8EB59 9.46e-36 130 34 4 243 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8X5N2 1.2e-35 130 34 4 241 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q5YVL8 4.83e-35 129 35 2 224 3 hmuV Hemin import ATP-binding protein HmuV Nocardia farcinica (strain IFM 10152)
O68877 1.33e-34 127 35 4 240 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FW7 1.33e-34 127 35 4 240 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3ICT8 6e-34 126 31 3 245 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
Q5E5I1 1.84e-33 125 33 4 237 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
O32188 5.86e-33 124 27 1 234 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q56953 6.65e-33 124 33 3 193 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q2T3B8 1.33e-32 123 34 3 252 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7W025 1.91e-32 122 35 4 260 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q55281 2.56e-32 122 30 3 227 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7WEH6 3.76e-32 121 35 4 260 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O05732 4.3e-32 121 35 2 243 3 HP_0888 Probable iron chelatin transport ATP-binding protein HP_0888 Helicobacter pylori (strain ATCC 700392 / 26695)
Q87J32 4.53e-32 121 34 7 241 3 hmuV Hemin import ATP-binding protein HmuV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZKW3 4.63e-32 121 35 2 243 3 jhp_0821 Probable iron chelatin transport ATP-binding protein jhp_0821 Helicobacter pylori (strain J99 / ATCC 700824)
Q28QF9 7.75e-32 120 33 3 245 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q9RZU5 1.23e-31 120 35 5 238 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
O34631 1.39e-31 124 33 2 232 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
Q2NSR0 2.19e-31 119 36 4 246 3 hmuV Hemin import ATP-binding protein HmuV Sodalis glossinidius (strain morsitans)
Q7W359 2.23e-31 119 34 4 261 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5QXD0 2.31e-31 119 33 7 246 3 hmuV Hemin import ATP-binding protein HmuV Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q81LM1 3.13e-31 119 25 1 237 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q0B697 3.92e-31 119 35 4 253 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2J3T0 5.03e-31 118 30 3 249 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q39B28 6.43e-31 118 35 4 253 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9HQ18 8.67e-31 120 32 2 220 1 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G4 8.67e-31 120 32 2 220 3 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q1IGL4 9.57e-31 118 36 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q66FK0 1.31e-30 117 32 3 230 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 1.31e-30 117 32 3 230 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 1.31e-30 117 32 3 230 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 1.31e-30 117 32 3 230 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q3M5J9 2.99e-30 116 33 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q92N13 3.58e-30 116 31 3 249 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q1H0W2 4.75e-30 116 32 3 230 3 hmuV Hemin import ATP-binding protein HmuV Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q3AKM8 5.69e-30 115 35 6 225 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q03PF2 5.95e-30 118 34 3 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q93SH7 6.18e-30 115 31 3 250 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9RKQ4 6.42e-30 116 33 2 230 3 hmuV Hemin import ATP-binding protein HmuV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4K441 7.31e-30 115 36 5 210 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q31J97 7.38e-30 115 31 5 247 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q63NR0 8.86e-30 115 34 3 252 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain K96243)
Q3JHM1 8.86e-30 115 34 3 252 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain 1710b)
Q62A98 8.86e-30 115 34 3 252 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia mallei (strain ATCC 23344)
Q88R93 9.13e-30 115 35 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7N3S7 1.09e-29 115 32 5 241 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q660M8 1.36e-29 117 33 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q8UIW7 1.81e-29 115 33 3 222 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6G475 1.9e-29 114 31 3 237 3 hmuV Hemin import ATP-binding protein HmuV Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q57293 2.41e-29 116 31 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q5JEB0 2.57e-29 115 34 5 212 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P74981 2.93e-29 114 34 7 235 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q7N545 3.06e-29 114 31 4 252 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O51587 3.41e-29 115 33 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q88ZJ6 3.42e-29 116 34 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q87RE5 3.57e-29 114 34 5 214 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O29527 3.73e-29 114 37 7 213 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q48CA0 4.29e-29 114 33 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7MMN0 4.35e-29 113 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 4.35e-29 113 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q1BJA5 4.48e-29 114 33 4 256 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia orbicola (strain AU 1054)
A0B3E2 4.48e-29 114 33 4 256 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia cenocepacia (strain HI2424)
Q138A9 4.74e-29 113 31 5 251 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q1LKJ2 5.09e-29 114 32 4 235 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6LQC0 6.14e-29 113 33 6 238 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium profundum (strain SS9)
Q02QT1 6.27e-29 113 37 6 213 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0SIB7 6.36e-29 114 31 2 230 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q03AH0 7.68e-29 115 32 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q3K506 7.72e-29 113 34 5 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q6F0V4 7.79e-29 115 30 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q8REG7 9.22e-29 112 29 5 248 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7MFA1 9.89e-29 112 32 6 240 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
Q0SML1 1.05e-28 114 33 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q4ZLS1 1.06e-28 112 33 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q21XJ9 1.11e-28 112 34 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P48334 1.17e-28 112 29 5 246 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q84EY8 1.61e-28 112 31 3 244 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q1MMZ3 1.73e-28 112 33 5 237 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UCM5 1.92e-28 112 32 2 231 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1DCP5 1.97e-28 112 34 3 240 3 hmuV Hemin import ATP-binding protein HmuV Myxococcus xanthus (strain DK1622)
Q8PHQ3 2.01e-28 112 36 5 210 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
P0A191 2.11e-28 111 30 2 235 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 2.11e-28 111 30 2 235 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q9HYG4 2.33e-28 112 37 6 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0I2Z4 2.54e-28 113 29 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q1GJU0 3.02e-28 111 31 3 241 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q6N7Y6 3.33e-28 111 33 3 229 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8D3S8 3.76e-28 111 32 7 241 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain CMCP6)
Q9KL34 4e-28 110 32 5 236 3 hmuV Hemin import ATP-binding protein HmuV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2KDV1 4.05e-28 111 33 5 243 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A0A0H2ZLL3 4.18e-28 110 32 4 228 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04G50 4.58e-28 113 29 5 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P44531 5.25e-28 112 30 6 236 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87UI3 6.18e-28 110 33 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5E6M2 6.28e-28 110 34 4 214 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6D4A8 6.73e-28 110 33 5 248 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8KZQ6 6.86e-28 110 35 4 201 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q6G098 7.62e-28 110 30 3 240 3 hmuV Hemin import ATP-binding protein HmuV Bartonella quintana (strain Toulouse)
P42360 7.63e-28 110 31 3 212 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
Q5ZWE4 8.03e-28 112 31 4 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q7NWX3 8.36e-28 112 33 5 229 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P72477 9.89e-28 110 28 2 239 3 abcX Putative ABC transporter ATP-binding protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5WXF0 1.03e-27 112 31 4 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q9KQB8 1.11e-27 110 36 5 215 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5X627 1.29e-27 112 31 5 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q6LKD4 1.41e-27 111 27 4 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
O31723 2.24e-27 109 30 4 253 2 ylmA Uncharacterized ABC transporter ATP-binding protein YlmA Bacillus subtilis (strain 168)
Q9Z8J5 2.6e-27 108 29 2 210 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q92V71 2.75e-27 109 33 3 222 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
Q14Q07 3.04e-27 110 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
P45247 3.04e-27 107 33 4 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 3.04e-27 107 33 4 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q9CM80 3.21e-27 110 30 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CP06 3.76e-27 110 30 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q16BC5 4.08e-27 108 32 4 226 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q65TB7 4.14e-27 107 32 4 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8CUY0 4.15e-27 108 29 4 231 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88RL1 4.34e-27 108 36 9 221 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7N986 4.5e-27 110 32 4 228 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KL04 4.72e-27 110 29 3 224 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1BC20 5.03e-27 107 33 5 233 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paracoccus denitrificans (strain Pd 1222)
P0A2U7 6.45e-27 107 30 4 224 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 6.45e-27 107 30 4 224 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2W4W1 6.47e-27 107 33 7 253 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q98GF5 6.51e-27 108 32 5 249 3 phnC Phosphonates import ATP-binding protein PhnC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9K8N1 7.33e-27 107 29 5 227 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3KKA1 7.49e-27 107 35 8 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q578K3 8.27e-27 109 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 8.27e-27 109 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8RD07 9.73e-27 107 30 6 239 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P94420 1.06e-26 107 25 3 241 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q8U6M1 1.22e-26 108 34 5 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7MFC4 1.38e-26 109 28 4 245 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 1.38e-26 109 28 4 245 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q3Z2L6 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.39e-26 106 32 4 214 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.39e-26 106 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q1CJG3 1.39e-26 106 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 1.39e-26 106 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 1.39e-26 106 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 1.42e-26 106 34 4 214 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q217B2 1.51e-26 107 29 3 248 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q8YCG3 1.53e-26 108 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1J255 1.72e-26 107 36 6 236 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q9HT73 1.73e-26 107 34 7 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.73e-26 107 34 7 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q32HA3 1.8e-26 106 32 5 218 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q6FFL0 1.86e-26 106 33 5 216 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1JRI2 1.92e-26 106 35 4 214 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q87GB5 2.05e-26 108 29 4 225 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q30V33 2.16e-26 108 30 5 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q92WJ0 2.31e-26 108 32 4 231 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8A883 2.56e-26 109 30 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1CDR0 2.57e-26 106 33 5 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 2.57e-26 106 33 5 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 2.57e-26 106 33 5 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q9KLQ5 2.7e-26 108 28 3 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q21PQ7 2.86e-26 106 33 4 202 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8U4K3 3.07e-26 107 34 6 197 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q65QT6 3.08e-26 108 30 3 224 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q73GK9 3.1e-26 105 29 6 237 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q6CYU2 3.14e-26 106 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2K8C8 3.21e-26 107 32 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q665B6 3.44e-26 106 33 5 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6D201 3.5e-26 107 30 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2SJY7 3.51e-26 108 30 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q8U4L3 3.72e-26 105 35 5 206 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q39GT7 3.85e-26 106 30 3 225 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2LY16 4.65e-26 106 31 6 230 3 cbiO Cobalt import ATP-binding protein CbiO Syntrophus aciditrophicus (strain SB)
Q83KR7 4.83e-26 105 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 4.83e-26 105 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
P26050 5.34e-26 106 32 3 216 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92L31 5.37e-26 104 34 3 206 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
O57872 5.77e-26 105 34 5 216 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8FVV5 6.57e-26 107 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q035E0 6.9e-26 105 30 6 240 3 phnC Phosphonates import ATP-binding protein PhnC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q5PIA5 7.04e-26 105 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 7.04e-26 105 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q3ISC1 7.47e-26 104 34 6 230 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8ZNV7 8.59e-26 104 32 4 214 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7AH43 8.92e-26 106 30 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q64SQ6 1.07e-25 107 30 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q6LTB1 1.08e-25 104 30 5 214 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q2JB14 1.14e-25 104 31 3 236 3 phnC Phosphonates import ATP-binding protein PhnC Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
O57896 1.15e-25 106 33 4 196 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q1IGY7 1.16e-25 104 35 9 221 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1BWI2 1.19e-25 105 30 3 225 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
O68106 1.2e-25 105 35 4 213 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q51719 1.26e-25 105 33 7 247 3 None Putative ABC transporter ATP-binding protein in cobA 5'region Propionibacterium freudenreichii subsp. shermanii
Q5LBT4 1.27e-25 107 30 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q3SGJ8 1.33e-25 104 32 3 224 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q9CN78 1.45e-25 103 32 4 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q8Z5W6 1.47e-25 103 32 4 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q2SSS4 1.57e-25 105 29 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q0K9I2 1.61e-25 105 33 6 247 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q38UT9 1.69e-25 104 34 5 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q89AJ0 1.87e-25 103 31 5 218 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q07LU3 1.88e-25 104 31 3 222 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q5LYN4 1.91e-25 106 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q03JH1 1.97e-25 106 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M397 1.97e-25 106 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q2GE91 2.2e-25 102 34 4 184 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
P27675 2.24e-25 103 29 2 218 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q830W6 2.36e-25 105 28 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q8Z4V6 2.61e-25 105 32 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q6MU19 2.62e-25 105 29 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
P22731 2.67e-25 103 29 5 244 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
Q1GMA8 2.69e-25 103 29 4 237 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q0SWH9 2.7e-25 104 30 8 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q4QP85 2.76e-25 105 31 6 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q98L75 2.76e-25 103 30 4 242 3 hmuV Hemin import ATP-binding protein HmuV Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0TA26 2.77e-25 105 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1BWL4 2.8e-25 104 33 5 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 2.8e-25 104 33 5 213 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q7VNG4 2.8e-25 105 28 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O52618 2.81e-25 105 32 8 245 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q0TUN8 2.82e-25 103 30 8 236 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P40860 2.84e-25 105 32 2 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FB37 2.92e-25 105 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8DZJ0 2.98e-25 105 30 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 2.98e-25 105 30 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 2.98e-25 105 30 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7UBD0 3.17e-25 105 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q3YUV0 3.26e-25 105 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 3.26e-25 105 28 4 242 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 3.26e-25 105 28 4 242 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 3.26e-25 105 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q1MCZ1 3.4e-25 103 32 4 229 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q48PV0 3.43e-25 103 34 8 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4FQ27 3.71e-25 102 30 7 255 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2JLH7 3.71e-25 103 31 4 228 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8D3Z9 3.98e-25 107 34 5 201 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 4.07e-12 68 27 6 230 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q4KKK4 4.03e-25 103 34 8 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0I3C2 4.15e-25 102 33 4 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q8XZQ4 4.28e-25 103 34 6 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P37009 4.64e-25 104 30 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
O69063 5.25e-25 104 31 5 248 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
O31711 5.36e-25 102 30 6 209 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q18AM3 5.38e-25 104 27 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q9MUN1 5.52e-25 104 30 4 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q39T41 5.55e-25 102 32 5 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q39GW5 5.58e-25 103 32 6 227 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O69051 5.64e-25 103 35 5 231 3 ptxA Phosphite import ATP-binding protein PxtA Stutzerimonas stutzeri
Q9V2C0 5.77e-25 104 34 6 204 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q31I51 5.81e-25 102 32 6 202 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8UCD5 5.96e-25 104 33 3 206 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q97KS6 6.2e-25 104 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4ZZS2 6.5e-25 102 34 8 220 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q9JUX4 6.65e-25 104 31 5 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8YK28 6.71e-25 102 37 6 210 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q664X5 6.75e-25 104 31 4 216 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 6.75e-25 104 31 4 216 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 6.75e-25 104 31 4 216 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 6.75e-25 104 31 4 216 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q7MFH3 7.12e-25 106 33 5 201 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 8.05e-12 68 27 7 231 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
O34946 7.58e-25 101 27 3 221 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q9AE30 7.91e-25 102 32 4 229 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium leguminosarum
O84071 8.11e-25 102 28 2 210 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q58488 8.31e-25 102 30 5 230 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8RD43 8.4e-25 105 30 1 214 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 1.51e-10 64 21 7 229 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9PKX1 8.91e-25 102 28 2 207 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q9JZW0 9.12e-25 103 31 5 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P45171 1e-24 104 27 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87SV4 1.02e-24 101 31 3 207 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1TXH7 1.03e-24 104 31 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q49WM4 1.05e-24 103 28 3 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0SXQ1 1.14e-24 103 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q5PKZ8 1.27e-24 103 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0BFQ0 1.27e-24 103 32 5 213 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q58967 1.29e-24 102 32 6 223 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q72FW5 1.29e-24 103 30 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DWR3 1.3e-24 102 27 3 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 1.3e-24 102 27 3 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 1.3e-24 102 27 3 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q4QK57 1.37e-24 103 27 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q6MUF4 1.37e-24 101 31 7 233 3 phnC Phosphonates import ATP-binding protein PhnC Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q7VMV4 1.39e-24 100 30 4 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LK87 1.45e-24 103 27 4 225 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q1Q889 1.49e-24 101 28 6 252 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2IYS5 1.5e-24 102 33 4 226 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q1MQ44 1.5e-24 103 31 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
P0A9V4 1.54e-24 101 31 3 236 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 1.54e-24 101 31 3 236 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 1.54e-24 101 31 3 236 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 1.54e-24 101 31 3 236 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q8TQ05 1.58e-24 105 31 4 219 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 9.73e-19 88 30 5 225 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9V2E4 1.61e-24 101 33 5 217 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q8TYV9 1.65e-24 101 33 6 232 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q471U2 1.65e-24 101 31 9 267 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q07PZ0 1.68e-24 102 32 4 228 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q8G838 1.75e-24 105 31 6 259 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.25e-17 85 30 7 220 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
P45092 1.76e-24 100 32 4 240 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5GRS1 1.86e-24 100 26 5 239 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q8FFB3 1.92e-24 103 31 2 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q926D8 1.99e-24 101 28 2 224 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9Z3I3 2.04e-24 102 31 4 217 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
P16676 2.04e-24 103 31 2 217 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 2.15e-24 103 31 2 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8PP41 2.19e-24 100 34 6 208 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q0BZD8 2.25e-24 101 34 4 224 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q1LNM0 2.27e-24 101 34 6 203 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q87UN0 2.29e-24 101 34 7 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0A9E2 2.37e-24 100 31 8 249 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q82MV1 2.45e-24 100 32 7 228 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P44513 2.46e-24 102 30 6 247 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87G35 2.55e-24 104 32 5 201 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 1.51e-11 67 28 8 244 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MPC5 2.59e-24 100 32 4 211 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 2.59e-24 100 32 4 211 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q88ZZ2 2.59e-24 104 30 6 266 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 8.27e-14 73 27 6 253 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5HQ70 2.6e-24 102 29 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34362 2.83e-24 104 29 3 230 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 1.65e-18 87 29 7 230 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q669P3 2.97e-24 100 33 3 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q82JY6 2.97e-24 102 32 4 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8ESM5 2.99e-24 100 28 4 226 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8DUF7 2.99e-24 103 30 3 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1QE80 3e-24 103 34 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q132E8 3.06e-24 100 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q2ISN3 3.07e-24 101 29 5 254 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q2IGQ6 3.1e-24 100 35 9 223 3 pstB Phosphate import ATP-binding protein PstB Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8Z1U0 3.22e-24 102 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
P19566 3.36e-24 102 28 4 242 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 3.36e-24 102 28 4 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
P45073 3.7e-24 100 27 4 236 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89C51 3.82e-24 100 28 5 266 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93DX8 3.85e-24 100 31 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8YUV1 4.05e-24 100 31 4 233 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8T674 4.39e-24 104 27 4 225 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
Q5DZC6 4.46e-24 102 27 3 224 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1LJ08 4.55e-24 100 31 5 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6D2F6 4.67e-24 102 31 4 219 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0K2U3 4.82e-24 100 34 8 224 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7MU65 4.98e-24 99 32 4 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
P72335 5.28e-24 101 31 5 220 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q1BG75 5.42e-24 100 33 6 215 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 5.42e-24 100 33 6 215 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q2SVN0 5.49e-24 101 32 6 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q160G4 5.79e-24 100 31 5 260 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0VTB6 5.93e-24 100 34 6 214 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7N8B9 6.12e-24 101 29 5 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q4FTM3 6.13e-24 99 31 4 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q04EY5 6.18e-24 100 29 3 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7UC29 6.23e-24 102 30 2 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q5L222 6.35e-24 101 29 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q02151 6.65e-24 99 27 3 254 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
Q8RI39 6.83e-24 102 29 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8XXY9 6.92e-24 101 30 6 250 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q10V16 7.14e-24 99 30 3 221 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Trichodesmium erythraeum (strain IMS101)
Q0I354 7.21e-24 98 31 3 204 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q4L5B3 7.77e-24 101 29 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q64Z80 7.95e-24 98 32 4 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q6MIP7 8.25e-24 99 34 5 229 3 phnC Phosphonates import ATP-binding protein PhnC Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q2JPW6 8.67e-24 99 30 6 249 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7N6Z2 8.92e-24 101 31 6 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1RDS4 9.32e-24 99 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 9.32e-24 99 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q832R5 9.57e-24 103 31 6 227 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 2.03e-09 60 27 8 237 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q38VW6 9.59e-24 101 30 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q6NBX6 9.8e-24 99 29 5 254 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A1WXT0 1.01e-23 99 30 6 242 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q9XDA6 1.01e-23 99 28 5 230 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O85818 1.05e-23 101 29 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q60AI1 1.07e-23 101 32 7 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q65SC9 1.1e-23 98 30 3 212 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7N0N3 1.12e-23 98 32 9 228 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q88AS5 1.17e-23 100 30 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8D385 1.18e-23 98 30 6 217 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q5FA19 1.2e-23 100 33 5 219 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8PVG9 1.21e-23 102 31 8 238 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PVG9 5.79e-16 80 25 4 219 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1CI46 1.32e-23 98 32 3 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 1.32e-23 98 32 3 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 1.32e-23 98 32 3 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q5FMM1 1.37e-23 99 28 4 222 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A3CVD3 1.46e-23 99 33 6 219 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q032D0 1.47e-23 98 28 4 227 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q1WVI7 1.49e-23 100 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1QCN2 1.51e-23 98 31 5 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q65UE1 1.59e-23 100 27 3 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CIQ6 1.61e-23 98 28 4 227 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. lactis (strain IL1403)
Q8FYU9 1.61e-23 98 31 4 235 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 1.61e-23 98 31 4 235 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BC2 1.65e-23 98 32 5 236 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.65e-23 98 32 5 236 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q8U8D6 1.69e-23 99 30 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8XIZ5 1.72e-23 100 28 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.72e-23 100 28 5 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9F9B0 1.75e-23 99 33 6 218 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
P38046 1.77e-23 99 34 6 206 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q56342 1.8e-23 102 28 4 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q56342 1.09e-13 73 24 4 228 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q62K82 1.95e-23 100 31 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8XNY7 2.03e-23 99 29 8 236 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q9I6L0 2.04e-23 100 29 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q63TW1 2.06e-23 99 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q63TY1 2.07e-23 100 31 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8CPN0 2.08e-23 100 29 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8TSC8 2.14e-23 102 33 6 206 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 2.45e-14 75 23 3 215 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5WBL0 2.25e-23 98 29 3 201 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
O86751 2.28e-23 100 32 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q3SQ65 2.32e-23 98 28 2 250 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q9K619 2.38e-23 98 28 5 223 3 bceA Bacitracin export ATP-binding protein BceA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7CN92 2.38e-23 100 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.38e-23 100 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q03ZQ0 2.41e-23 100 27 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q62K56 2.41e-23 99 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q2SVP3 2.49e-23 99 30 3 223 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P23703 2.5e-23 99 31 5 221 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q92UV5 2.57e-23 100 32 4 198 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q3JSR6 2.7e-23 99 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q668K6 2.78e-23 100 33 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q65HC0 2.79e-23 98 30 10 260 3 pstB1 Phosphate import ATP-binding protein PstB 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65S66 2.81e-23 100 28 4 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8FUU5 2.83e-23 99 32 5 211 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q2NU23 2.92e-23 97 33 5 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q65E55 2.95e-23 101 29 4 212 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65E55 2.15e-15 78 25 5 208 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3ATR5 3.31e-23 101 30 8 258 3 macB Macrolide export ATP-binding/permease protein MacB Chlorobium chlorochromatii (strain CaD3)
Q0I3Y9 3.45e-23 100 27 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q74K65 3.47e-23 99 29 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8D0W8 3.5e-23 99 33 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8GNH6 3.7e-23 99 30 6 242 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q9HNI8 3.83e-23 98 32 5 205 3 phnC Phosphonates import ATP-binding protein PhnC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8PSR0 4.19e-23 101 30 4 225 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PSR0 2.97e-21 95 30 5 225 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6NA00 4.23e-23 98 33 8 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1J6Q6 4.58e-23 99 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 4.58e-23 99 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 4.58e-23 99 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 4.58e-23 99 29 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q6D4E2 4.67e-23 99 29 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0SRL2 4.74e-23 99 25 3 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q5LI72 4.82e-23 96 32 4 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q2K551 5.32e-23 97 29 3 236 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
D4GP39 5.48e-23 99 30 3 206 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8Y8T6 5.55e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P18813 5.56e-23 98 28 5 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q89UD2 5.72e-23 99 28 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A0AGP9 5.96e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Z0H0 6.03e-23 99 27 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8ELR4 6.3e-23 99 27 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2NHA1 6.32e-23 97 30 5 220 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q11ID5 6.33e-23 97 30 3 241 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q8DPC2 6.44e-23 99 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 6.44e-23 99 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 6.44e-23 99 30 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C3LLU1 6.68e-23 97 31 4 222 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 6.68e-23 97 31 4 222 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q50966 6.88e-23 99 32 5 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q3JSQ0 6.96e-23 98 30 3 223 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 6.96e-23 98 30 3 223 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q0TJC1 7.07e-23 97 32 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5XCA4 7.27e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 7.41e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 7.41e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 7.41e-23 99 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q609Q1 7.46e-23 98 30 2 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q63TX3 7.48e-23 97 30 3 223 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q11B53 7.57e-23 97 31 3 225 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
Q6LQ77 7.78e-23 97 31 4 230 3 btuD Vitamin B12 import ATP-binding protein BtuD Photobacterium profundum (strain SS9)
Q2YXY2 8.05e-23 97 29 10 258 3 pstB Phosphate import ATP-binding protein PstB Staphylococcus aureus (strain bovine RF122 / ET3-1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10750
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 281187 - 281960 (strand: -1)
Length 774 (nucleotides) / 257 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1450
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1120 Inorganic ion transport and metabolism (P)
Coenzyme transport and metabolism (H)		 PH ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02013 iron complex transport system ATP-binding protein [EC:7.2.2.-] - -

Protein Sequence

MSDVLTTRDLAVGYGEKLILTNINLQLQQGDIICLLGANGCGKTTLMKTLLGLLPPKTGEIRINGKPLNHWSATALARRVAYVPQAHNMPFSFRVLDMVALGRSAHLSLFASPGRAERQMAEQELDALGIAHLALRAYSCLSGGEKQLVLIARALIQQPGLLIMDEPAASLDFGNQIKLLNKIEQLRERGITVLMSTHHPQHAAAVADSIVMLGSAQPARQDKPAALLTPETLAALYHVTPEHISAHFAQPTYKGLS

Flanking regions ( +/- flanking 50bp)

GTCGGCGCACCTTTTTTTATTTTTCTGCTGCTGCAAACGCGGAGGAACGGATGAGCGATGTACTGACCACCCGTGATCTGGCTGTGGGTTACGGAGAGAAGTTAATACTCACTAACATCAATCTGCAATTACAGCAGGGAGATATTATTTGTCTGCTCGGTGCCAACGGCTGCGGCAAAACAACACTGATGAAAACCCTGCTTGGCTTACTACCGCCGAAAACCGGGGAGATCCGCATCAACGGTAAACCGCTGAACCACTGGAGCGCCACCGCACTGGCGCGGCGCGTTGCCTATGTGCCGCAGGCGCATAATATGCCCTTCTCTTTCCGCGTGCTGGATATGGTCGCACTCGGGCGCAGTGCACATCTTTCCCTGTTTGCGTCTCCGGGACGGGCTGAGCGGCAGATGGCAGAACAGGAGCTGGATGCCCTCGGCATTGCGCATCTGGCACTACGCGCCTATTCCTGCCTGAGCGGCGGCGAAAAACAGCTGGTGCTGATTGCCCGCGCTCTTATCCAGCAGCCGGGTTTACTGATTATGGATGAACCTGCCGCCAGCCTGGATTTCGGCAACCAGATAAAATTACTGAATAAAATCGAGCAGTTACGGGAGCGCGGAATAACAGTGCTGATGTCCACCCATCATCCGCAACACGCGGCGGCGGTGGCAGACAGCATTGTGATGCTCGGCTCCGCACAGCCTGCCCGCCAGGACAAACCTGCCGCCCTGCTCACACCGGAAACGCTGGCGGCACTCTATCATGTGACACCGGAACATATTTCAGCGCATTTTGCGCAACCCACTTATAAGGGATTGTCATGACAATTGATGATATCGATTTCGCACAACTTTACCGCGACCATCTGGCACAG