Homologs in group_1350

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08365 FBDBKF_08365 95.0 Morganella morganii S1 uvrD DNA helicase II
EHELCC_13160 EHELCC_13160 95.0 Morganella morganii S2 uvrD DNA helicase II
NLDBIP_13500 NLDBIP_13500 95.0 Morganella morganii S4 uvrD DNA helicase II
LHKJJB_13055 LHKJJB_13055 95.0 Morganella morganii S3 uvrD DNA helicase II
HKOGLL_11975 HKOGLL_11975 95.0 Morganella morganii S5 uvrD DNA helicase II
PMI_RS16615 PMI_RS16615 84.4 Proteus mirabilis HI4320 uvrD DNA helicase II

Distribution of the homologs in the orthogroup group_1350

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1350

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P03018 0.0 1276 84 0 717 1 uvrD DNA helicase II Escherichia coli (strain K12)
Q05311 0.0 1274 83 0 717 3 uvrD DNA helicase II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02322 0.0 979 65 3 726 1 uvrD DNA helicase II Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9S3Q0 0.0 567 41 7 747 3 pcrA ATP-dependent DNA helicase PcrA Leuconostoc citreum
Q8CRT9 1.1e-178 531 38 8 730 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O34580 1.64e-178 530 40 10 735 1 pcrA ATP-dependent DNA helicase PcrA Bacillus subtilis (strain 168)
Q5HN29 1.98e-178 530 38 7 730 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GFF2 2.47e-177 527 38 8 735 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MRSA252)
P64319 5.26e-177 526 38 8 735 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain N315)
P64318 5.26e-177 526 38 8 735 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NVT1 2.08e-176 525 38 8 735 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MW2)
Q6G828 2.08e-176 525 38 8 735 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MSSA476)
Q5HEL7 2.08e-176 525 38 8 735 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain COL)
Q53727 2.08e-176 525 38 8 735 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P56255 1.52e-173 517 41 9 724 1 pcrA ATP-dependent DNA helicase PcrA Geobacillus stearothermophilus
Q1RIP8 1.04e-165 494 43 9 645 3 uvrD Probable DNA helicase II homolog Rickettsia bellii (strain RML369-C)
Q68WT1 1.32e-158 476 40 11 660 3 uvrD DNA helicase II Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4ULN5 1.2e-157 474 41 10 659 3 uvrD Probable DNA helicase II homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92HZ6 2.81e-157 473 41 10 659 3 uvrD Probable DNA helicase II homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZD95 3.14e-157 473 40 12 663 3 uvrD Probable DNA helicase II homolog Rickettsia prowazekii (strain Madrid E)
P9WMQ1 1.69e-154 470 39 14 754 1 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMQ0 1.69e-154 470 39 14 754 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5A4 1.69e-154 470 39 14 754 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CD72 2.35e-152 464 38 15 767 3 uvrD ATP-dependent DNA helicase UvrD1 Mycobacterium leprae (strain TN)
Q9L6S1 5.46e-122 382 38 9 638 3 rep ATP-dependent DNA helicase Rep Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09980 8.39e-122 382 38 9 638 1 rep ATP-dependent DNA helicase Rep Escherichia coli (strain K12)
P44804 5.84e-121 380 37 8 644 3 rep ATP-dependent DNA helicase Rep Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57654 7.17e-120 376 36 10 642 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89A21 8.74e-120 377 35 8 637 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P45612 5.21e-114 363 33 15 713 3 uvrD Probable DNA helicase II homolog Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
O51889 7.29e-114 361 34 10 643 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O31626 9.07e-84 284 31 12 628 1 yjcD Putative ATP-dependent DNA helicase YjcD Bacillus subtilis (strain 168)
Q10213 1.81e-82 283 32 18 656 1 srs2 ATP-dependent DNA helicase srs2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D1KF50 1.68e-64 236 26 27 760 1 SRS2 ATP-dependent DNA helicase SRS2-like protein At4g25120 Arabidopsis thaliana
P9WMP9 9.06e-58 211 33 9 459 1 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMP8 9.06e-58 211 33 9 459 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64321 9.06e-58 211 33 9 459 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P75437 2.12e-54 202 26 25 757 3 uvrD Probable DNA helicase II homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P53528 5.79e-51 192 32 10 472 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
P53528 3.29e-11 70 42 2 89 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
P12954 4.24e-48 187 28 29 741 1 SRS2 ATP-dependent DNA helicase SRS2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P75438 3.84e-41 161 32 9 368 3 MPN_340 Probable DNA helicase MPN_340 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75438 1.55e-08 61 34 5 132 3 MPN_340 Probable DNA helicase MPN_340 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47486 3.81e-33 139 28 11 373 3 uvrD Probable DNA helicase II homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47486 1e-09 65 26 9 210 3 uvrD Probable DNA helicase II homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q12039 2.92e-28 124 23 27 685 1 HMI1 ATP-dependent DNA helicase HMI1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B7GM51 9.78e-26 117 24 24 606 3 addA ATP-dependent helicase/nuclease subunit A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7GM51 4.65e-05 50 33 4 124 3 addA ATP-dependent helicase/nuclease subunit A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q3AA35 1.07e-22 107 24 16 545 3 addA ATP-dependent helicase/nuclease subunit A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B3WEJ1 1.41e-22 107 24 15 510 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus casei (strain BL23)
Q5HQJ4 1.55e-22 107 25 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQJ4 1.07e-05 52 28 2 126 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPT9 1.6e-22 107 25 16 487 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPT9 1.08e-05 52 28 2 126 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q043G6 1.65e-22 107 23 19 595 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q038V7 2.96e-22 106 24 15 510 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q74JA6 3.56e-22 106 25 19 507 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q4L4Y3 4.7e-22 105 24 17 492 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
Q4L4Y3 1.23e-05 52 26 1 132 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
A8YVK0 7.69e-22 105 23 18 568 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus helveticus (strain DPC 4571)
Q2YWW4 1.06e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWW4 6.46e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain bovine RF122 / ET3-1)
A6QFH8 1.1e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Newman)
A6QFH8 6.62e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Newman)
Q5HHB7 1.1e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain COL)
Q5HHB7 6.62e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain COL)
Q2FZT5 1.1e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FZT5 6.62e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A6H4 1.11e-21 104 24 18 512 1 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain N315)
Q7A6H4 6.46e-06 53 24 7 223 1 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain N315)
Q99VC3 1.11e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99VC3 6.46e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRE5 1.11e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH9)
A5IRE5 6.46e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH9)
A6U074 1.11e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH1)
A6U074 6.46e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH1)
A7X0I2 1.11e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X0I2 6.46e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z073 1.14e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300 / TCH1516)
A8Z073 8.41e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIA8 1.14e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300)
Q2FIA8 8.41e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300)
Q6GAV9 1.16e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MSSA476)
Q6GAV9 6.29e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MSSA476)
Q6GIC1 1.32e-21 104 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
Q6GIC1 2.94e-05 51 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
Q5FJX0 1.56e-21 103 24 20 571 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8NXE9 1.68e-21 103 24 18 512 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MW2)
Q8NXE9 6.03e-06 53 24 7 223 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MW2)
B1IBR6 1.88e-21 103 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain Hungary19A-6)
A8FBR1 2.03e-21 103 25 21 548 3 addA ATP-dependent helicase/nuclease subunit A Bacillus pumilus (strain SAFR-032)
A8FBR1 3.03e-06 54 30 4 124 3 addA ATP-dependent helicase/nuclease subunit A Bacillus pumilus (strain SAFR-032)
B2IPX3 2.39e-21 103 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain CGSP14)
B9DIS2 2.92e-21 103 23 18 510 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus carnosus (strain TM300)
B9DIS2 1.41e-07 58 27 8 222 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus carnosus (strain TM300)
B8ZQ32 3.41e-21 103 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q49WA6 4.5e-21 102 24 22 578 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49WA6 7.19e-05 50 27 2 132 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DPR6 4.65e-21 102 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QP9 4.65e-21 102 26 16 456 3 rexA Exonuclease/helicase subunit RexA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04KF8 4.65e-21 102 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8Y511 5.07e-21 102 23 19 536 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y511 9.53e-07 56 31 3 122 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B7IL84 6.58e-21 102 25 18 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain G9842)
B7IL84 2.34e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain G9842)
B7JDU4 7.05e-21 102 26 19 470 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH820)
B7JDU4 2.32e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH820)
A7GM37 8.45e-21 101 26 18 430 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GM37 0.0002 48 43 2 67 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B5E4P5 1.25e-20 101 26 16 456 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 19F (strain G54)
B8DF44 1.99e-20 100 23 19 536 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4a (strain HCC23)
B8DF44 9.13e-07 56 31 3 122 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4a (strain HCC23)
Q81GP9 3.08e-20 100 25 18 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GP9 2.36e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HGP9 3.08e-20 100 25 18 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain B4264)
B7HGP9 2.38e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain B4264)
Q63EM2 3.13e-20 100 26 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ZK / E33L)
Q63EM2 2.43e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ZK / E33L)
Q81TW1 3.65e-20 99 26 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus anthracis
Q81TW1 1.74e-05 52 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus anthracis
B9ITE9 3.95e-20 99 25 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain Q1)
B9ITE9 2.49e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain Q1)
B7HZR5 4.27e-20 99 25 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH187)
B7HZR5 2.57e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH187)
Q73C23 4.57e-20 99 26 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73C23 2.45e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RAX7 4.73e-20 99 26 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis (strain Al Hakam)
A0RAX7 2.38e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis (strain Al Hakam)
A9VJ02 5.52e-20 99 26 19 476 3 addA ATP-dependent helicase/nuclease subunit A Bacillus mycoides (strain KBAB4)
A9VJ02 2.3e-05 52 27 10 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus mycoides (strain KBAB4)
Q71X99 5.56e-20 99 23 21 560 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4b (strain F2365)
Q71X99 8.26e-08 59 31 3 122 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4b (strain F2365)
Q6HM43 6.02e-20 99 26 19 471 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HM43 2.51e-05 51 28 11 205 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q929A9 1.27e-19 97 22 19 555 3 addA ATP-dependent helicase/nuclease subunit A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q929A9 1.78e-09 65 33 3 122 3 addA ATP-dependent helicase/nuclease subunit A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1JMH5 1.57e-19 97 25 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS9429)
B5XKR4 1.59e-19 97 25 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JCJ8 1.75e-19 97 25 14 455 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS2096)
B1YKM8 1.78e-19 97 25 23 591 3 addA ATP-dependent helicase/nuclease subunit A Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B1YKM8 1.98e-05 52 31 4 122 3 addA ATP-dependent helicase/nuclease subunit A Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q65LJ9 2.5e-19 97 23 20 560 3 addA ATP-dependent helicase/nuclease subunit A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65LJ9 3.07e-05 51 29 4 124 3 addA ATP-dependent helicase/nuclease subunit A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8P1J2 3.87e-19 96 25 15 460 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M18 (strain MGAS8232)
A0AL18 5.92e-19 95 23 21 549 3 addA ATP-dependent helicase/nuclease subunit A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AL18 2.87e-08 61 31 3 122 3 addA ATP-dependent helicase/nuclease subunit A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q48UB8 9.3e-19 95 25 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ53 1.14e-18 94 25 14 455 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ52 1.14e-18 94 25 14 455 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1J7E4 1.35e-18 94 25 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5XCW6 1.35e-18 94 25 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1JHM1 1.63e-18 94 25 15 460 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M2 (strain MGAS10270)
B1HN90 1.89e-18 94 22 20 563 3 addA ATP-dependent helicase/nuclease subunit A Lysinibacillus sphaericus (strain C3-41)
B1HN90 2.51e-05 51 44 4 77 3 addA ATP-dependent helicase/nuclease subunit A Lysinibacillus sphaericus (strain C3-41)
A2RFA8 2.4e-18 94 25 14 455 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M5 (strain Manfredo)
Q9A0H3 2.68e-18 93 24 14 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M1
B1MZM2 5.88e-18 92 24 20 544 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc citreum (strain KM20)
B1MZM2 0.00025 48 32 4 134 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc citreum (strain KM20)
Q9CJI9 6.44e-18 92 24 21 582 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. lactis (strain IL1403)
Q8ERW5 9.62e-18 92 22 15 520 3 addA ATP-dependent helicase/nuclease subunit A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ERW5 1.02e-05 53 48 2 64 3 addA ATP-dependent helicase/nuclease subunit A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5L263 1.21e-17 91 25 23 540 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
Q5L263 5.88e-05 50 45 1 66 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
B9DRV0 1.36e-17 91 26 21 474 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B9DRV0 1.75e-05 52 29 4 138 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q033I1 1.38e-17 91 23 23 580 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. cremoris (strain SK11)
P15038 1.73e-17 90 28 8 338 1 helD DNA helicase IV Escherichia coli (strain K12)
Q1WRS0 1.82e-17 90 21 16 533 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
Q1WRS0 2.77e-06 54 26 7 188 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
A2RH77 1.82e-17 90 23 23 586 1 rexA Exonuclease/helicase subunit RexA Lactococcus lactis subsp. cremoris (strain MG1363)
B2UX57 2.77e-17 90 22 15 515 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Alaska E43 / Type E3)
B2UX57 5.02e-06 53 28 6 188 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Alaska E43 / Type E3)
B2THC8 3.28e-17 90 22 16 514 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Eklund 17B / Type B)
B2THC8 3.48e-06 54 28 5 184 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Eklund 17B / Type B)
Q1GAA9 7.07e-17 89 23 19 548 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q03D71 7.09e-17 89 21 16 559 3 addA ATP-dependent helicase/nuclease subunit A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q03D71 6.76e-06 53 24 7 212 3 addA ATP-dependent helicase/nuclease subunit A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
C0MGY6 9.26e-17 88 24 16 462 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain H70)
J8HQ06 1.11e-16 87 28 11 287 1 gajB Gabija protein GajB Bacillus cereus (strain VD045)
B4U2H1 1.27e-16 88 25 18 475 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q03W49 3.29e-16 87 24 21 537 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03W49 0.000415 47 46 2 63 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q04AN7 3.4e-16 87 23 17 520 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8E5T9 1.03e-15 85 24 21 504 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype III (strain NEM316)
Q04GY7 1.31e-15 85 23 20 533 3 addA ATP-dependent helicase/nuclease subunit A Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q836J8 1.61e-15 84 23 17 517 3 addA ATP-dependent helicase/nuclease subunit A Enterococcus faecalis (strain ATCC 700802 / V583)
A8MJ41 1.97e-15 84 23 18 527 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus oremlandii (strain OhILAs)
A8MJ41 1.62e-07 58 27 7 212 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus oremlandii (strain OhILAs)
A7Z368 4.77e-15 83 24 17 495 3 addA ATP-dependent helicase/nuclease subunit A Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A7Z368 1.24e-05 52 29 4 124 3 addA ATP-dependent helicase/nuclease subunit A Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P23478 6.54e-15 82 23 20 560 1 addA ATP-dependent helicase/nuclease subunit A Bacillus subtilis (strain 168)
P23478 1.02e-05 53 30 4 124 1 addA ATP-dependent helicase/nuclease subunit A Bacillus subtilis (strain 168)
A6TVN2 1.06e-14 82 24 22 527 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus metalliredigens (strain QYMF)
A6TVN2 3.15e-07 57 46 0 66 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus metalliredigens (strain QYMF)
B1I493 1.24e-14 82 23 18 549 3 addA ATP-dependent helicase/nuclease subunit A Desulforudis audaxviator (strain MP104C)
B1I493 8.17e-07 56 36 5 125 3 addA ATP-dependent helicase/nuclease subunit A Desulforudis audaxviator (strain MP104C)
Q03NA7 1.65e-14 81 23 14 485 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03NA7 7.87e-05 50 26 8 219 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q38X69 2.72e-14 80 24 17 461 3 addA ATP-dependent helicase/nuclease subunit A Latilactobacillus sakei subsp. sakei (strain 23K)
Q8E061 4.82e-14 80 24 21 504 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1I4 5.72e-14 79 24 21 504 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B2G532 8.22e-14 79 20 18 575 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHK2 8.22e-14 79 20 18 575 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri (strain DSM 20016)
A4VUD2 2.87e-13 77 24 17 463 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 05ZYH33)
A4W0M7 2.87e-13 77 24 17 463 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 98HAH33)
A0PY67 3.57e-13 77 22 18 552 3 addA ATP-dependent helicase/nuclease subunit A Clostridium novyi (strain NT)
A0PY67 1.23e-05 52 30 5 139 3 addA ATP-dependent helicase/nuclease subunit A Clostridium novyi (strain NT)
A6LPC4 3.76e-13 77 22 17 514 3 addA ATP-dependent helicase/nuclease subunit A Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LPC4 7.27e-07 56 48 2 66 3 addA ATP-dependent helicase/nuclease subunit A Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5M2T7 2.98e-12 74 23 20 558 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8DT76 3e-12 74 23 21 553 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B0K213 3.46e-12 73 21 19 546 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter sp. (strain X514)
B0K213 8.62e-08 59 33 8 171 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter sp. (strain X514)
B0KDB7 3.58e-12 73 21 18 546 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KDB7 8.33e-08 59 33 8 171 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q03IZ8 4.09e-12 73 23 20 558 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q8RCZ0 5.59e-12 73 22 19 531 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RCZ0 4.75e-07 57 31 7 172 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5LY80 6.83e-12 73 23 16 471 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain CNRZ 1066)
B2A610 7.31e-12 72 30 3 162 3 addA ATP-dependent helicase/nuclease subunit A Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2A610 8.17e-05 50 27 6 188 3 addA ATP-dependent helicase/nuclease subunit A Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A4J4E3 3.43e-11 70 22 21 586 3 addA ATP-dependent helicase/nuclease subunit A Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q88U41 1.35e-10 68 23 19 506 3 addA ATP-dependent helicase/nuclease subunit A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A3CNT9 1.57e-10 68 24 18 464 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus sanguinis (strain SK36)
O84645 3.58e-10 67 31 3 138 3 recB RecBCD enzyme subunit RecB Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9PLT8 3.81e-10 67 31 3 144 3 recB RecBCD enzyme subunit RecB Chlamydia muridarum (strain MoPn / Nigg)
B1KUZ8 4.51e-10 67 20 20 556 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Loch Maree / Type A3)
B1KUZ8 0.00026 48 33 5 142 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Loch Maree / Type A3)
P08394 1.07e-09 65 24 21 494 1 recB RecBCD enzyme subunit RecB Escherichia coli (strain K12)
Q97GV3 2.08e-09 65 21 19 547 3 addA ATP-dependent helicase/nuclease subunit A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97GV3 1.22e-07 59 29 6 177 3 addA ATP-dependent helicase/nuclease subunit A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7GAJ8 1.97e-08 61 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A4IKW7 2.13e-08 61 31 7 151 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
A4IKW7 4.48e-08 60 24 8 306 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
A4IKW7 4.48e-05 50 45 1 66 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
Q0AXU8 2.28e-08 61 32 5 138 3 addA ATP-dependent helicase/nuclease subunit A Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AXU8 9e-08 59 33 2 120 3 addA ATP-dependent helicase/nuclease subunit A Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B2GEY4 2.32e-08 61 30 8 175 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A3DH19 3.72e-08 60 33 7 156 3 addA ATP-dependent helicase/nuclease subunit A Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DH19 1.17e-06 55 25 11 290 3 addA ATP-dependent helicase/nuclease subunit A Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DH19 1.39e-06 55 30 4 143 3 addA ATP-dependent helicase/nuclease subunit A Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8K9A9 5.76e-08 60 40 2 86 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9Z7G7 1.94e-07 58 29 2 131 3 recB RecBCD enzyme subunit RecB Chlamydia pneumoniae
B8I2Y2 4.04e-07 57 22 8 337 3 addA ATP-dependent helicase/nuclease subunit A Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B8I2Y2 7.09e-07 56 35 4 105 3 addA ATP-dependent helicase/nuclease subunit A Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q18AN9 4.06e-07 57 28 9 185 3 addA ATP-dependent helicase/nuclease subunit A Clostridioides difficile (strain 630)
Q18AN9 5.69e-06 53 41 2 72 3 addA ATP-dependent helicase/nuclease subunit A Clostridioides difficile (strain 630)
A5N628 4.07e-07 57 33 5 132 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5N628 6.02e-05 50 26 5 148 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZK4 4.35e-07 57 33 5 132 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
B9DZK4 6.73e-05 50 26 5 148 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
A8AY33 1.53e-06 55 30 3 124 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A9KTE6 1.61e-06 55 27 11 247 3 addA ATP-dependent helicase/nuclease subunit A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q8XPE2 1.62e-06 55 46 2 66 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain 13 / Type A)
Q8XPE2 1.32e-05 52 28 5 139 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain 13 / Type A)
Q0SWW4 1.63e-06 55 46 2 66 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain SM101 / Type A)
Q0SWW4 2.72e-05 51 30 4 118 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain SM101 / Type A)
Q0TV46 1.73e-06 55 46 2 66 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TV46 2.68e-05 51 30 4 118 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q2RL77 2.44e-05 51 30 5 136 3 addA ATP-dependent helicase/nuclease subunit A Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P57529 3.83e-05 51 32 5 120 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B0TDI0 3.95e-05 51 28 6 172 3 addA ATP-dependent helicase/nuclease subunit A Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B0TDI0 0.000743 47 24 16 396 3 addA ATP-dependent helicase/nuclease subunit A Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
P45157 4.65e-05 50 38 4 93 3 recB RecBCD enzyme subunit RecB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5D1P3 7.62e-05 50 31 4 130 3 addA ATP-dependent helicase/nuclease subunit A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5D1P3 0.000194 48 26 4 139 3 addA ATP-dependent helicase/nuclease subunit A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q67MD5 0.000163 48 26 8 203 3 addA ATP-dependent helicase/nuclease subunit A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67MD5 0.000245 48 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B1IEN0 0.000308 48 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Okra / Type B1)
C1FSA8 0.000344 48 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Kyoto / Type A2)
C3L047 0.000368 47 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain 657 / Type Ba4)
A7FPG0 0.000371 47 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain ATCC 19397 / Type A)
A5HYY0 0.000378 47 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
Q24WW8 0.000524 47 30 6 136 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain Y51)
B8FXD7 0.000528 47 30 6 136 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
P9WMQ3 0.000719 47 30 4 112 1 recB RecBCD enzyme subunit RecB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMQ2 0.000719 47 30 4 112 3 recB RecBCD enzyme subunit RecB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09565
Feature type CDS
Gene uvrD
Product DNA helicase II
Location 12237 - 14408 (strand: 1)
Length 2172 (nucleotides) / 723 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1350
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00580 UvrD/REP helicase N-terminal domain
PF13361 UvrD-like helicase C-terminal domain
PF21196 PcrA/UvrD tudor domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0210 Replication, recombination and repair (L) L Superfamily I DNA or RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03657 ATP-dependent DNA helicase UvrD/PcrA [EC:5.6.2.4] Nucleotide excision repair
Mismatch repair		 -

Protein Sequence

MEIMDVSYLLEGLNDKQRDAVAAPRSNMLILAGAGSGKTRVLVHRIAWLMAVENASPFSIISVTFTNKAAAEMRHRVEGLVGTSEGGMWIGTFHGLAHRLLRAHHLDAGLPQDFQILDSDDQIRLIRRLIKAMNLDEKQWPAKQGSWYINGKKDEGLRPQHIESYGNPIEATWLKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPAILQHYRNRFTNILVDEFQDTNSIQYAWIRMLAGDTGKVMIVGDDDQSIYGWRGAQVENIQHFLKDFPGATTIRLEQNYRSTNNILKAANALISHNSDRLGKNLWTDGEDGELISLYCAFNDLDEARYVVSRIKQWHENGGALADCAILYRSNAQSRQQEEALLQAAMPYRIYGGQRFFERQEIKDALAYLRLMSNRHDDAAFERVVNTPTRGIGDRTLDVVRQTARDRQLTLWDSCGALLEERALAGRAASALGRFIELINLLAQETDGLPLHVQADRVIRDSGLRAHYEQEKGEKAQARIENLEELVTATNQFSYQDADEGLTPLQAFLSHAALESGESQADAYQDAVQLMTLHSAKGLEFPQVFIVGVEEGMFPGMMSMEESGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPPECVEEVRLRATVSRPVNHQRLGTPITANDSGYTLGQRVRHDKFGEGTIINMEGSGEHCRLQIAFQGEGIKWLVASYAKLVKP

Flanking regions ( +/- flanking 50bp)

ACGGCCGGGGAGGCGTTCTTTCTCTCGCGGCGACAGCCGAACAACCATTGATGGAAATTATGGACGTCTCTTATCTGCTTGAAGGCCTGAATGATAAACAGCGTGATGCGGTGGCAGCTCCCCGCTCAAACATGCTGATTCTGGCGGGGGCCGGGTCCGGAAAAACCCGGGTACTGGTTCACCGTATCGCCTGGCTGATGGCGGTGGAGAATGCGTCTCCTTTTTCCATTATATCGGTCACATTTACCAACAAGGCGGCAGCAGAGATGCGCCACCGTGTTGAAGGGCTGGTCGGTACCAGTGAAGGCGGCATGTGGATTGGTACGTTCCACGGCCTGGCGCACCGTTTGTTACGGGCGCACCATCTTGACGCCGGGCTGCCGCAGGATTTTCAGATCCTCGACAGCGACGACCAGATCCGTCTGATCCGCCGCCTGATAAAAGCCATGAATCTTGATGAAAAACAGTGGCCTGCCAAACAAGGCTCCTGGTACATCAACGGGAAAAAAGACGAAGGTCTGCGCCCGCAACATATTGAAAGTTATGGTAATCCAATTGAAGCCACCTGGCTGAAGGTTTATCAGGCTTATCAGGAAGCCTGTGATCGTGCCGGGCTGGTGGATTTTGCCGAATTACTGCTGCGCGCCCACGAATTGTGGCTGAATAAACCGGCTATTTTGCAGCACTACCGCAACCGTTTTACTAATATTCTGGTGGATGAGTTCCAGGACACCAACAGTATTCAGTACGCCTGGATAAGAATGCTGGCGGGCGATACCGGCAAAGTGATGATTGTCGGGGATGATGATCAGTCAATCTATGGCTGGCGCGGGGCGCAGGTTGAAAACATTCAGCACTTCCTGAAAGATTTCCCCGGGGCAACCACTATCCGCCTGGAGCAGAATTACCGCTCCACCAATAATATCCTGAAAGCGGCTAACGCTCTGATTTCTCACAATAGTGACAGGCTGGGGAAAAATCTTTGGACGGATGGCGAAGATGGCGAGCTGATTTCGCTTTACTGTGCATTTAATGATCTCGATGAAGCCCGTTATGTGGTGAGTCGGATCAAACAGTGGCATGAAAACGGCGGAGCACTGGCAGATTGCGCGATTTTATACCGCAGCAACGCCCAGTCCCGTCAGCAGGAAGAGGCACTGTTACAGGCGGCAATGCCGTACCGCATATACGGCGGTCAGCGCTTCTTTGAACGCCAGGAAATCAAAGATGCCCTTGCGTATCTGCGCCTGATGTCCAACCGCCATGATGATGCGGCTTTTGAGCGCGTGGTGAATACGCCGACCCGTGGTATCGGCGACCGCACACTGGATGTGGTGCGCCAGACCGCCCGTGATCGACAGCTTACTCTCTGGGACAGTTGTGGTGCTCTGCTGGAAGAGCGGGCGCTGGCAGGTCGTGCGGCATCTGCACTGGGGCGTTTTATTGAGCTGATTAACCTGCTGGCACAGGAAACGGACGGACTGCCGCTGCATGTACAGGCTGACCGTGTGATCCGCGATTCCGGTCTGCGCGCGCATTATGAGCAGGAAAAAGGCGAAAAAGCCCAGGCACGTATCGAAAACTTAGAAGAGCTGGTGACGGCAACAAATCAGTTCAGTTATCAGGATGCGGATGAAGGGCTTACGCCGCTTCAGGCATTCTTATCTCATGCGGCGCTGGAGTCCGGCGAAAGCCAGGCAGATGCTTATCAGGACGCGGTTCAGCTGATGACGCTGCACTCGGCAAAAGGGCTTGAGTTCCCGCAGGTCTTTATCGTCGGTGTCGAAGAGGGCATGTTCCCGGGTATGATGTCGATGGAGGAGAGCGGACGCCTGGAAGAAGAGCGGCGTCTCGCGTATGTCGGCGTGACCCGTGCCATGCAGAAATTAACCCTGACGTATGCAGAAACCCGTCGTCTGTACGGCAAAGAAGTGTATCACCGCCCGTCACGGTTTATCGGTGAACTGCCGCCGGAATGTGTGGAAGAGGTGCGCCTGCGTGCCACGGTTTCCCGCCCTGTGAATCATCAGCGGCTCGGCACGCCGATCACCGCCAATGACAGCGGTTATACCCTCGGGCAGCGTGTCCGCCATGATAAATTTGGCGAAGGCACCATCATCAATATGGAAGGCAGCGGCGAGCACTGCCGCCTGCAGATTGCGTTTCAGGGCGAGGGGATCAAATGGCTGGTTGCCTCCTATGCAAAACTCGTAAAACCCTGATCACCGGCAGAGAAGCGGTGTCAATTCGCGAATAAGCGGTTGACACCCTT