Homologs in group_3857

Help

1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
PMI_RS14605 PMI_RS14605 46.2 Proteus mirabilis HI4320 chbA PTS N,N'-diacetylchitobiose transporter subunit IIA

Distribution of the homologs in the orthogroup group_3857

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3857

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P69794 1.37e-23 90 47 1 95 3 chbA PTS system N,N'-diacetylchitobiose-specific EIIA component Shigella flexneri
P69791 1.37e-23 90 47 1 95 1 chbA PTS system N,N'-diacetylchitobiose-specific EIIA component Escherichia coli (strain K12)
P69792 1.37e-23 90 47 1 95 3 chbA PTS system N,N'-diacetylchitobiose-specific EIIA component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69793 1.37e-23 90 47 1 95 3 chbA PTS system N,N'-diacetylchitobiose-specific EIIA component Escherichia coli O157:H7
A2RIE7 4.26e-17 73 40 3 96 2 ptcA PTS system galactose-specific EIIA component Lactococcus lactis subsp. cremoris (strain MG1363)
Q9CIE9 1.73e-15 69 41 3 91 2 ptcA PTS system cellobiose-specific EIIA component Lactococcus lactis subsp. lactis (strain IL1403)
P46319 2.77e-15 68 41 1 98 2 licA Lichenan-specific phosphotransferase enzyme IIA component Bacillus subtilis (strain 168)
Q45402 6.2e-15 68 39 2 107 1 celD PTS system cellobiose-specific EIIA component Geobacillus stearothermophilus
Q8CNF6 7.07e-12 60 32 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM39 7.07e-12 60 32 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P23532 5.8e-11 57 31 1 94 1 lacF PTS system lactose-specific EIIA component Lactococcus lactis subsp. lactis
O05506 9.66e-11 57 34 1 102 1 gmuA PTS system oligo-beta-mannoside-specific EIIA component Bacillus subtilis (strain 168)
P11502 1.42e-10 57 35 1 96 1 lacF PTS system lactose-specific EIIA component Lacticaseibacillus casei
P26426 1.17e-08 52 31 1 91 3 lacF PTS system lactose-specific EIIA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P0A0D5 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain MW2)
P0A0D6 1.81e-08 51 28 1 91 1 lacF PTS system lactose-specific EIIA component Staphylococcus aureus
Q6G7C3 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain MSSA476)
Q6GEN8 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain MRSA252)
P0A0D4 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain N315)
P0A0D3 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HE14 1.81e-08 51 28 1 91 3 lacF PTS system lactose-specific EIIA component Staphylococcus aureus (strain COL)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09150
Feature type CDS
Gene -
Product PTS lactose/cellobiose transporter subunit IIA
Location 1915757 - 1916095 (strand: 1)
Length 339 (nucleotides) / 112 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3857
Orthogroup size 2
N. genomes 2

Actions

Genomic region

Domains

PF02255 PTS system, Lactose/Cellobiose specific IIA subunit

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1447 Carbohydrate transport and metabolism (G) G Phosphotransferase system cellobiose-specific component IIA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02759 cellobiose PTS system EIIA component [EC:2.7.1.196 2.7.1.205] Starch and sucrose metabolism
Phosphotransferase system (PTS)
-

Protein Sequence

MTQQTTETDIITLITCAGSARSLVFQAIREARENRDFPHAEILMQQAKEMLSGAHWIQTQLISLDEGEGKIPVTLALVHAQDHLMNAVLLTELGTEIIALHRQIAEKPKDKR

Flanking regions ( +/- flanking 50bp)

TGGACAGTGGTGCGGTATTAAATCAGGCTCTGGAATTACTGGATTAATCAGTGACACAACAAACAACTGAAACCGATATCATTACACTTATCACCTGTGCGGGAAGCGCCCGCAGTCTGGTATTTCAGGCCATTCGTGAAGCCCGTGAAAACCGTGATTTTCCGCACGCAGAGATACTGATGCAACAAGCAAAAGAAATGCTTTCCGGTGCTCACTGGATTCAGACTCAGCTTATCAGCCTGGATGAGGGAGAGGGAAAAATCCCTGTTACCCTGGCACTGGTACACGCTCAGGATCATCTGATGAACGCTGTCCTGCTGACAGAGCTGGGCACAGAGATTATTGCCCTGCACCGGCAGATTGCAGAAAAACCAAAAGATAAAAGATAAAAGATAAAACCTTCTTCTTCCGGATTCGGGCGTCGGGAAAAACCAAAAAA