Homologs in group_3845
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| PMI_RS14605 | PMI_RS14605 | 46.2 | Proteus mirabilis HI4320 | chbA | PTS N,N'-diacetylchitobiose transporter subunit IIA |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| P69794 | 1.37e-23 | 90 | 47 | 1 | 95 | 3 | chbA | PTS system N,N'-diacetylchitobiose-specific EIIA component | Shigella flexneri |
| P69791 | 1.37e-23 | 90 | 47 | 1 | 95 | 1 | chbA | PTS system N,N'-diacetylchitobiose-specific EIIA component | Escherichia coli (strain K12) |
| P69792 | 1.37e-23 | 90 | 47 | 1 | 95 | 3 | chbA | PTS system N,N'-diacetylchitobiose-specific EIIA component | Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) |
| P69793 | 1.37e-23 | 90 | 47 | 1 | 95 | 3 | chbA | PTS system N,N'-diacetylchitobiose-specific EIIA component | Escherichia coli O157:H7 |
| A2RIE7 | 4.26e-17 | 73 | 40 | 3 | 96 | 2 | ptcA | PTS system galactose-specific EIIA component | Lactococcus lactis subsp. cremoris (strain MG1363) |
| Q9CIE9 | 1.73e-15 | 69 | 41 | 3 | 91 | 2 | ptcA | PTS system cellobiose-specific EIIA component | Lactococcus lactis subsp. lactis (strain IL1403) |
| P46319 | 2.77e-15 | 68 | 41 | 1 | 98 | 2 | licA | Lichenan-specific phosphotransferase enzyme IIA component | Bacillus subtilis (strain 168) |
| Q45402 | 6.2e-15 | 68 | 39 | 2 | 107 | 1 | celD | PTS system cellobiose-specific EIIA component | Geobacillus stearothermophilus |
| Q8CNF6 | 7.07e-12 | 60 | 32 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200) |
| Q5HM39 | 7.07e-12 | 60 | 32 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A) |
| P23532 | 5.8e-11 | 57 | 31 | 1 | 94 | 1 | lacF | PTS system lactose-specific EIIA component | Lactococcus lactis subsp. lactis |
| O05506 | 9.66e-11 | 57 | 34 | 1 | 102 | 1 | gmuA | PTS system oligo-beta-mannoside-specific EIIA component | Bacillus subtilis (strain 168) |
| P11502 | 1.42e-10 | 57 | 35 | 1 | 96 | 1 | lacF | PTS system lactose-specific EIIA component | Lacticaseibacillus casei |
| P26426 | 1.17e-08 | 52 | 31 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Streptococcus mutans serotype c (strain ATCC 700610 / UA159) |
| P0A0D5 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain MW2) |
| P0A0D6 | 1.81e-08 | 51 | 28 | 1 | 91 | 1 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus |
| Q6G7C3 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain MSSA476) |
| Q6GEN8 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain MRSA252) |
| P0A0D4 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain N315) |
| P0A0D3 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain Mu50 / ATCC 700699) |
| Q5HE14 | 1.81e-08 | 51 | 28 | 1 | 91 | 3 | lacF | PTS system lactose-specific EIIA component | Staphylococcus aureus (strain COL) |
| Source | Morganella psychrotolerans |
|---|---|
| Locus tag | F4V73_RS09150 |
| Feature type | CDS |
| Gene | - |
| Product | PTS lactose/cellobiose transporter subunit IIA |
| Location | 1915757 - 1916095 (strand: 1) |
| Length | 339 (nucleotides) / 112 (amino acids) |
| Accession | term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object |
|---|---|
| Length | 2012992 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3845 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
| PF02255 | PTS system, Lactose/Cellobiose specific IIA subunit |
|---|
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG1447 | Carbohydrate transport and metabolism (G) | G | Phosphotransferase system cellobiose-specific component IIA |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K02759 | cellobiose PTS system EIIA component [EC:2.7.1.196 2.7.1.205] | Starch and sucrose metabolism Phosphotransferase system (PTS) |
- |
MTQQTTETDIITLITCAGSARSLVFQAIREARENRDFPHAEILMQQAKEMLSGAHWIQTQLISLDEGEGKIPVTLALVHAQDHLMNAVLLTELGTEIIALHRQIAEKPKDKR
TGGACAGTGGTGCGGTATTAAATCAGGCTCTGGAATTACTGGATTAATCAGTGACACAACAAACAACTGAAACCGATATCATTACACTTATCACCTGTGCGGGAAGCGCCCGCAGTCTGGTATTTCAGGCCATTCGTGAAGCCCGTGAAAACCGTGATTTTCCGCACGCAGAGATACTGATGCAACAAGCAAAAGAAATGCTTTCCGGTGCTCACTGGATTCAGACTCAGCTTATCAGCCTGGATGAGGGAGAGGGAAAAATCCCTGTTACCCTGGCACTGGTACACGCTCAGGATCATCTGATGAACGCTGTCCTGCTGACAGAGCTGGGCACAGAGATTATTGCCCTGCACCGGCAGATTGCAGAAAAACCAAAAGATAAAAGATAAAAGATAAAACCTTCTTCTTCCGGATTCGGGCGTCGGGAAAAACCAAAAAA
