Homologs in group_1671

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11615 FBDBKF_11615 79.0 Morganella morganii S1 zipA cell division protein ZipA
EHELCC_17535 EHELCC_17535 79.0 Morganella morganii S2 zipA cell division protein ZipA
NLDBIP_18745 NLDBIP_18745 79.0 Morganella morganii S4 zipA cell division protein ZipA
LHKJJB_17975 LHKJJB_17975 79.0 Morganella morganii S3 zipA cell division protein ZipA
HKOGLL_18675 HKOGLL_18675 79.0 Morganella morganii S5 zipA cell division protein ZipA
PMI_RS09005 PMI_RS09005 57.0 Proteus mirabilis HI4320 zipA cell division protein ZipA

Distribution of the homologs in the orthogroup group_1671

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1671

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8GHF3 6.69e-93 282 54 6 332 3 zipA Cell division protein ZipA Serratia proteamaculans (strain 568)
Q6D8S6 7.64e-92 279 51 9 341 3 zipA Cell division protein ZipA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JFY9 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668M5 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMG5 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pestis (strain Pestoides F)
Q1CJV8 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH1 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Angola)
P58492 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pestis
B2K918 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5X8 8.73e-92 279 49 7 355 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGC1 5.48e-91 277 49 7 354 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VE39 3.56e-90 274 50 5 326 3 zipA Cell division protein ZipA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NSC1 3.25e-89 273 50 8 335 3 zipA Cell division protein ZipA Sodalis glossinidius (strain morsitans)
C6D9P6 3.8e-88 270 49 9 346 3 zipA Cell division protein ZipA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7N6Y5 4.18e-87 266 50 7 332 3 zipA Cell division protein ZipA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4WD24 1.52e-74 234 45 6 326 3 zipA Cell division protein ZipA Enterobacter sp. (strain 638)
A7MKW3 1.28e-73 232 46 8 340 3 zipA Cell division protein ZipA Cronobacter sakazakii (strain ATCC BAA-894)
A7ZPL3 9.89e-69 220 45 9 344 3 zipA Cell division protein ZipA Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I4Y9 2.13e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli (strain SE11)
A8A2Q8 2.13e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli O9:H4 (strain HS)
B7M6S2 2.13e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli O8 (strain IAI1)
B7LCF7 2.13e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli (strain 55989 / EAEC)
Q3YZD0 2.15e-68 219 46 9 344 3 zipA Cell division protein ZipA Shigella sonnei (strain Ss046)
P77173 2.2e-68 219 46 9 344 1 zipA Cell division protein ZipA Escherichia coli (strain K12)
B1IX59 2.2e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA83 2.2e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / DH10B)
C4ZVU3 2.2e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / MC4100 / BW2952)
Q8X492 2.25e-68 219 46 9 344 3 zipA Cell division protein ZipA Escherichia coli O157:H7
Q31Y67 3.57e-68 219 46 9 344 3 zipA Cell division protein ZipA Shigella boydii serotype 4 (strain Sb227)
Q0TF54 4.85e-67 216 47 11 338 3 zipA Cell division protein ZipA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FFC0 8.05e-67 215 47 11 338 3 zipA Cell division protein ZipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UGB3 1.03e-66 215 47 11 339 3 zipA Cell division protein ZipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QN9 2.38e-66 214 45 9 343 3 zipA Cell division protein ZipA Shigella flexneri
Q1R8W0 3.39e-64 209 46 9 335 3 zipA Cell division protein ZipA Escherichia coli (strain UTI89 / UPEC)
B1LMK6 3.39e-64 209 46 9 335 3 zipA Cell division protein ZipA Escherichia coli (strain SMS-3-5 / SECEC)
A1ADS9 3.39e-64 209 46 9 335 3 zipA Cell division protein ZipA Escherichia coli O1:K1 / APEC
B7MHR6 3.39e-64 209 46 9 335 3 zipA Cell division protein ZipA Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XVT3 1.1e-57 192 60 1 156 3 zipA Cell division protein ZipA Klebsiella pneumoniae (strain 342)
A6TC48 1.49e-57 192 60 1 156 3 zipA Cell division protein ZipA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8ADI1 1.68e-57 192 59 1 156 3 zipA Cell division protein ZipA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1LU19 1.12e-56 187 47 3 196 3 zipA Cell division protein ZipA Baumannia cicadellinicola subsp. Homalodisca coagulata
C4K4K3 2.62e-55 184 35 7 314 3 zipA Cell division protein ZipA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A9MIF9 2.66e-55 186 57 2 157 3 zipA Cell division protein ZipA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F0F6 7.92e-55 184 63 1 135 3 zipA Cell division protein ZipA Salmonella agona (strain SL483)
Q57LT0 9.11e-55 184 57 2 157 3 zipA Cell division protein ZipA Salmonella choleraesuis (strain SC-B67)
B4SZU6 1.18e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella newport (strain SL254)
P0A2N6 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2N7 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella typhi
B5BB71 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain AKU_12601)
A9N361 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PND8 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TCF7 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella heidelberg (strain SL476)
B5RCQ0 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3V5 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella enteritidis PT4 (strain P125109)
B5FQC0 1.31e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella dublin (strain CT_02021853)
C0PZB3 1.43e-54 184 57 2 157 3 zipA Cell division protein ZipA Salmonella paratyphi C (strain RKS4594)
B4TQF9 1.61e-54 184 63 1 135 3 zipA Cell division protein ZipA Salmonella schwarzengrund (strain CVM19633)
B2TWZ6 1.78e-52 178 58 2 156 3 zipA Cell division protein ZipA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32DE1 2.15e-52 178 58 3 156 3 zipA Cell division protein ZipA Shigella dysenteriae serotype 1 (strain Sd197)
B5YZV9 2.15e-52 178 58 3 156 3 zipA Cell division protein ZipA Escherichia coli O157:H7 (strain EC4115 / EHEC)
B5FGU8 5.77e-50 172 36 11 352 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain MJ11)
B6EJQ7 2.11e-48 167 36 9 331 3 zipA Cell division protein ZipA Aliivibrio salmonicida (strain LFI1238)
Q6LTU6 3.34e-48 168 34 6 350 3 zipA Cell division protein ZipA Photobacterium profundum (strain SS9)
Q5E3L0 1.11e-47 166 34 10 356 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q12L81 6.85e-47 164 31 6 338 3 zipA Cell division protein ZipA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0HK32 2.43e-45 160 33 9 350 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-4)
Q0HWD3 3.01e-45 160 33 9 350 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-7)
Q8ED69 1.85e-44 158 32 7 344 3 zipA Cell division protein ZipA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A7MT68 2.13e-44 157 33 9 333 3 zipA Cell division protein ZipA Vibrio campbellii (strain ATCC BAA-1116)
A1S5R6 3.21e-44 157 32 9 352 3 zipA Cell division protein ZipA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TKB3 1.71e-43 154 34 10 325 3 zipA Cell division protein ZipA Shewanella halifaxensis (strain HAW-EB4)
Q87RJ5 3.93e-43 154 32 5 321 3 zipA Cell division protein ZipA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8H375 4.83e-43 154 33 8 332 3 zipA Cell division protein ZipA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0KVI3 9.16e-43 153 33 9 350 3 zipA Cell division protein ZipA Shewanella sp. (strain ANA-3)
A4Y803 1.69e-41 150 30 7 352 3 zipA Cell division protein ZipA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C4LAQ5 2.49e-41 147 32 8 325 3 zipA Cell division protein ZipA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B1KJT6 3.52e-41 148 33 7 324 3 zipA Cell division protein ZipA Shewanella woodyi (strain ATCC 51908 / MS32)
A3QFJ6 4.69e-41 149 32 9 354 3 zipA Cell division protein ZipA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9L5Z2 9.05e-41 148 30 9 366 3 zipA Cell division protein ZipA Shewanella baltica (strain OS195)
A6WPS6 9.05e-41 148 30 9 366 3 zipA Cell division protein ZipA Shewanella baltica (strain OS185)
A1RII6 1.73e-40 147 30 7 352 3 zipA Cell division protein ZipA Shewanella sp. (strain W3-18-1)
Q080K8 1.92e-37 139 30 9 350 3 zipA Cell division protein ZipA Shewanella frigidimarina (strain NCIMB 400)
A8FU25 2.13e-36 136 29 9 350 3 zipA Cell division protein ZipA Shewanella sediminis (strain HAW-EB3)
B0US80 1.61e-35 134 29 9 336 3 zipA Cell division protein ZipA Histophilus somni (strain 2336)
Q0I2I2 3.05e-35 133 29 9 336 3 zipA Cell division protein ZipA Histophilus somni (strain 129Pt)
A1TZT8 2.07e-29 118 29 8 345 3 zipA Cell division protein ZipA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q65RN5 2.3e-29 118 28 7 362 3 zipA Cell division protein ZipA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UD03 3.24e-29 117 26 10 348 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittEE)
P44113 5.42e-29 116 25 7 332 3 zipA Cell division protein ZipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UIM7 1.64e-28 115 27 12 347 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittGG)
Q4QLI9 2.4e-28 115 27 12 347 3 zipA Cell division protein ZipA Haemophilus influenzae (strain 86-028NP)
Q1ICK1 1.66e-26 109 28 7 315 3 zipA Cell division protein ZipA Pseudomonas entomophila (strain L48)
A6VR17 4.54e-26 108 29 10 331 3 zipA Cell division protein ZipA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CKC8 8.19e-26 108 26 6 315 3 zipA Cell division protein ZipA Pasteurella multocida (strain Pm70)
Q9I3I5 2.24e-25 106 29 8 310 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ4 2.24e-25 106 29 8 310 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain LESB58)
A6V7X4 5.68e-25 105 28 8 314 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain PA7)
C3JYN4 8.68e-25 104 35 2 165 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain SBW25)
A4VKM9 9.32e-25 103 37 1 143 3 zipA Cell division protein ZipA Stutzerimonas stutzeri (strain A1501)
Q02K11 1.88e-24 103 28 8 311 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3KFB3 1.94e-24 103 37 2 159 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain Pf0-1)
A4XVY6 5.2e-24 102 35 3 171 3 zipA Cell division protein ZipA Pseudomonas mendocina (strain ymp)
C1DN28 6.32e-24 102 37 0 130 3 zipA Cell division protein ZipA Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4KFH2 8.17e-24 101 35 1 153 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q47YH9 1.91e-23 102 39 1 131 3 zipA Cell division protein ZipA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7VMX6 5.34e-23 100 37 1 129 3 zipA Cell division protein ZipA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BQN7 7.28e-23 100 35 2 144 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8F313 9.94e-23 98 38 1 128 3 zipA Cell division protein ZipA Glaesserella parasuis serovar 5 (strain SH0165)
Q88F24 1.62e-22 98 35 1 170 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B3H276 1.92e-22 99 34 2 144 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1V3 4.87e-22 97 34 2 144 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0KPX4 5.25e-22 97 38 0 130 3 zipA Cell division protein ZipA Pseudomonas putida (strain GB-1)
Q4ZVF7 7.04e-22 96 37 0 130 3 zipA Cell division protein ZipA Pseudomonas syringae pv. syringae (strain B728a)
Q48KR3 9.66e-22 96 37 0 130 3 zipA Cell division protein ZipA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5W0T9 1.01e-21 96 38 0 130 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JC07 1.17e-21 96 38 0 130 3 zipA Cell division protein ZipA Pseudomonas putida (strain W619)
Q87YY5 1.22e-21 95 37 0 130 3 zipA Cell division protein ZipA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3BV17 2.01e-19 89 35 0 129 3 zipA Cell division protein ZipA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PAB7 2.11e-19 89 35 0 129 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTA8 2.11e-19 89 35 0 129 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain 8004)
Q8PM10 9.96e-19 87 34 0 129 3 zipA Cell division protein ZipA Xanthomonas axonopodis pv. citri (strain 306)
Q87A87 1.54e-18 86 32 3 172 3 zipA Cell division protein ZipA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PAG1 8.19e-18 84 31 2 169 3 zipA Cell division protein ZipA Xylella fastidiosa (strain 9a5c)
C3LTL8 1.86e-10 64 57 0 49 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain M66-2)
Q9KTD2 1.86e-10 64 57 0 49 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2W2 1.86e-10 64 57 0 49 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DFK4 2e-09 61 59 0 42 3 zipA Cell division protein ZipA Vibrio vulnificus (strain CMCP6)
Q7MMT6 2.02e-09 61 59 0 42 3 zipA Cell division protein ZipA Vibrio vulnificus (strain YJ016)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08065
Feature type CDS
Gene zipA
Product cell division protein ZipA
Location 1674481 - 1675449 (strand: -1)
Length 969 (nucleotides) / 322 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1671
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04354 ZipA, C-terminal FtsZ-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3115 Cell cycle control, cell division, chromosome partitioning (D) D Cell division protein ZipA, interacts with FtsZ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03528 cell division protein ZipA - -

Protein Sequence

MMQDLRLILIVVGAVAIIALLLHGLWTSRKERSSLFRARPMKRRKHEPQDDAADEQSEARGSRHSALPENTSSQTDSQDPLLSAGNNMYPPSEPVVPSVLPKAAAERRPAKSPESEPQIGLFDAIEQEAHTEPVAQVLTTGAVITAAETAEPDVPQDNDNEPAPVSAPQEQEQPAAKNSGAEKELVLALFVAAHQGQLIAGETLRIAVEQAGFRFGAMNIYHRHVDPAGSGPVLFSLANMVNPGTFVPEQMDAIETPGVAMFMMVPSYGDANQNFKLMLQAGQRIASDVGGVVLDDERRILTPQKIEVYKARIRKVLVCTQS

Flanking regions ( +/- flanking 50bp)

ATGATAGTATTTTGCCATGGTGGCCTTTAATTTAAACAACAGAGATAGCACTGATGCAAGATTTGCGTCTGATATTAATCGTTGTGGGTGCGGTAGCAATCATCGCTTTGTTACTTCACGGACTGTGGACGAGCCGCAAAGAGCGCTCATCCCTGTTTCGCGCGCGTCCCATGAAGCGTCGAAAACACGAACCGCAGGATGATGCCGCTGATGAACAGTCAGAGGCGCGGGGTTCCCGTCATTCTGCTTTGCCGGAAAATACGTCGTCGCAGACAGACTCACAGGATCCTCTGTTATCTGCGGGTAATAATATGTATCCGCCGTCAGAGCCGGTTGTGCCTTCCGTTTTGCCGAAAGCGGCTGCTGAACGCCGTCCGGCTAAATCCCCTGAATCTGAGCCACAGATTGGTTTATTTGATGCCATAGAGCAGGAAGCTCACACTGAGCCTGTTGCACAAGTGCTGACTACCGGTGCGGTGATTACTGCGGCAGAAACAGCAGAACCGGATGTGCCGCAGGATAATGATAATGAACCAGCACCCGTATCCGCACCGCAGGAGCAGGAACAGCCTGCTGCTAAAAACAGCGGCGCGGAAAAGGAACTGGTGCTGGCGCTGTTTGTTGCTGCGCATCAGGGACAGCTTATCGCCGGTGAGACACTGCGTATTGCTGTCGAACAGGCAGGCTTTCGTTTCGGTGCCATGAATATTTATCACCGCCATGTTGATCCTGCGGGCAGCGGACCTGTGCTGTTCAGTCTGGCAAACATGGTGAATCCGGGAACTTTTGTGCCCGAGCAGATGGACGCCATTGAAACACCCGGTGTGGCGATGTTTATGATGGTACCGTCTTACGGCGACGCGAATCAGAACTTTAAGCTGATGTTGCAGGCCGGACAGCGTATCGCCTCTGACGTGGGCGGCGTGGTACTTGATGATGAACGCAGAATATTAACACCACAAAAAATTGAGGTGTATAAAGCGCGTATCAGGAAAGTCCTTGTCTGCACTCAGTCCTGACGGATATATACCCGACGTCATTCGTGATGCAGGCAGGCGGCAAGGGAAGA